Molecular cloning, characterization and functional ...

Comparative Biochemistry and Physiology, Part B 176 (2014) 34–41

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Molecular cloning, characterization and functional analysis of QRFP in orange-spotted grouper (Epinephelus coioides) Hu Shu a,⁎, Huapu Chen b,e,⁎⁎, Yun Liu c, Lidong Yang a, Yuqing Yang d, Haifa Zhang d a

School of Life Sciences, Guangzhou University, Guangzhou 510006, China Fisheries College, Guangdong Ocean University, Zhanjiang 524088, China School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong, China d Guangdong Daya Bay Fisheries Development Center, Huizhou 516081, China e Zebrafish Platform, Affiliated Hospital of Guangdong Medical College, Guangdong Medical College, Zhanjiang 524001, China b c

a r t i c l e

i n f o

Article history: Received 26 April 2014 Received in revised form 24 July 2014 Accepted 25 July 2014 Available online 4 August 2014 Keywords: QRFP Orange-spotted grouper Feeding Reproduction

a b s t r a c t The peptide QRFP plays an important role in the regulation of vertebrate feeding behavior. In this study, we cloned the full length cDNA of a QRFP precursor in a teleost fish, the orange-spotted grouper (Epinephelus coioides). Sequence analysis has shown that the functional regions of QRFP in other vertebrates (QRFP-25 and QRFP-7) are conserved in orange-spotted grouper. RT-PCR demonstrated that the pre-processed mRNA of QRFP is widely expressed in orange-spotted grouper. Three days of food deprivation did not change the hypothalamic pre-processed QRFP expression. However, QRFP expression significantly increased when the fish were reefed after three days of fasting. Intraperitoneal injection of QRFP-25 peptide to orange-spotted grouper suppressed expression of orexin, but elevated expression of pro-opiomelanocortin (POMC) in the hypothalamus. We also investigated the effects of QRFP-25 on the expression of reproductive genes. The peptide suppressed the expression of seabream-type gonadotropin-releasing hormones (sbGnRH), luteinizing hormone beta subunit (LHβ) and follicle-stimulating hormone beta subunit (FSHβ) in vivo, as well as inhibited the expression of LHβ and FSHβ in pituitary cells in primary culture. Our results indicate that QRFP may play an inhibitory role in the regulation of feeding behavior and reproduction in orange-spotted grouper. © 2014 Elsevier Inc. All rights reserved.

1. Introduction The pyroglutamylated arginine-phenylalanine-amide peptide (QRFP), also called 26RFa, is a member of the RF-amide peptide family and was originally isolated from frog brain (Chartrel et al., 2003). The orthologues of QRFP have been identified in mammals (Chartrel et al., 2003; Fukusumi et al., 2003), birds (Ukena et al., 2010; Tobari et al., 2011) and teleost fish (Liu et al., 2009). The biological activity of QRFP is mediated by the endogenous receptor GPR103 (G protein-coupled receptor 103) that is a 7-transmembrane G protein-coupled receptor (Chartrel et al., 2003; Fukusumi et al., 2003). The expression of QRFP is mainly detected in the hypothalamus of several species (Chartrel et al., 2003; Fukusumi et al., 2003; Bruzzone et al., 2006; Liu et al., 2009; Ukena et al., 2010; Tobari et al., 2011). Detailed localization analyses in rats have shown that QRFP neurons are located in the ventromedial hypothalamic nucleus, the lateral hypothalamic area, the arcuate nucleus, and the retrochiasmatic area, ⁎ Corresponding author at: School of Life Sciences, Guangzhou University, Guangzhou 510006, China. Tel./fax: +86 20 39366915. ⁎⁎ Correspondence to: H. Chen, Fisheries College, Guangdong Ocean University, Zhanjiang 524088, China. Tel.: +86 759 2383124; fax: +86 759 2382459. E-mail addresses: [email protected] (H. Shu), [email protected] (H. Chen).

http://dx.doi.org/10.1016/j.cbpb.2014.07.005 1096-4959/© 2014 Elsevier Inc. All rights reserved.

suggesting that the peptide's role is related to the regulation of food intake and energy expenditure (Chartrel et al., 2003, 2006; Fukusumi et al., 2003). Additionally, hypothalamic prepro-QRFP mRNA expression is elevated after food deprivation in mouse (Takayasu et al., 2006) and goldfish (Liu et al., 2009). Administration of QRFP peptides (QRFP-43, QRFP-26) could effectively stimulate food intake in birds (Ukena et al., 2010; Tobari et al., 2011) and rodents (Chartrel et al., 2003; Moriya et al., 2006; Takayasu et al., 2006; Primeaux, 2011). These data indicate that QRFP is an orexigenic peptide in vertebrates. Several lines of evidence have shown that QRFP can increase aldosterone levels (Fukusumi et al., 2003), inhibit insulin secretion (Egido et al., 2007), and promote secretion of gonadotropin in rats (Navarro et al., 2006). Although studies in goldfish have indicated that QRFP affects the regulation pathway of energy homeostasis and the hypothalamic– pituitary–gonadal (HPG) axis (Liu et al., 2009), there is still much work to clarify the roles of this peptide in teleost fish. The orangespotted grouper (Epinephelus coioides) is a protogynous hermaphroditic marine teleost that is commercially important and frequently cultured. In this study, using the orange-spotted grouper as an experimental model, we cloned the full-length cDNA encoding the QRFP peptide. Subsequently, we examined the expression of QRFP precursor mRNA in the hypothalamus after food deprivation. Finally, we investigated

H. Shu et al. / Comparative Biochemistry and Physiology, Part B 176 (2014) 34–41

the possible roles that QRFP peptides play in the regulation of food intake control and reproduction.

2. Material and methods

35

The signal peptide and the neuropeptide prohormone cleavage sites of QRFP were predicted using Signal P 3.0 (Bendtsen et al., 2004) and Neuropred software (Southey et al., 2006), respectively. Amino acid sequences of QRFP's precursor were aligned with Clustal X 1.81 (Thompson et al., 1994), and the phylogenetic tree was constructed in Mega 4.0 using the neighbor-joining method (Kumar et al., 2004).

2.1. Experimental animals and chemicals Groupers (E. coioides) were obtained from Guangdong Daya Bay Fishery Development Center (Huizhou City 516081, Guangdong, P. R. China). Female fish were anesthetized with tricaine methanesulfonate (MS222) and sacrificed by decapitation. Tissues were sampled and frozen immediately in liquid nitrogen, and stored at −80 °C until RNA extraction. Peptides corresponding to orange-spotted grouper QRFP-25 and QRFP-7 peptides were synthesized by GL Biochem, Shanghai, China. The purity was N95% as determined by analytical HPLC.

2.2. Cloning of grouper QRFP precursor cDNA and sequence analysis Total RNA was extracted from brain tissue using Trizol reagent (Invitrogen, USA). The isolated RNA was used to synthesize the firststrand cDNA using the ReverTra Ace-α First-strand cDNA Synthesis Kit (TOYOBO, Japan). To amplify cDNA fragments of grouper QRFP cDNA, degenerate PCR primers were designed based on the conserved nucleotide sequences of the QRFP peptide of other fish as available in the GenBank database. Full-length cDNA sequences encoding QRFP were obtained by using the SMART 5′- and 3′-rapid amplification of cDNA ends (RACE) kit (BD Biosciences Clontech). All primers used in the present study are listed in Table 1. Amplifications for PCR were performed as follows: denaturation at 94 °C for 3 min, followed by 35 cycles at 94 °C for 15 s, 53–58 °C for 15 s and 72 °C for 0.5–1.5 min. The reaction finished with a final extension of 10 min at 72 °C in the PTC-200 thermocycler (MJ Research, Watertown, MA, USA). PCR amplification products were examined with 1.5% agarose gel dyed by ethidium bromide (EB), purified using the E.Z.N.A. Gel Extraction Kit (Omega BioTek, USA), and ligased into the pTZ57R/T vector (Fermentas, USA). Three positive clones were sequenced on an ABI 3700 sequencer (Applied Biosystems).

2.3. Tissue distribution and expression of QRFP precursor mRNA Total RNA was isolated from different tissues of female orangespotted groupers including the olfactory bulb, the telencephalon, the optic tectum–thalamus, the cerebellum, the hypothalamus, the medulla oblongata, the pituitary, gill, eye, liver, stomach, intestines, kidney, heart, spleen and ovary. After checking the concentrations and the qualities of total RNA of each sample, 1 μg of total RNA from each tissue was digested with DNase I and reverse-transcribed into cDNA using the ReverTra Ace-α First-strand cDNA Synthesis Kit (TOYOBO, Japan). The amplification regime was 40 cycles of 95 °C for 15 s, 55 °C for 12 s, and 72 °C for 40 s, followed by a further amplification at 72 °C for 5 min. The 18 s was used as the internal control by performing PCR with the same samples above. PCR products were separated on a 1.5% agarose gel and visualized with EB.

2.4. Feeding regimes Eight-month-old female groupers (mass 52–60 g, body length 13–15 cm) for the short-term fasting experiment were cultured in indoor tanks filled with circulating seawater at a temperature between 24.5 °C and 29.2 °C in October–November 2012. Fish were divided into three groups (n = 8/group) for the shortterm fasting experiment (3 days), and fed with commercial food once a day at 9 a.m. Then as the start of the fast, one group of fish was fed daily for 3 days while the other two groups were not fed. At the end of the 3-day fast, one of the unfed groups was allowed to resume feeding. The hypothalamus of all three groups was sampled 3 h after the scheduled feeding time at the end of the experiment. The samples were quickly dissected out and frozen immediately in liquid nitrogen, then stored at −80 °C before RNA extraction.

Table 1 Sequences of PCR primers. Gene

Purpose

Primer

5′to 3′ sequence

QRFP

5′RACE PCR

R2 (first) R3 (nest) F2 (first) F3 (nest) F4 R4 F5 R5 F R F R F R F R F R F R F R

ACAGTGCATCTTGCCTACG CATCTCCTCACAGCTTCACC AANGANGCYCTGACCTCCAT CCGGNGGMCTYCANGCYGTC AAGCAGTGGTATCAACGCAGAG GTTCCACTTATTCTCCTCCGTAC GAGAAAGGAGGATTCGGGTTC ACAGTGCATCTTGCCTACG ACCGAGTACATCTACACCACCA GCAGTACGTGTTTCCTGCGTTA ACAGGTTGGCAGAGTGATGTTC CTTGATGACAGGGTCCTTGGTG CAAGAACAAATCAGAGACGC GTGTGTCCACGTGTGGAAACC ACGGTCCCACAGTCAAGATAC GCGGCTCATAGAGGTAAAGG ATGTGTCCTGCGTGGCTTTTG CTCGGCTGACTCTTCTTCTAC TGTTGCTTTGTCGCTCTGG TCTTCAGTCCTCTTGCCCAT CCTGAGAAACGGCTACCACATCC AGCAACTTTAGTATACGCTATTGGAG

3′RACE PCR ORF PCR Real-time and tissue distribution PCR FSHβ

Real-time PCR

LHβ

Real-time PCR

sbGnRH

Real-time PCR

NPY

Real-time PCR

POMC

Real-time PCR

Orexin

Real-time PCR

18s

Real-time and tissue distribution PCR

Mixed bases: W: A/T; Y: C/T; R: A/G; M: A/C; S: G/C; K: G/T.

36


2.5. In vivo effect of QRFP-25 and QRFP-7 on the expression of NPY, orexin, POMC, sbGnRH and GtH

The pituitary cells were harvested after incubation for 6 h, and were stored at −80 °C before RNA extraction.

A separate group of eight-month-old females (mass 52–60 g, body length 13–15 cm) used for in vivo experiment was cultured in indoor tanks with circulating sea water at a temperature between 24.5 °C and 29.2 °C. Fish were allowed to acclimatize to the environment for 2 weeks, and fed on commercially available fish foods without any supplemented hormones. The test peptide was dissolved in a vehicle of 0.7% NaCl. Fish were anesthetized with 0.05% MS222, and then intraperitoneally injected with the test peptides: negative control fish were administrated with 0.7% NaCl only, while experimental fish were injected with QRFP-25 and QRFP-7 peptides with the doses of 0.01, 0.1 and 1 μg/g body mass. The hypothalamus and pituitary were sampled 6 h after the injection and frozen immediately in liquid nitrogen, then stored at −80 °C before RNA extraction.

2.7. Quantitative real-time PCR

2.6. In vitro effect of QRFP-25 and QRFP-7 on the expression of GtH from pituitary cells in primary culture Groupers (mass 500–600 g, body length 25–28 cm) were anesthetized in 0.05% MS222 before decapitation. The pituitary glands were removed and washed three times with Hanks' balanced salt solution (HBSS). Pituitaries were diced into small pieces of 1 mm3 dimension, and digested with 1 mg/mL trypsin (Invitrogen, USA) at 25 °C for 60 min. The protease digestion was terminated by 1 mg/mL trypsin inhibitor (Sigma-Aldrich, USA). After further digestion with 25 mg/mL DNase I (Invitrogen, USA), pituitary cells were then washed with HBSS solution containing 1 mM EGTA and filtered through a 100 μm nylon membrane. Pituitary cells were harvested by centrifugation (200 g for 15 min) and were resuspended in Hanks salt medium 199 (M199). Viability of the cells was 90%, as determined with the Trypan-blue staining method. Cells were seeded at a density of 2.5 × 105 cells/well on poly-L-lysine-coated 24-well dishes in 1 mL M199 containing 100 U/mL penicillin, 100 mg/mL streptomycin, and 5% fetal bovine serum (FBS). After preincubation at 25 °C for 24 h under 5% CO2, the medium was aspirated away and replaced with a fresh medium containing the doses of 100 nM test peptides (QRFP-25 and QRFP-7).

Quantitative real-time PCR was performed on a Roche LightCycler 480 real-time PCR system using SYBR Green Real-time PCR Master Mix (TOYOBO, Japan) according to the manufacturer's protocol. PCR conditions were as follows: denaturation at 94 °C for 2 min, followed by 40 cycles at 94 °C for 15 s, 58 °C for 15 s and 72 °C for 20 s. Standard curves of amplification for the prepro-QRFP, neturopetide Y (NPY), orexin, POMC, sbGnRH, FSHβ, LHβ and 18s genes were generated using serial dilutions of plasmid constructs as the templates. After amplification, fluorescent data were converted to threshold cycle values (CT). Concentration of the template in the sample was determined by relating the CT value to the standard curve. The corresponding gene transcript levels were compared with the 18s gene transcript. 2.8. Statistical analyses All data are expressed as mean values ± S.E.M. Statistical differences were assessed with a one-way ANOVA followed by a Duncan's multiple range test. A probability level less than 0.05 (P b 0.05) was used as the definition of statistical significance. All analyses were performed using the software SPSS 13.0 (SPSS, Chicago, IL, USA). 3. Results 3.1. Cloning and sequence analysis of the QRFP precursor cDNA The orange-spotted grouper QRFP precursor cDNA contained an ORF of 498 bp, a 71 bp 5′UTR and a 333 bp 3′UTR. The ORF encodes a 165-aa pro-peptide with the putative mature peptides 25RFa and 7RFa located at the C-terminal (Fig. 1). Multiple sequence alignment of the known QRFP precursors revealed that they share low overall amino acid identities. However, the function-related regions were relatively conserved. The QRFP peptides in grouper, medaka (Japanese rice fish), goldfish and zebrafish contain 25 amino acids, but those of other vertebrates contain 26 amino

Fig. 1. Nucleotide sequence and deduced amino acid sequence of the orange-spotted grouper QRFP precursor cDNA. The signal peptide was in italics. The predicted mature peptide QRFP-25 was underlined. QRFP-7 was marked by black triangles. The stop codon was marked with an asterisk.


37

acids (Fig. 2). A phylogenetic tree showed that the orange-spotted grouper QRFP precursors clustered in the clade of QRFP (Fig. 3).

elevated in the hypothalamus in fish that were re-fed after the food deprivation (Fig. 5).

3.2. Expression pattern of prepro-QRFP in grouper tissues

3.4. In vivo effects of QRFP-25 and QRFP-7 on the hypothalamic expression of NPY, orexin and POMC

The mRNA expression of prepro-QRFP in various tissues was studied using RT-PCR. Prepro-QRFP was expressed in almost all tissues examined except the medulla; it was highly expressed in the olfactory bulb, pituitary gland and gill filaments, with moderate expression in the hypothalamus and other tissues (Fig. 4). 3.3. Effect of food deprivation on the hypothalamic mRNA level of prepro-QRFP The amount of prepro-QRFP mRNA after food deprivation was investigated with quantitative real-time PCR. Grouper hypothalamic preproQRFP expression did not significantly change after three days of food deprivation. However, prepro-QRFP mRNA expression was significantly

We next investigated whether peripheral administration of QRFP peptides could regulate neuropeptide-encoding genes involved in the control of food intake. Injection of grouper QRFP-25 could significantly suppress the expression of hypothalamic orexin and promote the expression of POMC. However, peripheral administration of QRFP-25 did not significantly change hypothalamic NPY expression. The QRFP-7 treatment showed no effect on the expression of NPY, orexin and POMC (Fig. 6). 3.5. Effects of QRFP-25 and QRFP-7 on the expression of sbGnRH and GtH The actions of QRFP-25 and QRFP-7 on the expression of sbGnRH and GtH were also investigated in vivo and in vitro. As shown in Fig. 7,

Fig. 2. Comparison of amino acid sequences of QRFP precursor from different species. Multiple sequence alignment was performed by Clustal X1.81. QRFP-26/-25 was in bold and underlined. QRFP-43 in human, sheep and frog, and QRFP-42 in zebra finch were in the broken box.

38


Human QRFP

86 97

Mouse QRFP

55

Sheep QRFP

74

Western clawed frog QRFP Zebra Finch QRFP 87

Japanese quail QRFP 100

Goldfish QRFP Zebrafish QRFP

99

Medaka QRFP 99

Grouper QRFP Zebrafish GnIH Japanese quail GnIH

100 98

Rat GnIH

0.2 Fig. 3. Phylogenetic analysis of QRFP precursor. The phylogenetic tree was constructed by MEGA 4.0 using neighbor-joining method. The numerals represent the reliability. Scale bar refers to a phylogenetic distance of 0.2 amino acid substitutions per site. The GenBank accession numbers of the sequences used in the phylogenetic analysis are: human QRFP (NP_937823), mouse QRFP (AAH94274), sheep QRFP (XP_004073955), zebra finch QRFP (XP_004174391), Japanese quail QRFP (BAI81890), Western clawed frog QRFP (XP_004916730), goldfish QRFP (ACI46681), zebrafish QRFP (XP_001338837), medaka QRFP (XP_004073955), zebrafish GnIH (NP_001076418), Japanese quail GnIH (Q9DGD4) and rat GnIH (EDL88193).

grouper QRFP-25 significantly suppressed the hypothalamic expression of sbGnRH 6 h after injection of QRFP-25 at a dose of 0.1 μg/g body mass. The expression of LHβ and FSHβ in pituitary was decreased 6 h after injection at the doses of 0.1 and 1 μg/g body mass. The in vitro effect of QRFP-25 and QRFP-7 on the expression of GtH was examined in the primary cultures of pituitary cells. As shown in Fig. 8, 100 nM of QRFP-25 significantly decreased the expression of LHβ and FSHβ after 6 h incubation. Treatment with QRFP-7 did not significantly change the expression of sbGnRH, LHβ and FSHβ in vivo and in vitro.

contains only two putative peptides (25RFa and 7 RFa), as does the QRFP precursor of the goldfish (Liu et al., 2009). Previous studies have shown that the hypothalamus is the main organ where prepro-QRFP is expressed in mammals (Chartrel et al., 2003; Fukusumi et al., 2003; Bruzzone et al., 2006), birds (Ukena et al., 2010; Tobari et al., 2011) and goldfish (Liu et al., 2009). The QRFP function in the hypothalamus is thought to be involved in the regulation of energy homeostasis and reproductive control (Chartrel et al., 2003; Fukusumi et al., 2003; Bruzzone et al., 2006; Liu et al., 2009; Ukena et al., 2010; Tobari et al., 2011). Our RT-PCR analysis revealed that the prepro-QRFP of orange-spotted grouper is moderately expressed in the hypothalamus, suggesting roles in feeding and reproductive control in the central nervous system. Furthermore, the expression of preproQRFP mRNA in the pituitary has also been reported in goldfish and other vertebrates (Chartrel et al., 2003; Fukusumi et al., 2003; Liu et al., 2009; Ukena et al., 2010; Tobari et al., 2011). High expression of prepro-QRFP was detected in the pituitary of orange-spotted grouper, suggesting a possible role of QRFP in the regulation of pituitary function. To investigate the role of QRFP in the regulation of energy homeostasis in orange-spotted grouper, the mRNA level of prepro-QRFP was examined in fish with a negative energy balance caused by fasting. Unexpectedly, the hypothalamic expression of prepro-QRFP in orangespotted grouper did not change significantly after three days of food deprivation, but the resumption of feeding caused up-regulation of prepro-QRFP expression. This result is different from the findings in goldfish (Liu et al., 2009) and mouse (Takayasu et al., 2006). Increased hypothalamic expression of prepro-QRFP was observed in these species after food deprivation, suggesting an orexigenic role of QRFP (Takayasu et al., 2006; Liu et al., 2009). Additional evidence for this function of QRFP is that administration of QRFP-26 increased food intake in mouse, rat and zebra finch (Chartrel et al., 2003; Moriya et al., 2006;

4. Discussion In the present study, we successfully isolated the QRFP cDNA from the orange-spotted grouper and investigated the biological activity of QRFP peptides. Although the QRFP precursor in this species has a low overall similarity to that of other vertebrates, we found that the RF-amide C-terminal motif – unique to QRFP – is conserved, providing the evidence for the authenticity of the cloned QRFP. It has been reported that the length of the core peptide QRFP is variable, ranging in size from 24 to 27 amino acids in different vertebrate classes (Liu et al., 2009). In the orange-spotted grouper, the QRFP compartment contained only 25 amino acids. Sequence alignment revealed that QRFP compartments exhibit low similarity at the N-terminal region. It's not clear whether differences in length and composition in the N-terminal region of QRFP would result in functional differences. Additionally, the QRFP precursor contains several potential cleavage sites and so may generate peptides with varying lengths in vertebrates. For example, four putative peptides (43RFa, 26RFa, 9 RFa and 7 RFa) were found in the human QRFP precursor (Chartrel et al., 2003). However, the grouper QRFP precursor

O

SP K IN ST L

H

G

E

P HY MO CE OTT TE OB B

18s Prepro-QRFP Fig. 4. RT-PCR analysis for tissue distribution of prepro-QRFP mRNA in orange-spotted grouper. 18s is used as an internal control. B, brain; OB, olfactory bulbs; TE, telencephalon; OTT, optic tectum–thalamus; CE, cerebellum; MO, medulla oblongata; HY, hypothalamus; P, pituitary; E, eye; G, gill; H, heart; L, liver; ST, stomach; K, kidney; Sp, spleen; O, ovary.


prepro-QRFP

0.04

0.02

0.00 Fed

Unfed

Refed

Fig. 5. Relative mRNA expressions of grouper prepro-QRFP after food deprivation and refeeding. The mRNA levels of prepro-QRFP were quantified by real-time PCR and 18s is used as the internal reference. Values represent as mean ± S.E.M. (n = 5–7). *P b 0.05 versus corresponding controls.

Takayasu et al., 2006; Ukena et al., 2010; Primeaux, 2011; Tobari et al., 2011). In orange-spotted grouper, hypothalamic prepro-QRFP was also sensitive to metabolic signals, but it seems to play a distinctive role in the regulation of energy homeostasis and food intake. The NPY and POMC in hypothalamus are the two main regulators involving in stimulating or inhibiting feeding, respectively (Kalra et al., 1999; Schwartz et al., 2000; Cerdá-Reverter and Peter, 2003; Valassi et al., 2008). Central administration of QRFP-26 stimulated NPY expression, but decreased POMC expression in the hypothalamus (Lectez et al., 2009). These data suggested that the orexigenic effect of QRFP was mediated by NPY and POMC. In our study, the interactions between QRFP peptides and factors related to feeding were also examined. However, intraperitoneal injection of QRFP-25 did not change hypothalamic NPY expression levels, yet promoted POMC expression and decreased orexin expression. It has been demonstrated that orexin peptides increased hypothalamic NPY expression in orange-spotted grouper (Yan et al., 2011). Our data indicated that the orexigenic function of QRFP is not conserved in the orange-spotted grouper. Although several studies have demonstrated the orexigenic effect of QRFP in various species (Chartrel et al., 2003; Moriya et al., 2006; Takayasu et al., 2006; Ukena et al., 2010; Primeaux, 2011; Tobari et al., 2011), the functional roles of QRFP in regulation of the food intake may differ among species. For example, QRFP-26 did not increase food intake in layer chicks (Ukena et al., 2010), and did not affect food consumption in rats that were fed normally (Fukusumi et al., 2003; Kampe et al., 2006). It has been proposed that the effect of QRFP on feeding behavior is species specific and/or that it differs according to energy status (Ukena et al., 2013). In the present study, the up-regulation of anorexigenic factor and down-regulation of orexigenic factor induced by QRFP-25 suggest an anorexigenic role of QRFP in the grouper. Further studies are highly warranted to investigate whether the grouper QRFP-25 could inhibit food intake in the grouper. QRFP peptides have been implicated in regulation of the HPG axis, stimulating LH release in rat (Navarro et al., 2006) and goldfish (Liu et al., 2009). However, in the present study, it was observed that QRFP-25 decreased the mRNA expression of sbGnRH, LHβ and FSHβ. Thus, it seems that the role of QRFP in regulating the HPG axis varies in different species. Along with species differences, the reproductive stage of animals used in experiments might be another explanation for this discrepancy. The groupers used in our study were immature females, with ovaries at the primary growth stage, while other studies have used adult rats (Navarro et al., 2006) or sexually mature goldfish (Liu et al., 2009). At the pituitary level, the effects of QRFP peptides on LH secretion are controversial. Navarro et al. reported that QRFP-26 and QRFP-7 stimulated LH release from rat pituitary cell cultures (Navarro et al., 2006),

2.0 1.5

Control 0.01ug/g 0.1ug/g 1ug/g

NPY

1.0 0.5 0.0

B Relative mRNA level

*

Relative mRNA level

A

2.0 1.5 1.0 0.5 0.0

C Relative mRNA level

Relative mRNA level

0.06

39

1.0 0.8 0.6

QRFP-25 Control 0.01ug/g 0.1ug/g 1ug/g

*

QRFP-7

Orexin

* *


QRFP-7

POMC

* * *

0.4 0.2 0.0

QRFP-25

QRFP-7

Fig. 6. Effects of peripheral injection of QRFP-25 and QRFP-7 on the expressions of NPY (A), orexin (B) and POMC (C). Orange-spotted grouper was injected with different concentrations (0.01, 0.1, 1 μg/g body mass) of QRFP-25 and QRFP-7. Hypothalamus was collected after intraperitoneal injection of 6 h. Values were represented by the means ± S.E.M. (n = 5–7). *P b 0.05 versus corresponding controls.

while other studies did not observe stimulatory effects in rat and goldfish (i.e., after incubation of rat pituitary fragments, and static incubation of goldfish pituitary cell cultures; Liu et al., 2009; Patel et al., 2008). In our study, QRFP-25 suppressed the expression of gonadotropin in primary cultures of pituitary cells. This evidence suggested that QRFP-25 can inhibit the expression of gonadotropin in both the hypothalamus and pituitary gland in the orange-spotted grouper. The amino acid sequence of QRFP-7 is well-conserved among vertebrates. This heptapeptide has been reported to elicit basal LH secretion in rats (Navarro et al., 2006), yet it had no effect on the expression of genes examined in this study, nor did this peptide treatment change the LH level in goldfish (Liu et al., 2009). Thus, QRFP-7 appears to possess little biological activity in fish. More recently, Olivier et al. demonstrated that although this peptide is responsible for activation


1.5

Relative mRNA level

A

sbGnRH

1.0

* 0.5

0.0

B 0.06


QRFP-7

0.02

** ** 0.00

0.075


QRFP-7

LH

Control 100nM QRFP-25 100nM QRFP-7

0.04

0.02

*

0.00

0.08

Control 100nM QRFP-25 100nM QRFP-7

0.06 0.04

*

0.02 0.00

Fig. 8. Effects of QRFP-25 and QRFP-7 on the expressions of FSHβ (A) and LHβ (B) by incubated primary pituitary cell culture. Pituitary cells were treated with 100 nM concentrations of QRFP-25 and QRFP-7. Cells were harvested after 6 h of incubation. Values were represented by the means ± S.E.M. (n = 4). *P b 0.05 versus corresponding controls.

Science Fund (Nos.064201000067, S2013040013257), the Guangdong Provincial Science and Technology Program (No. 2012A020602063), the Hainan Provincial Science and Technology Program (No. XH201301) and the special fund of Hainan Province for the introduction of integration and demonstration (No.YJJC20130006).

0.050

0.025

0.000

0.06

B

FSH

0.04

C Relative mRNA level

Control 0.01ug/g 0.1ug/g 1ug/g

Relative mRNA level of FSH

Relative mRNA level

A

Relative mRNA level of LH

40

** ** QRFP-25

QRFP-7

Fig. 7. Effects of peripheral injection of QRFP-25 and QRFP-7 on the expressions of sbGnRH(A), FSHβ (B) and LHβ(C). Orange-spotted grouper was injected with different concentrations (0.01, 0.1, 1 μg/g body mass) of QRFP-25 and QRFP-7. Hypothalamus and pituitaries were collected after IP injection of 6 h. Values were represented by the means ± S.E.M. (n = 5–7). *P b 0.05, **P b 0.01 versus corresponding controls.

of the receptor, it is 75-times less potent than 43RFa and 26RFa in that regard (Le Marec et al., 2011). In conclusion, our study advances knowledge of the function of QRFP by demonstrating that QRFP is involved in the regulation of energy homeostasis, food intake and reproductive axis in the orange-spotted grouper. Our results indicate that the peptide QRFP-25 may act as a negative regulator of feeding and of the HPG axis in this species. This provides valuable information for further elucidating the structures and functions of QRFP in vertebrates. Acknowledgment This work is supported by the National 863 Program of China (No. 2012AA10A407), the Guangdong Provincial Oceanic and Fishery Administration Fund (No.2011587), the Guangdong Provincial Natural

References Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340, 783–795. Bruzzone, F., Lectez, B., Tollemer, H., Leprince, J., Dujardin, C., Rachidi, W., Chatenet, D., Baroncini, M., Beauvillain, J.C., Vallarino, M., Vaudry, H., Chartrel, N., 2006. Anatomical distribution and biochemical characterization of the novel RFamide peptide 26RFa in the human hypothalamus and spinal cord. J. Neurochem. 99, 616–627. Cerdá-Reverter, J.M., Peter, R.E., 2003. Endogenous melanocortin antagonist in fish: structure, brain mapping, and regulation by fasting of the goldfish agouti-related protein gene. Endocrinology 144, 4552–4561. Chartrel, N., Dujardin, C., Anouar, Y., Leprince, J., Decker, A., Clerens, S., Do-Régo, J.C., Vandesande, F.,Llorens-Cortes, C.,Costentin, J.,Beauvillain, J.C.,Vaudry, H., 2003. Identification of 26RFa, a hypothalamic neuropeptide of the RFamide peptide family with orexigenic activity. Proc. Natl. Acad. Sci. U. S. A. 100, 15247–15252. Chartrel, N.,Bruzzone, F.,Leprince, J.,Tollemer, H.,Anouar, Y.,Do-Régo, J.C.,Ségalas-Milazzo, I., Guilhaudis, L., Cosette, P., Jouenne, T., Simonnet, G., Vallarino, M., Beauvillain, J.C., Costentin, J., Vaudry, H., 2006. Structure and functions of the novel hypothalamic RFamide neuropeptides R-RFa and 26RFa in vertebrates. Peptides 27, 1110–1120. Egido, E.M.,Hernández, R.,Leprince, J.,Chartrel, N.,Vaudry, H.,Marco, J.,Silvestre, R.A., 2007. 26RFa, a novel orexigenic neuropeptide, inhibits insulin secretion in the rat pancreas. Peptides 28, 725–730. Fukusumi, S., Yoshida, H., Fujii, R., Maruyama, M., Komatsu, H., Habata, Y., Shintani, Y., Hinuma, S.,Fujino, M., 2003. A new peptidic ligand and its receptor regulating adrenal function in rats. J. Biol. Chem. 278, 46387–46395. Kalra, S.P., Dube, M.G., Pu, S., Xu, B., Horvath, T.L., Kalra, P.S., 1999. Interacting appetiteregulating pathways in the hypothalamic regulation of body weight. Endocr. Rev. 20, 68–100. Kampe, J., Wiedmer, P.,Pfluger, P.T.,Castaneda, T.R.,Burget, L.,Mondala, H., Kerr, J., Liaw, C., Oldfield, B.J., Tschöp, M.H., Bagnol, D., 2006. Effect of central administration of QRFP(26) peptide on energy balance and characterization of a second QRFP receptor in rat. Brain Res. 1119, 133–149.

H. Shu et al. / Comparative Biochemistry and Physiology, Part B 176 (2014) 34–41 Kumar, S.,Tamura, K.,Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Le Marec, O.,Neveu, C.,Lefranc, B.,Dubessy, C.,Boutin, J.A.,Do-Régo, J.C.,Costentin, J.,Tonon, M.C.,Tena-Sempere, M.,Vaudry, H., Leprince, J., 2011. Structure–activity relationships of a series of analogues of the RFamide-related peptide 26RFa. J. Med. Chem. 54, 4806–4814. Lectez, B., Jeandel, L., El-Yamani, F.Z., Arthaud, S., Alexandre, D., Mardargent, A., Jégou, S., Mounien, L., Bizet, P., Magoul, R., Anouar, Y., Chartrel, N., 2009. The orexigenic activity of the hypothalamic neuropeptide 26RFa is mediated by the neuropeptide Y and proopiomelanocortin neurons of the arcuate nucleus. Endocrinology 150, 2342–2350. Liu, Y.,Zhang, Y.,Li, S.,Huang, W.,Liu, X.,Lu, D.,Meng, Z.,Lin, H., 2009. Molecular cloning and functional characterization of the first non-mammalian 26RFa/QRFP orthologue in goldfish, Carassius auratus. Mol. Cell. Endocrinol. 303, 82–90. Moriya, R., Sano, H., Umeda, T., Ito, M., Takahashi, Y., Matsuda, M., Ishihara, A., Kanatani, A., Iwaasa, H., 2006. RFamide peptide QRFP43 causes obesity with hyperphagia and reduced thermogenesis in mice. Endocrinology 147, 2916–2922. Navarro, V.M., Fernández-Fernández, R., Nogueiras, R., Vigo, E., Tovar, S., Chartrel, N., Le Marec, O., Leprince, J.,Aguilar, E.,Pinilla, L.,Dieguez, C.,Vaudry, H.,Tena-Sempere, M., 2006. Novel role of 26RFa, a hypothalamic RFamideorexigenic peptide, as putative regulator of the gonadotropic axis. J. Physiol. 573, 237–249. Patel, S.R.,Murphy, K.G.,Thompson, E.L.,Patterson, M.,Curtis, A.E.,Ghatei, M.A.,Bloom, S.R., 2008. Pyroglutamylated RFamide peptide 43 stimulates the hypothalamic–pituitary– gonadal axis via gonadotropin-releasing hormone in rats. Endocrinology 149, 4747–4754. Primeaux, S.D., 2011. QRFP in female rats: effects on high fat food intake and hypothalamic gene expression across the estrous cycle. Peptides 32, 1270–1275. Schwartz, M.W., Woods, S.C., Porte Jr., D., Seeley, R.J., Baskin, D.G., 2000. Central nervous system control of food intake. Nature 404, 661–671.

41

Southey, B.R., Amare, A., Zimmerman, T.A., Rodriguez-Zas, S.L., Sweedler, J.V., 2006. NeuroPred: a tool to predict cleavage sites in neuropeptide precursors and provide the masses of the resulting peptides. Nucleic Acids Res. 34, 267–272. Takayasu, S., Sakurai, T., Iwasaki, S., Teranishi, H., Yamanaka, A., Williams, S.C., Iguchi, H., Kawasawa, Y.I., Ikeda, Y., Sakakibara, I., Ohno, K., Ioka, R.X., Murakami, S., Dohmae, N., Xie, J., Suda, T., Motoike, T., Ohuchi, T., Yanagisawa, M., Sakai, J., 2006. A neuropeptide ligand of the G protein-coupled receptor GPR103 regulates feeding, behavioral arousal and blood pressure in mice. Proc. Natl. Acad. Sci. U. S. A. 103, 7438–7443. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tobari, Y.,Iijima, N.,Tsunekawa, K.,Osugi, T.,Haraguchi, S.,Ubuka, T.,Ukena, K.,Okanoya, K., Tsutsui, K., Ozawa, H., 2011. Identification, localisation and functional implication of 26RFa orthologue peptide in the brain of zebra finch (Taeniopygia guttata). J. Neuroendocrinol. 23, 791–803. Ukena, K., Tachibana, T.,Iwakoshi-Ukena, E.,Saito, Y., Minakata, H.,Kawaguchi, R.,Osugi, T., Tobari, Y., Leprince, J., Vaudry, H., Tsutsui, K., 2010. Identification, localization, and function of a novel avian hypothalamic neuropeptide, 26RFa, and its cognate receptor, G protein-coupled receptor-103. Endocrinology 151, 2255–2264. Ukena, K., Tachibana, T., Tobari, Y., Leprince, J., Vaudry, H., Tsutsui, K., 2013. Identification, localization and function of a novel neuropeptide, 26RFa, and its cognate receptor, GPR103, in the avian hypothalamus. Gen. Comp. Endocrinol. 190, 42–46. Valassi, E., Scacchi, M., Cavagnini, F., 2008. Neuroendocrine control of food intake. Nutr. Metab. Cardiovasc. Dis. 18, 158–168. Yan, A., Zhang, L., Tang, Z., Zhang, Y., Qin, C., Li, B., Li, W., Lin, H., 2011. Orange-spotted grouper (Epinephelus coioides) orexin: molecular cloning, tissue expression, ontogeny, daily rhythm and regulation of NPY gene expression. Peptides 32, 1363–1370.