Molecular Cloning, Sequencing, and Expression of a L ... - Springer Link

Protein J (2009) 28:34–43 DOI 10.1007/s10930-009-9163-6

Molecular Cloning, Sequencing, and Expression of a L-Glutamine D-Fructose 6-Phosphate Amidotransferase Gene from Volvariella volvacea Chuping Luo Æ Weilan Shao Æ Xun Li Æ Zhiyi Chen Æ Yongfeng Liu

Published online: 23 January 2009 Ó Springer Science+Business Media, LLC 2009

Abstract Using 30 -RACE and 50 -RACE, we have cloned and sequenced the genomic gene and complete cDNA encoding L-glutamine D-fructose 6-phosphate amidotransferase (GFAT) from the edible straw mushroom, Volvariella volvacea. Gfat contains five introns, and encodes a predicted protein of 697 amino acids that is homologous to other reported GFAT sequences. Southern hybridization indicated that a single gfat gene locus exists in the V. volvacea genome. Recombinant native V. volvacea GFAT enzyme, over-expressed using Escherichia coli and partially purified, had an estimated molecular mass of 306 kDa and consisted of four equal-sized subunits of 77 kD. Reciprocal plots revealed Km values of 0.55 and 0.75 mM for fructose 6-phosphate and L-glutamine, respectively. V. volvacea GFAT activity was inhibited by the end-product of the hexosamine pathway, UDPGlcNAc, and by the glutamine analogues N3-(4-methoxyfumaroyl)-L-2,3-diaminopropanoic acid and 2-amino-2deoxy-D-glucitol-6-phosphate. Keywords L-Glutamine:D-fructose-6-phosphate amidotransferase Volvariella volvacea cDNA cloning Heterologous expression

Abbreviations GFAT GATase SDS–PAGE RACE GLcN-6-P UDP-GlcNAc FMDP ADGP CMC DTT EDTA cAMP PKA L-Gln Fru-6-P PMSF

L-Glutamine D-fructose

6-phosphate amidotransferase Glutamine amidotransferase Sodium dodecyl sulfate polyacrylamide gel electrophoresis Rapid amplification of cDNA ends D-Glucosamine-6-phosphate Uridine 50 -diphospho-Nacetylglucosamine N3-(4-Methoxyfumaroyl)-L-2,3diaminopropanoic acid 2-Amino-2-deoxy-D-glucitol-6-phosphate Carboxymethyl cellulose Dithiothreitol Ethylenediamine tetraacetic acid disodium salt cyclic Adenosine monophosphate cAMP-dependent protein kinase L-Glutamine D-Fructose-6-phosphate Phenylmethylsulfonyl fluoride

1 Introduction C. Luo (&) Z. Chen Y. Liu Institute of Plant Protection, Jiangsu Academy of Agriculture Sciences, Nanjing, Jiangsu 210014, China e-mail: [email protected]; [email protected] C. Luo W. Shao X. Li Jiangsu Key Laboratory of Biodiversity and Biotechnology, Nanjing Normal University, Nanjing, Jiangsu 210097, China X. Li Department of Bioengineering, Nanjing Forestry University, Nanjing, Jiangsu 210017, China

123

Filamentous fungi have attracted much attention in recent years as potential hosts for the production of homologous and heterologous gene products due to their natural capacity to secrete proteins into the growth medium and their more elaborate post-translational modification systems compared to yeasts [1]. Consequently, genetic engineering has been employed to develop improved strains for use in a variety of biotechnological and other industrial processes. Several of the genetic markers used to

Molecular Cloning, Sequencing, and Expression

select genetically engineered filamentous fungi are linked to antibiotic or herbicide resistance [1] but, while valuable for selection purposes in many filamentous species, they cannot be applied in all cases. Furthermore, such markers are often subject to patent protection and their use is restricted by proprietary considerations. Moreover, there is general concern that widespread usage of antibiotic or herbicide resistance markers could lead to the transfer of these genes to other organisms. Consequently, there is a need to develop alternative and less controversial selectable marker genes. L-Glutamine:D-fructose-6-phosphate amidotransferase (hexose-isomerizing; EC 2.6.1.16), known under the trivial name of glucosamine-6-phosphate synthase (GlcN-6-P synthase), catalyses ammonia transfer and sugar phosphate isomerization in the reaction: L-glutamine ? D-fructose 6-phosphate ? D-glucosamine 6-phosphate ? L-glutamate. This reaction is the first and committed step in the biosynthetic pathway leading to the formation of UDPGlcNAc, the precursor of numerous amino sugar-containing macromolecules including chitin and mannoproteins in fungi, peptidoglycan and lipopolysaccharides in bacteria, and glycoproteins in mammals [2–5]. There are numerous glutamine amidotransferases (GATases) that catalyse the removal of the amido group from glutamine and subsequent transfer to an acceptor substrate. These GATases are divided into two classes, Class I (trpG-type) and Class II (purF-type), based on sequence similarities. GlcN-6-P synthase, along with phosphoribosyltransferase and asparagine synthetase, is a Class II GATase which, unlike Class I enzymes, are apparently unable to use exogenous ammonia as a nitrogen donor [6, 7]. Saccharomyces cerevisiae and Candida albicans contain only one copy of gfat in their genomic DNA and mutations affecting the gene are lethal [8, 9]. Gfat haploid mutants of S. cerevisiae and C. albicans are unable to grow since they cannot form the chitin septum separating mother and daughter cells, and because N-glycosylation of proteins is essential for mitotic growth. However, such mutants are able to grow if supplied with glucosamine [3, 8] thereby indicating that gfat might serve as a novel selective marker gene for screening genetically engineered fungi. Furthermore, in view of GFAT’s role as a precursor of fungal chitin and the fact that filamentous fungi represent the largest and most economically important group of plant pathogens, increased understanding of the structure and mechanism of action of the enzyme has important implications for the development of anti-fungal agents for disease control [10–13]. However, although GFATs have been isolated and characterized from numerous sources including Escherichia coli, Aedes aegypti, yeast, mice and Homo sapiens [6, 8, 9, 14–18], relatively few gfat genes have been cloned and characterized from filamentous fungi.

35

One commercially important filamentous fungus is the edible straw mushroom, Volvariella volvacea, which is grown on an industrial scale in many tropical and subtropical regions as a source of food and bioactive agents [19]. V. volvacea produces a range of cellulolytic, hemicellulolytic and ligninolytic enzymes [20, 21], grows more rapidly and at higher temperatures than mesophilic filamentous fungi, and is highly efficient at transforming agriculture wastes into value-added bio-products. We now report for the first time the molecular cloning and sequence analysis of the gfat gene from V. volvacea, the existence of a single gfat locus in this fungus, and the expression, purification and characterization of recombinant V. volvacea GFAT produced in E. coli. We have also undertaken structural and active site analyses of V. volvacea GFAT, and determined the effect of specific inhibitors on V. volvacea GFAT activity.

2 Materials and Methods 2.1 Microbial Strains and Growth Conditions Volvariella volvacea V1-1 (ATCC50447) was obtained from the General Microbiological Culture Collection Center of China (Beijing) and grown on solid medium (pH 6.8) containing (in 1,000 mL distilled water): 2 g carboxymethyl cellulose (CMC); 2 g birch wood xylan; 2 g K2HPO4; 2 g (NH4)2SO4; 1 g MgSO4; 2.5 mg thiamine and 15 g agar. E. coli JM109 and JM109 DE3 (Promega Corp., Madison, WI, USA) served as hosts to plasmid pET20b(?) [Novagen, Darmstadt, Germany] for the overexpression of V. volvacea gfat. E. coli transformants were grown at 30 or 37 °C in Luria-Bertani (LB) medium containing 100 mg/mL ampicillin. Unless stated otherwise, all chemicals were purchased from Sigma (St Louis, USA). 2.2 RNA Manipulation, cDNA Synthesis and Cloning Mycelium from V. volvacea cultures grown for 5 days in medium as described above was harvested, frozen with liquid nitrogen and ground to a fine powder with a mortar and pestle. Total RNA was isolated from this material using the Tri-Reagent (Molecular Research Center, Inc. Cincinnati, OH, USA) and poly(A) ? mRNA was purified from total RNA using the PolyATract mRNA isolation system (Promega). Reverse transcription was carried out at 42 °C for 2 h in a 10-lL reaction volume containing: 2 lL diethylpyrocarbonate-treated H2O, 2 lL 59 first strand buffer, 0.01 M dithiothreitol, 0.5 mM dNTPs, 0.5 lg oligodT, 0.1 lg polyA RNA and 100 U BD Powerscript Reverse Transcriptase (Clontech, Palo Alto, CA). The cDNA from the reaction was kept at -70 °C until use.

123

36

C. Luo et al.

Fig. 1 Schematic representation of the 50 -RACE and 30 -RACE used to obtain full-length V. volvacea gfat cDNA. A to obtain the 30 -end of V. volvacea gfat mRNA, first strand cDNA was synthesized by RT-PCR using primer 3 [designed according to the poly(A) tail of eukaryotes], followed by linear amplification using degenerate primer 1 (designed according to the conserved amino acids GETADT), and exponential amplification using degenerate primers 2 and 3 (designed according to the conserved amino acids KAYTSQ). The amplified DNA fragment was sub-cloned into T-vector pMD18-T (TakaRa Table 1 Primers used in this study

Primer

Sequence (50 –30 )

Usage

1

GGN GA[A/G] CAN GCN GA[T/C] AC

RT-PCR—gfat cDNA

2

AA[A/G]GCNTA(T/C) CANTCNCA

30 RACE—gfat

3

Poly(A)30(A/C/G)N

30 RACE—gfat

4

-p-GAGCAACAAACTC

RT-PCR—gfat cDNA

5

TGCAGAGAACTGTCTTGTTGC

50 RACE—gfat

6

ACTAGCAACTACTGTCGGCG

50 RACE—gfat

7

TATGTGTGGGATTTTTGCTTAC

PCR—full-length gfat

8

CTCCGTAGTGACAGATTTAGC

PCR—full-length gfat

9

CCCGGTACCTATGTGTGGGATTTTTGCTTAC

Cloning gfat into pET-20b

10

CCCAAGCTTTTACTCCGTAGTGACAGATTTA


11

CCCAAGCTTCTCCGTAGTGACAGATTT AGC


RACE was performed to obtain the full-length V. volvacea gfat cDNA sequence (Fig. 1). The 30 and 50 -Full Race Core Set was purchased from TaKaRa Biotechnology (Dalian) Co., Ltd. The 30 -cDNA end fragment of the gfat gene was obtained by linear and exponential PCR using the degenerate primers 1 and 2 (Table 1) designed respectively on the basis of the GFAT amino sequences GETADT and KAYTSQ shown to be highly conserved in the corresponding gene from yeasts, bacteria and other sources. Linear PCR amplification of a gfat cDNA fragment was carried out using a Peltier Thermal

123

Biotechnology Co., Ltd, Dalian China) and sequenced. B to verify the 50 -end of the gfat mRNA, inverse PCR was carried out according to the procedure described by Maruyama et al. [22]. cDNA was synthesized using primer 4 (the 50 -end of which was phosphorylated) and reverse transcriptase BD Powerscript (Clontech, Palo Alto, CA), and circularized with RNA ligase. Inverse PCR was carried out using primers 5 and 6, and the amplified DNA fragment was sub-cloned into pMD18-T and sequenced

Cycler 100 (MJ Research, Watertown, MA, USA) in 50 lL reaction mixtures containing 2.5 U EXTaq DNA polymerase, 5 lL 109 Mg-free reaction buffer, 200 lM dNTP, 2.5 mM MgCl2, 1 lM primer 1 and 0.5 lL template. Amplification conditions were: 1 cycle of 95 °C for 3 min, 46 °C for 30 s and 72 °C for 2 min; 20 cycles of 94 °C for 30 s, 46 °C for 30 s, and 72 °C for 2 min; then a final extension at 72 °C for 10 min before storage at 4 °C. Exponential amplification of the 30 cDNA gfat fragment was carried out in 50 lL reaction volumes containing 2.5 U EXTaq DNA polymerase, 5 lL 109 Mg-free reaction buffer, 200 lM dNTP, 2.5 mM


MgCl2, 1 lM each of primers 2 and 3, and 0.5 lL linear PCR product. Amplification conditions were: 1 cycle of 95 °C for 3 min, 46 °C for 30 s and 72 °C for 1 min; 30 cycles of 94 °C for 30 s, 46 °C for 30 s, and 72 °C for 1 min; then a final extension at 72 °C for 10 min before storage at 4 °C. Amplification products were fractionated by electrophoresis in 1.0% (w/v) agarose/Tris–borate/EDTA gels and appropriate bands excised and eluted from the gel by centrifugation. The eluted DNA was extracted with phenol/ chloroform, precipitated with ethanol and resuspended in 10 lL H2O. An aliquot (4 lL) was incubated at 16 °C overnight with 3 U T4 DNA ligase (Promega), 1 lL 109 buffer with 10 mM ATP (Promega) and 1 lL pMD18T vector in a total volume of 10 lL and transformed into E. coli JM109. Plasmids encoding the 30 cDNA end fragment were isolated using the Wizard Miniprep Kit (Promega) and sequenced by the Sanger Company, China. The 50 -cDNA end fragment of the gfat gene was obtained by 50 -RACE using inverse PCR as previously reported [22]. Using the 750-bp 30 fragment sequence of gfat obtained above, the gene specific primers 4, 5 and 6 (Table 1) were designed for the 50 -RACE reaction to generate the 50 cDNA end fragment of gfat. Extracted mRNA was retro-transcribed with PowerScriptTM reverse transcriptase (Clontec) using primer 4 (Table 1), and the first-strand cDNA was then ligated by T4 RNA ligase. PCR amplification was carried out in 50 lL reaction volumes containing 2.5 U EXTaq DNA polymerase, 5 lL 109 Mgfree reaction buffer, 200 lM dNTP, 2.5 mM MgCl2, 1 lM each of primers 5 and 6 (Table 1), and 1 lL of the ligated product. Amplification conditions were: 30 cycles of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 3 min, followed by a final extension at 72 °C for 10 min. The PCR product was cloned and sequenced as above. 2.3 Cloning and Sequencing of V. volvacea gfat Genomic DNA and Southern Blot Analysis Genomic DNA of V. volvacea was extracted from 5-day old mycelium using the GenElute Plant Genomic DNA Miniprep Kit (Sigma). Gfat genomic DNA was amplified using primers 7 and 8 (Table 1), and the PCR product was cloned into pMD18-T and sequenced. The upstream and downstream sequences were cloned using the Clontech Genome Walk Universal Kit according to the manufacturer’s instructions. Genomic DNA was digested with HindIII, XbaI, NcoI and XhoI, and the fragments were separated on 0.8% (w/v) agarose gels and transferred to a nylon membrane. The blot was hybridized with DIGlabelled V. volvacea gfat PCR product and probed by detection starter kit II (Roche). Prehybridization, hybridization and membrane washing procedures were conducted at 65 °C. The membrane was washed using stringent

37

conditions (twice in 0.29 SSC with 0.1% w/v SDS for 20 min) before exposure. 2.4 Gene Characterization, Active Site and Catalytic Domain Analyses, and Structural Modelling DNA sequence data analyses, amino acid sequence alignments and construction of a phylogenic tree were carried out using DANMAN and DNA-STAR software packages. Searches for domain structures in V. volvacea GFAT were performed using Protein Families Database of Alignments and HMMs (http://www.sanger.ac.uk/software/pfam/ search.shtml). The structure of V. volvacea GFAT was modelled on SWISSMODEL (http://swissmodel.expasy. org), and determination of the active site was based on known sequences and structures. 2.5 Construction of E. coli Expression Plasmids and Induction of Expression The pET-20b(?) vector has a NdeI restriction enzyme site in front of its N-terminal pelB signal sequence and an optional C-terminal His-Tag sequence. First strand cDNA was prepared for expression in E. coli by PCR using primers 9 and 10 or primers 9 and 11 (Table 1). Primer 9 has a NdeI restriction enzyme site, and primer 10 but not primer 11 has a stop codon (TAA). PCR products were cloned into pET20-b to yield the recombinant plasmids pET20-b-gfat and HpET20-b-gfat, respectively. Consequently, a poly-Histag was present on the carboxyl end of recombinant proteins expressed using HpET20-b-gfat but was absent from recombinant proteins expressed using pET20b-gfat. Transformants of E. coli JM109(DE3) were selected by growth at 28 °C in LB media containing 100 lg/mL ampicillin. Cells were induced by addition of IPTG (1.2 mM final concentration) and incubated until the OD600 reached 0.6. Cells in 1 mL of culture were harvested by centrifugation and re-suspended in 400 lL distilled water. The suspension was mixed with 100 lL 59 SDS–PAGE sample buffer containing 250 mmol/L Tris–HCl (pH 6.8), 200 mmol/L DTT, 10% (w/v) SDS, 0.05% (w/v) bromophenol blue and 45% (v/v) glycerol, and boiled for 5 min. After centrifugation at 12,000g for 10 min, proteins in the supernatant were separated using 10% (w/v) SDS–PAGE, stained with Coomassie blue, and analyzed by density scanning using an image analysis system (Bio-Rad). 2.6 Cell Lysis and GFAT Assay Approximately 6 h after IPTG induction of the T7 promoter in the plasmids, 1 mL aliquots of the E. coli culture

123

38

suspension were centrifuged and, after subjecting to two freeze-thaw cycles, the cell pellets were re-suspended in 0.5 mL of ice-cold lysis buffer containing 100 mM NaH2PO4 (pH 7.5), 50 mM KCl, 10 mM EDTA, 12 mM glucose 6-phosphate, and 100 mM PMSF. Glucose 6-phosphate was included in the lysis buffer to stabilize GFAT activity. Cells were then lysed by sonication and the crude enzyme solution was recovered following centrifugation at 12,000g for 15 min at 4 °C. All solutions, cell preparations, and cytosol were maintained in an ice bath during the lysis procedure. GFAT was assayed using the procedure described by Ghosh et al. [23] with modifications. Reaction mixtures contained: 15 mM fructose-6-phosphate, 10 mM L-glutamine, 1 mM EDTA, 0.5 mM PMSF, 1 mM DTT and 50 mM potassium phosphate (pH 6.5). Samples were incubated at 30 °C for 30 min and enzyme solution was then added (to a final volume of 50 lL) to initiate the reaction. After a further 30 min at 30 °C, samples were boiled for 2 min to terminate the reaction and the amount of GlcN-6-P formed was determined as follows: after transferring the reaction mixtures to 1.5 mL tubes, 20 lL of 5% (v/v) acetic anhydride in acetone and 0.33 M potassium tetraborate (pH 9.0) were added and the tubes were incubated in a water bath for 3 min at 100 °C. Ehrlich’s reagent (700 lL) was then added and samples were incubated at 37 °C for 30 min. The absorbance at 590 nm was recorded, and the amount of product formed was determined from a standard curve prepared using GlcN-6P. Assays were performed in triplicate, and variations about the mean were less than 5%. One unit of GFAT activity was defined as the amount of enzyme that catalyzed the formation of 1.0 nmol GlcN-6-P per minute at 37 °C. 2.7 Purification and Characterization of Recombinant GFAT Expression products were purified by immobilized Ni2? affinity chromatography. Purified and concentrated enzyme (1-4 mg/mL) was stored at -70 °C with 1 mM Fru-6-P in buffer containing 50 mM MOPS (pH 6.5), 1 mM DTT, 1 mM EDTA, 10 mM KCl, Roche Molecular Biochemicals complete protease mixture and 10% (v/v) glycerol. Immediately prior to assay, the enzyme was diluted with assay buffer containing 10 mM KCl, 1 mg/mL bovine serum albumin, 20 mM imidazole buffer (pH 6.8), 1 mM EDTA, 1 mM DTT and 10% (v/v) glycerol. Molecular weights were determined by gel filtration and SDS–PAGE. Km values for recombinant V. volvacea GFAT were determined using the Morgan Elson method [23]. Data were fitted to the Michaelis–Menten equation and Km values were calculated using curve fitting software (Graft

123

C. Luo et al.

version 4.0.13). IC50 values of specific inhibitors of GFAT were determined in assays that measured the synthesis of GlcN-6-P as described in 2.6 and calculated using a SASassisted curve fit programme.

3 Results and Discussion 3.1 Sequence Analysis of V. volvacea gfat cDNA and Genomic DNA The full-length V. volvacea GFAT cDNA (submitted to GenBank under accession number AY661466) contained a predicted ORF of 2,091 bp coding for 697 amino acids that constituted a protein of molecular mass *77 kD. The 50 and 30 - untranslated regions were 327 and 193 bp, and a putative polyadenylation signal (AAATAA) was identified 130 bp upstream of the poly(A) tail. The cloned V. volvacea genomic gfat (GenBank accession number EF143259) contained five introns. Introns have been reported in most eukaryotic gfat genes with the exception of gfat from A. aegypti [3]. Alignment of the deduced amino acid sequence of V. volvacea GFAT with sequences of GFATs from other sources revealed highest overall identity with the corresponding enzymes from S. cerevisiae (66%), C. albicans (66%), A. aegypti (56%) and H. sapiens (56%; Fig. 2). Sequence identity values for GFATs from E. coli and Bacillus subtilis were 39 and 34%, respectively. These sequence comparisons strongly indicate that we have cloned the V. volvacea GFAT gene. Phylogenetic relationships between V. volvacea GFAT and GFATs from both eukaryotic and prokaryotic sources are shown in Fig. 3. Our data confirm that, in agreement with the evolutionary distances between the different species tested, V. volvacea GFAT is clearly related more closely to the corresponding enzymes from fungi (i.e. S. cerevisiae, C. albicans, Schizosaccharomyces pombe) than from plant, animal, arthropod and bacterial sources. 3.2 Domain and Active Site Analysis of V. volvacea GFAT Domain structure analysis revealed that, as with all GFATs previously described [12, 24], V. volvacea GFAT contained a Class II glutamine transferase (GAT2) motif (from Cys-2 to Gly-202) at the N-terminus, and two sugar isomerase (SIS) motifs (from Leu-373 to Glu-511, and from Ala-548 to 684-Asn) centrally and near the C-terminus, respectively (Fig. 2). The half-life of a cytosolic protein is determined to a large extent by its terminal amino acid residue [25]. Thus, the conserved GAT2 sequence suggests that V. volvacea GFAT, like all other eukaryotic GFATs, is


39

Fig. 2 Alignment of deduced amino acid sequences of GFATs from V. volvacea and other species. GFAT amino sequences were aligned using the DANMAN programme. Vv, Volvariella volvacea (AY661466); Ae, Aedes aegypti (AF399922); Ca, Candida albicans (CAA6430); Ec, Escherichia coli (AE005604); Hs, Homo sapiens (Q06210); Sc, Saccharomyces cerevisiae (NP_012818). The numbers down the right-hand side indicate the position from the initial methionine residue of each sequence. The relative positions of catalytic domains (GFAT2 and SIS) are marked by “ ” and “ ”, respectively. The residues, Cys-2, Ser-205 and Lys-603, putatively assigned a function in D-fructose-6-phosphate binding, phophorylation and glutamine amide transfer respectively, are marked with an asterisk. The conserved amino acid sequences, GETADT and KAYTSQ, used to design primers 2 and 3, are boxed. Amino acids conserved among all of the sequences are shaded

subject to a rapid turnover rate in order to cope with sudden changes in metabolic activity patterns. Comparison of eukaryotic (V. volvacea, C. albicans, S. cerevisiae) and prokaryotic (E. coli, B. subtilis) GFATs revealed a relatively large region (residues 220-297 in the V. volvacea protein) that is lacking from the prokaryotic enzymes. This region may be involved in interaction with the allosteric effector [3, 15, 16]. GFAT belongs to the group of purF amidotransferases which, in the mature form, contain a conserved N-terminal cysteine residue that functions in the glutamine amide transfer [6]. Assuming that the N-terminal cysteine residue is removed in the course of post-translational processing [26], such a residue is present in the predicted amino acid

sequence of the V. volvacea GFAT protein. Lys-684 in the highly conserved C-terminal region of the V. volvacea GFAT probably corresponds to Lys-603 in the E. coli protein where it is involved in the binding of D-fructose-6phosphate [27]. In mammals, GFAT activity is regulated by cAMP-dependent protein kinase (PKA) which, in the case of human GFAT, appears to control the flux of glucose into the hexosamine pathway by phosphorylating the Ser205 residue [28–30]. This serine residue is conserved in all eukaryotic GFATs and, in V. volvacea GFAT, is located at Ser-197 where it is followed by two additional conserved amino acids. Therefore, PKA may also regulate V. volvacea GFAT activity and subsequently the concentration of cytosolic UDP-GlcNAc and chitin biosynthesis.

123

40

C. Luo et al. 100%

90%

80%

70%

60%

50%

40%

30%

A. e 81% D. m 69% H. s 99% M. m 56%

C. a 76% S. c

66%

V. v

60%

S. p

39%

E. c 75% H. i

56%

T. p

43%

M. t 34% B. s 39% C. c 36% C. m

32%

S. s P. f

Fig. 3 Phylogenetic relationships between GFATs from V. volvacea and other sources. A. e (Aedes aegypti, AF399922); D. m (Drosophila melanogaster, AAF 45333); H. s (Homo sapiens, M90516); M. m (Mus musculus, NP-038556); C. a (Candida albicans, CAA6430); S. c (Saccharomyces cerevisiae, NP-012818); S. p (Schizosaccharomyces pombe Q09740); E.c (Escherichia coli, AE005604); H.i (Haemophilus influenzae, AAC22088); T.p (Treponema pallidum, 083833); M. t (Mycobacterium tuberculosis, CAA04007); B.s (Bacillus subtilis, P39754); C. c (Cyanidium caldarium O19908); C. m (Cyanidioschyzon merolae NP_848985); S. s (Sulfolobus solfataricus, NP_341920); P. f (Plasmodium falciparum, NP_700718)

Fig. 4 Southern analysis of the Volvariella volvacea gfat gene. Genomic DNA from V. volvacea was digested with the restriction enzymes identified at the top of the figure and subjected to Southern blotting. Labelled gfat PCR product was used as a probe for hybridization under the conditions described in Experimental Procedures. Approximate sizes of the observed fragments are indicated on the left of the figure

transport systems and to be phosphorylated to GlcN-6-P by hexokinases. Although GFAT provides GlcN-6-P for UDPGlcNAc synthesis and N-glycosylation of proteins, it is not required when GlcN is available as a precursor [3, 5]. 3.4 Expression, Purification and Characterization of V. volvacea GFAT

3.3 Southern Analysis of the gfat Gene Southern analysis of V. volvacea gfat following digestion with HindIII, XbaI, KpnI and XhoI revealed three bands in the XhoI lane, two bands in the NcoI lane and only one band elsewhere (Fig. 4). The probe region only contained restriction sites for XhoI (two) and NcoI (one). These data indicate that V. volvacea, like haploid cells of S. cerevisiae and C. albicans, contains only a single copy of the gfat gene, whereas two genes encoding different GFAT isoforms are present in H. sapiens, M. musculus, A. aegypti and D. melanogaster. This conclusion is supported by research showing that gfat mutants of V. volvacea are unable to grow unless provided with glucosamine. Glucosamine is presumed to enter the cell by way of hexose

123

Proteins present in whole cell extracts of E. coli containing the pET20-b-gfat, pET20-b-gfat and HpET20-b plasmids were fractionated by SDS–PAGE (Fig. 5). A band of *77 kDa was present only in the recombinant plasmid samples. To determine if the expression product represented a functional recombinant V. volvacea GFAT, enzyme activity was measured in extracts of cells containing one of three plasmids (Fig. 6). Functional recombinant V. volvacea GFAT was synthesized only by those cells transfected with either the pET20-b-gfat or HpET20-b-gfat plasmid, thereby indicating that attachment of the His-tag to the C-terminal of the protein had little or no effect on enzyme activity. Expression of eukaryotic genes is often unsuccessful in prokaryotic organisms due to


41

Fig. 5 Heterologous expression and partial purification of V. volvacea GFAT. Lane M: molecular weight standards; lane C: protein profile from E. coli containing pET20-b plasmid; lanes S1 and S2: protein profiles from E. coli containing recombinant plasmids pET20-b-gfat and HpET20-b-gfat, respectively; lane S3: recombinant GFAT partially purified using affinity chromatography. Proteins were separated by SDS–PAGE on 10% (w/v) gels and stained with Coomassie Blue

Fig. 6 Expression of V. volvacea GFAT activity in E. coli. Total E. coli GFAT activity was measured in extracts of transfected cells containing pET20-b (Ctr l j), pET20-b-gfat (VvcDNA j) and HpET20-b-gfat (HVvGFAT j) following induction with 1.2 mM IPTG for 6 h. GFAT activity was also determined in the corresponding reaction mixtures containing 250 mM UDP-GlcNAc (Ctrl , VvcDNA , HVvcDNA ). Values shown are corrected for basal GFAT levels in the bacterial host

the lack of post-translation modification systems although McKnight et al. [17] reported expressing human gfat in a bacterial host. This may indicate that both the GFAT protein structure and post-translation modification systems are conserved in different organisms. Numerous previous reports have documented the instability of GFAT from different sources [6, 8, 9, 14–16]

which, together with its relative low abundance, has been a serious obstacle to in-depth biochemical studies and prevented a full kinetic characterization of the enzyme [15]. Although GFAT can be detected in fresh crude extracts of V. volvacea tissue, enzyme activity is low and no longer evident after overnight storage of the extracts at 4 °C. In this study, we have used the gfat native ATG as the translational start code to avoid altering the amino terminal, and have attached a poly-His tag at the carboxyl end to expedite enzyme purification. Like the native enzyme, the recombinant GFAT is labile, and preparations lose 60% of their activity overnight at 4 °C. Recombinant GFAT was partially purified using HisBand Resin Column Chromatography and appeared as the main band on SDS–PAGE with an estimated molecular mass of 77 kDa (Fig. 5). Partially purified enzyme eluted as a single peak (corresponding to a molecular mass of *310 kDa) from a Sephacryl S-200 gel filtration column, indicating that the native enzyme was composed of four subunits. Optimal pH and temperature values for enzyme activity were pH 6.4 and 37 °C, respectively. The enzyme was active over the pH range 5.5-7.5 but is labile (t1/2 = 1 h at 45 °C), in common with the relatively short-lived mammalian GFAT proteins (t1/2 = 45 min) [12]. This appears to be true for most enzymes that play important roles in metabolic regulation, the fluctuations in enzyme levels allowing for rapid changes in metabolic patterns. Recombinant GFAT Km values for Fru-6-P and L-Gln were 0.55 and 0.75 mM, respectively (mean of 5 replicate determinations in each case; Fig. 7A1, A2 and B1, B2, respectively). These values fall within the ranges of corresponding Km values reported previously for GFATs from other sources (0.2–1.0 mM for Fru-6-P and 0.4–2.0 mM for L-Gln, respectively) [6, 8, 9, 14–16].

123

C. Luo et al.

V (µmols min-1 mg-1)

Fig. 7 Km values of recombinant V. volvacea GFAT for Fru-6-P and L-Gln. A1, A2: the Km value for Fru-6-P (0.55 mM) was determined by measuring the rate of GlcN 6-phosphate production at increasing Fru-6-P concentrations and a constant L-Gln concentration (10 mM). B1, B2 the Km value for L-Gln (0.75 mM) was determined by measuring the rate of GlcN 6-phosphate production at increasing Gln concentrations and a constant Fru-6-P concentration (10 mM). Both values are the mean of five replicates and are derived from the data by curve-fitting or from linearized double reciprocal plots

V (µmols min-1 mg-1)

42

3.5 Inhibition of V. volvacea GFAT by UDP-GlcNAc, FMDP and ADGP Considerable attention has been focused on utilizing glutamine and UDP-GlcNAc analogues to inhibit GFAT activity in attempts to develop antibacterial and antifungal agents [12]. In common with other eukaryotic GFATs, the V. volvacea enzyme is also partially inhibited by the endproduct of the hexosamine pathway, UDP-GlcNAc, although it is less sensitive than human GFAT and more sensitive than the corresponding enzymes from S. cerevisiae and C. albicans (Table 2). Feedback inhibition by UDP-GlcNAc is a key regulatory mechanism for limiting

Table 2 Inhibitor IC50 values for GFATs from different sources GFAT source

a

H. sapiens

IC50 value (lM) UDP-GlcNAc

FMDP

ADGP 2.5

7

ND

b

V. volvacea

160

120

85

c

S. cerevisiae

2,500

10.0

NAb

d

C. albicans

670

4.0

NAb

e

E. coli

NI

ND

19.3

NI microbial enzyme not inhibited by UDP-GlcNAc ND not determined a

[15]; bV. volvacea (this work); c[9]; d[8]; e[6]

123

GFAT-mediated hexosamine biosynthesis in eukaryotes. However, UDP-GlcNAc does not act as a feedback inhibitor of bacterial aminotransferases suggesting that GFAT inhibitor sites in prokaryotes are distinct from those in eukaryotes and that the former rely on a different mechanism to control the UDP-GlcNAc pool size and prevent nucleotide sugar accumulation [4]. Consequently, it should be possible to partially desensitize recombinant V. volvacea GFAT to UDP-GlcNAc inhibition. The glutamine analogues N3-(4-methoxyfumaroyl)-L2,3-diaminopropanoic acid (FMDP) and 2-amino-2-deoxyD-glucitol-6-phosphate (ADGP) are also reported to be highly effective GFAT inactivators [10–12]. Both analogues inhibited V. volvacea GFAT, with recorded IC50 values of 120 and 85 lM for FMDP and ADGP, respectively (Table 2). Therefore, the V. volvacea enzyme was less sensitive to FMDP compared with S. cerevisiae and C. albicans GFATs, but more sensitive to ADGP than either the human or E. coli GFAT (IC50 values of 2.5 and 19.3 lM, respectively; Table 2). Our data demonstrate that GFATs from different sources exhibit different inhibitor sensitivities, and that structural and functional analyses of the gfat gene from V. volvacea should aid the design of targeted inhibitors for controlling fungal plant pathogens. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (Grant No. 30370034) and the 211 Foundation of Ministry of Light Industry of China (2001). We thank Dr John Buswell (Institute of Edible Fungi, Shanghai

Molecular Cloning, Sequencing, and Expression Academy of Agricultural Sciences) for linguistic revision of the manuscript.

References 1. Nevalainen KM, Te’o VS, Bergquist PL (2005) Trends Biotechnol 23:468–474 2. Bulik DA, Olczak M, Lucero HA, Osmond BC, Robbins PW, Specht CA (2003) Eukaryot Cell 2:886–900 3. Kato N, Dasgupta R, Smartt CT, Christensen BM (2002) Insect Mol Biol 11:207–216 4. Kornfeld R (1967) J Biol Chem 242:3135–3141 5. Ram AFJ, Arentshorst M, Damveld RA, vanKuyk PA, Klis FM, van den Hondel CAMJJ (2004) Microbiology 150:3315–3326 6. Badet B, Vermoote P, Haumont PY, Lederer F, LeGoffic F (1987) Biochemistry 26:1940–1948 7. Zalkin H (1993) Adv Enzymol 66:203–309 8. Smith RJ, Milewski S, Brown AJ, Gooday GW (1996) J Bacteriol 178:2320–2327 9. Watzele G, Tanner W (1989) J Biol Chem 264:8753–8758 10. Bearne SL (1996) J Biol Chem 271:3052–3057 11. Bearne SL, Blouin C (2000) J Biol Chem 275:135–140 12. Marshall NJ, Andruszkiewicz R, Gupta S, Milewski S, Payne JW (2003) J. Antimicrob Chemother 51:821–831 13. Naganuma A, Miura N, Kaneko S, Mishina T, Hosoya S, Miyari S, Furuchi T, Kuge S (2000) FASEB J 14:968–972 14. Badet-Denisot MA, Fernandez-Herrero LA, Berenguer J, Ooi T, Badet B (1997) Arch Biochem Biophys 337:129–136 15. Broschat KO, Gorka C, Page JD, Martin-Berger CL, Davies MS, Huang H, Gulve EA, Salsgiver WJ, Kasten TP (2002) J Biol Chem 277:14764–14770

43 16. Huynh QK, Gulve EA, Dian T (2000) Arch Biochem Biophys 379:307–313 17. McKnight GL, Mudri SL, Mathewes SL, Traxinger RR, Marshall S, Sheppard PO, O’Hara PJ (1992) J Biol Chem 267:25208– 25212 18. Sayeski PP, Wang D, Su K, Han IO, Kudlow JE (1997) Nucleic Acids Res 25:1458–1466 19. Buswell JA, Chen MJ (2005) Intl J Med Mushr 7:157–166 20. Chen S, Ge W, Buswell JA (2004) Eur J Biochem 271:318–328 21. Ding SJ, Ge W, Buswell JA (2001) Eur J Biochem 268: 5687–5695 22. Maruyama IN, Rakow TL, Maruyama HI (1995) Nucleic Acids Res 23:3796–3797 23. Ghosh S, Blumenthal HJ, Davidson E, Roseman S (1960) J Biol Chem 235:1265–1273 24. Milewski S, Kuszczak D, Jedrzejczak R, Smith RJ, Brown AJ, Gooday GW (1999) J Biol Chem 274:4000–4008 25. Tabias JW (1991) Science 254:1374–1377 26. Dummitt B, Micka WS, Chang YH (2005) J Biol Chem 280:14356–14360 27. Golinelli-Pimpaneau B, Badet B (1991) Eur J Biochem 201: 175–182 28. Chang Q, Su K, Baker JR, Yang XY, Paterson AJ, Kudlow JE (2000) J Biol Chem 275:21981–21987 29. Hu Y, Riesland L, Paterson AJ, Kudlow JE (2004) J Biol Chem 279:29988–29993 30. Zhou J, Huynh QK, Hoffman RT, Crook ED, Daniels MC, Gulve EA, McClain DA (1998) Diabetes 47:1836–1840

123