Molecular Cloning, Sequencing, and Expression of Human Myocardial ...

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1991 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 266, No. 25, Issue of September 5, pp. 16774-16777,1991 Printed in U.S.A.

Molecular Cloning, Sequencing, and Expression of Human Myocardial Fatty Acid Ethyl Ester Synthase-I11 cDNA* (Received for publication, April 8, 1991)

Puran S. Bora#, Nalini S. Boraq, Xiaolin WuS, and Louis G. Lange@II From the $Departmentof Medicine, Cardiovascular Division, Jewish Hospital of St. Louis and the §Departmentof Psychiatry and the qDepartment of Opthalmology and Visual Sciences, Washington University School of Medicine, St. Louis, Missouri 63110

Fatty acid ethyl ester synthase-I11 (FAEES-111), preNo mechanism has been proposed which accounts for the viously purified to homogeneity from human heart, propensity of certain individuals to drink toexcess, to develop metabolizes ethanol nonoxidatively. Using a derived alcohol-related damage to organs, or to explain the association partial amino acid sequence and corresponding oligo- between excessive drinkingandcertain cancers. We have nucleotide probes, the cDNA for this enzyme has beenpreviously reported the existence of nonoxidative alcohol cloned from a human heart Xgtll library. Of the five metabolism in extrahepatic organs such as brain, heart, panpositive clones obtained, one contained a complete cod- creas, and adipose tissue (1-4), organs injured by alcohol ing region (630base pairs) and the entire 3’-noncoding abuse but lacking oxidative metabolism of ethanol. Fatty acid region (41 base pairs). From this nucleotide sequence the complete 210 amino acid sequence of FAEES-I11 ethyl esters (FAEEs)’ are synthesized nonoxidatively at high (Mr23,307) is reported. Comparison of its amino acid rates in these tissues, and in myocardium they accumulate sequence with that of glutathione S-transferase T-1 and are potentially toxic (5). These observations provide a suggests that they belong to the same gene familyplausible since link between the observed tissue damage and the they differ in onlynucleotides six and four amino acids. ingestion of alcohol. Three forms of FAEE synthase from human myocardium The sequence of FAEES-111 was also compared with have been characterized by their elution position from DEAEthose of placental glutathione S-transferase and the basic glutathione S-transferase. FAEES-I11 was 84% cellulose when the resin is washed with a linear salt gradient (6-8). The N-terminal sequence of FAEES-111, the most acidic homologous with placental glutathione S-transferase but only less than 10%homologous with the basicglu- synthase (PI 4.9), is > 87% identical with that of an acidic detoxification enzyme, glutathione S-transferasefrom human tathioneS-transferase.Northernblotsdemonstrate expression ofFAEES-111 mRNA in normalhuman heart. Moreover, both the human FAEE synthase and bovine liver, placenta, and heart. In all cases, the mRNA for liver GST catalyze the formation either of FAEE or of glutathe enzyme is 0.7 kilobase in size. MCF-7 cells trans- thione-xenobiotic conjugates. These structural and functional fected with FAEES-111 cDNA have a 14-fold increase findings now provide a biochemical link between alcohol and in synthase activity and a 12-fold increase in glutathi- carcinogen metabolism. one S-transferase (GST) activity compared with conIn the present investigation we extendthesestudies to trol cells. MCF-7 cellstransfected with GSTr-1 cDNA report the cDNA cloning and sequencing of human myocarhave a 13-fold increase in GST activity compared with dial FAEES-111. Oligonucleotidesderived from the N-terminal control cells but no increase in synthase activity. When amino acid sequence of the purified homogeneous FAEES-I11 the supernatant of COS-7 cells transfected with were used to isolate the clone. We also report the totalamino FAEES-I11 cDNA were immunoblottedwithrabbit FAEES-I11 antibody, a band at 24 kilodaltons was acid sequence deduced from the nucleotide sequence, a comdemonstrated. Thus, we have obtained the first cDNA parison of the sequences with known GSTs, the tissue distriand amino acid sequence for a human FAEES-I11which bution of the FAEES-111 mRNA, and the transfection of also has significant GST activity, andwe have identi- cDNA into theMCF-7 and COS-7 cells. These studiesenable fied 4 residues potentially responsible for conferring clinical investigation of potential genetic predispositions toward development of alcohol-induced end organ disease such ethanol recognition toGSTs. as cardiomyopathy.

* This work was supported in part by National Institutesof Health/ National Institute on Alcohol Abuse and Alcoholism Grants 2ROlAA06989-05 (to L. G. L.), 5ROlAA07656-03 (to L. G. L.), and lROlAA08247-01Al (to L. G . L.); by American Heart Grant-in-aid 890891 (to L. G. L.) and by a grant from the Alcoholic Beverage Medical Research Foundation (to L. G. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s)reported in thispaperhas been submitted

totheGenBankTM/EMBLDataBankwith

accession number(s)

M69113. 11 T o whom correspondence should be sent: Cardiology Research, 4007 Steinberg,theJewishHospital of St.LouisatWashington University Medical Center, 216 S. Kingshighway, St. Louis, MO 63110. Tel.: 314-454-8804.

EXPERIMENTAL PROCEDURES

Materials-Restriction enzymes, polynucleotide kinase, T4 DNA ligase, alkaline phosphatase, and DNA polymerase were purchased from Promega Corporation. Human heart cDNA library was purchased from Clontech,and [Y-~’P]ATP, [LY-~’P]~CTP, and 35S-dATP were purchased from Amersham Corp. TheGSTr-l-transfected MCF-7 cells were kindly provided by Jeffrey Moscow and Kenneth Cowan, Medicine Branch, NCI. Library Screening-The human heart cDNA library was screened with ”P-labeled synthetic oligonucleotide (9). Recombinant phages were plated a t a density of approximately 3 X 10‘ plaque-forming units/l50-mm dish. Plaque hybridization was carried out a t 45 “C The abbreviations used are: FAEE(s), fatty acid ethyl ester(s); FAEES-111, fatty acid ethyl ester synthase-111; GST, glutathione S transferase; SDS, sodiumdodecyl sulfate.

16774

16775

Cloning Fatty Acid Ethyl Ester Synthase-III cDNA overnight in 6 X SSC (1X SSC; 0.15 M NaC1,0.015 M sodium citrate), 10 mM EDTA, 5 X Denhardt's solution, 0.1% SDS, 100 pg/ml denatured salmon sperm DNA, and 32P-labeledoligonucleotide probe (24 X lo6 cpm/ml). Filters were washed twice in 2 X SSC, 0.1% SDS at room temperature and then twice in 1 X SSC, 0.1% SDS at 48 "C for 15 min each time. DNA Blot Hvbridization-Phaee DNA was isolated and digested by EcoRI, elecirophoresed on a f% agarose gel, and the DN;\ was transferred to a nitrocellulose filter. Hybridization and washing were carried out as described for the plaque hybridization. cDNA Cloning-Approximately 30,000 plaques that were grown in the presence of ampicillin were screened with a 3ZP-labeledsynthetic probe as described above. The 27-mer oligonucleotideprobe, a mixture of several different oligonucleotides containing allpossible sequences for the amino acid sequence 2-10, was designed to account for codon degeneracy in the amino acid sequence. From plaque hybridization 1 2 positive clones were detected from the first screening. Secondary and tertiary screening revealed five more positive clones. After extracting phage DNA from these clones the DNAs were digested with EcoRI and analyzed by Southern blot hybridization with the probe. All five clones hybridized and had an insert size of 0.7 kilobase. One of the five clones, designated FAEES-111, was chosen for subcloning in pBluescript KS 11. DNA Sequencing-The full-length cDNA insert was isolated from the DNA of the purified phage clones by digesting with EcoRI and subcloned into the EcoRI site of the pBluescript KS I1 plasmid. Sequencing was performed by the dideoxy chain termination method with 3sSS-labeled adenosine triphosphates (10). Standard T3 and T7 primers were used to sequence from the ends of the fragments. Sequence information was obtained from both strands tocover both orientation and overlapping sequences. RNA Northern Blot Analysis-Total RNA from different human tissues and MCF-7 cells was electrophoresed on a 1%agarose gel containing 2.2 M formaldehyde. After transfer onto a nitrocellulose filter, it was hybridized (60 "C) with the isolated insert of the FAEES111 cDNA whichhad been random prime labeled using the Boehringer Mannheim random primer DNA labeling kit. Nonspecific reaction product wasremoved by washing two times at 60 "C with buffer containing 1 X SSC and 0.1% SDS. Positive hybridization was identified by exposure to Kodak XAR-2 films at -20 "C for 8 h. Transfection and Expression Studies-A full-length FAEES-111 cDNA insert was subcloned into the EcoRI site in an expression vector, SFFV.neo, which uses the SFFV-LTR as a promoter (11). This construct was used to transfect MCF-7 and COS-7 cells stably by the calcium phosphate precipitation technique. Colonies of stable integrants were selected by growth in medium containing antibiotic G418 sulfate, and expression of the transfected cDNA was assessed in total cellular RNA and by immunoblotting. Zrnrnunoblot Analysis-Proteins secreted by the COS-7-transfected cells and control cells were precipitated by adding 1%sodium deoxycholate, 100% trichloroacetic acid and were collected by centrifugation a t 5,000 X g for 30 min a t 4 'C. The precipitated proteins were resuspended in 1 N NaOH, separatedon sodium dodecyl sulfatepolyacrylamide gel electrophoresis as described (12) and then transferred electrophoretically to nitocellulose paper (13). After transfer, the nitrocellulose paper was washed four times with 300 ml of phosphate-bufferedsalinecontaining 0.3% (v/v) Tween 20 andthen incubated for 3h with rabbit anti-FAEES-111 antibody and 1% ovalbumin. After washing three times with phosphate-buffered saline, the paper was incubated with lZsII-proteinA (150 pl, lo5 cpm/pmol) containing 1%ovalbumin. The nitrocellulose paper was then washed again with phosphate-buffered saline, dried, and exposed to x-ray film for 72 h. RESULTS

Nucleotide Sequence of FAEES-111-The complete nucleotide sequences of both strands were obtained by sequencing the cDNAs obtained from different clones. In all instances the sequences of overlapping regions of different clones were identical. The human FAEES-I11 cDNA is 683 nucleotides long. It contains a 5"untranslated region of 9 nucleotides prior to the ATG start codon and a 3"untranslated region of 41 base pairs after the TGA stop codon which includes the polyadenylation signal AATAAA (Fig. 1). The polyadenylation signal is located 14 nucleotides upstream from the

FAEES-111

'ATACCCACC

iTG CCG CCC TAC ACCGTG GTC TAT TTC CCA G T I CGA GGC CGC TGC GCC GCC Met Pro

CSR-1

Pro Tyr Thr Val Val TyrPhe Pro Val Arg Gly Arg Cy3 Ala Ale ." ." ." ." ." ." ." ." ." ." ." ."." ."

." ... ." ... ". ". ... ." ... ." . . ". ~ ." ." ." ." ." ." ." ."

60 FAEES-Ill CTG CGC ATG CTG CTG GCA GAT CAC CGC CAC ACC TGC AAG GAG GGA GTG GCG ACC GTG GAC L ~ U ~ r net g L ~ U L ~ UAI^ ASP cln ~ l y GI" s e r ~ r L p Y ~GI" ~ l val y val mr vel clu ." ." ." ." ." ." ." ". ." ... ... ." ." ." .AG ." ." ." ~ .." . ." ." ." ." ." ." Cl" ." ." ~ .". . ." ." ." ." ." ." ." ." ~~. 120 ACG TGC CAG GAG GGC TCA CTCM A GCC TCC TGC CTA TAC GGG GAG CTC CCC AAG TIC CAG FAEES-I11 Thr cys cln G l u Gly Ser Leu Lys Ala Ser Cyr Leu Tyr Gly CluLeu Pro Lyr Phe Gln ." "C ." ." ." ."." ~ .." . ." ." ." ." ." C" ... ... ... ." ." CSR-1 . ... ... ." ." . . ~ .... . G I " ." ." ." ~ .." . ." Trp ." ." .". ~." 180 CTG CCT CAC CTG GGC CGC ACC ClT GAC GGA GACCTC ACC CTC TAC CAG TCC AAT ACC ATC FAEES-I11 Asp Cly AapLeu Thr Leu Tyr C:n Ser Asn Thr Ile Leu Arg H i s Leu Gly Arg f i r Leu ." ~ .." . ~.~ ." ." ."." ." ."." ." ." ... ." ." ". ." ." . . ~ CSR-1 ". ." ." ." ." ." ." ." ." ." ." ." ." ." ." ." ." ." ." .~~ 240 FAEES - I I I GGG CTC TAT GGGM C CAC CAG CAC GAG CCA GCC CTC GTC CAC AIC GIG AAT CAC GGC CTC ~ t Ly ~ UTYC GI? LYS esp a n clu A I = AI= L ~ U val ASP net vai AS" ASP ~ l yval ." ." ." ." ." ." ." ~ .." . ." ." ." . . ~ . . ~~ .". . ~ .." . C S R -1 ." ." ." ." ." ." ". ." ." ." ." ." ." . ~. .~ . ~ . ." . ~ .." . 300 M C TAT GAG GCG CGC M C CAI GAG CAC CTC CGC TGCAM TAC ATC TCCCTC ATC TAC ACC FAEES-111 Glu Asp Leu Arg Cyr LYE Tyr lle Ser Leu Ile Tyr Thhr AS" Tyr Glu Ala C1y Lys Asp . ." ." ." ." ." ." ." ." ." ." ." ." ." ." ." ". ." ." ~ .." G S R -1 ." ." ." ." ." ." ". ." ." ." ." ." ." . . ~ ." ~ .." . ~ .." . ." 360 GAG TAT GTG AAG GCA CTG CCC GGG CAA CTG AAG CCT TTT GAC ACC CTG CTC TCC CAC M C FAEES-Ill Asp Try Val Lyr Ala Leu Pro Gly Cln Leu Lyr Pro Phe Clu Thr Leu Leu Ser Gln Asn ." ." ." ." ." ."." ... ." ." .~~ . ~." . ." ." ." ." ." ... ~~. C S R -1 ." ... ." ". ... ." ." ." ." ." ." ." ~ ...~ . ." ." ." ." ." ." 420 CAG ATC TCC TTC CCT GAC TACM C CTC CTG CAC GGA CGC AAC ACC TIC ATT GIG CGA GAC FAEES-Ill Gln Gly Cly Lys Thr Phe I l e Val Gly Asp Gln lle Ser Phe Ala Asp Tyr ArnImu Leu ... ... ." ." ." ." ." ." ." ." ." ." ." ." ." ." ." ... ." ." CSR-1 ." ." ." ." ." ." ". ". ... ." ." ." ." ." ." ." ." ." ." 480 FAEES-I11 GAC TTG CTGCTG ATC CAT GAC CTC CTA CCC CCT GGC CTG TCC CAT GCC TTC CCC CTG CTC Asp Leu Leu Leu 110 Hls GLu Val Leu Ala Pro Cly Cys Leu Asp Ala Phe Pro Leu Leu ... ... ." ." ." ." ."~ .." . ." ." ." . . ~ ~.~ . ~." . ." ". ." ." GSR-1 ." ." ~~. ." ." ." ."~ .." . ." ". ." ." . . ~ ." ." ". ." ." 540 FAEES-Ill TCA GCA TAT CTC CCG CGC CTC ACT GCC CGG CCC AAG CTC A A G GCC TIC GIG CCC TCC CCT S e r Ala Tyr Val Cly ArgLeu 5er Ala Arg Pro Lys Leu Lyr Ale Phe Vel Ala Ser Pro ." . . ~ ." ." ." ." ." ~ .." . ." .". ~ . ...~ .". . . C" ~ "C ~ .." . CSR-1 ..~ ... ." ." ." ." ." ... ." ." ." ." ." ... ." ... Le" ." .. ." 600 FAEES-I11 GAG TAC GTC AAC CTC CCC ATC AAT GCC AAC AMCGG CAG TGA GGGTTGGGCCGACTCTGACCGGA Glu Tyr ValAis" Leu Pro 11s As" Cly A m Gly Lys Gln End ... ... ." ." ."". ... ." ." ." ." ." ... ... csn-1 ." ." . . ~ ." ." ." ." ." ~ .." . ." ." ." End CSR.1

~~~

~~~

~~~

___

___

~

FAEES-I11

GGh*_T&SBI\TTTCTAAGA

FIG. 1. Nucleotide and deduced amino acid sequences of the FAEES-I11 cDNA compared with the nucleotide and amino acid sequences of G S T r - 1 cDNA (14).Dashed lines, areas of agreement between the two cDNAs. The Endrepresents a stop codon. The poly(A) adenylation signal, AATAAA, is underZined. The EcoRI site is shown by an arrow.

poly(A) tail. The termination codon TGA was found at nucleotide 631. Beginning with the consensus ATG initiation codon, an open reading frame coding for a protein with 210 amino acid residues was observed. The N-terminal amino acid sequence deduced from the nucleotide sequence agreed completely with that of the previously reported polypeptide sequence analysis except for positions 1, 14, 15, and 21, which were ambiguous in amino acid sequencing. The calculated molecular mass of the human FAEES-I11encoded by FAEESI11 is 23,307 daltons. Northern blot analysis was performed to determine the prevalence of FAEES mRNA in a number of organs affected by alcohol abuse. Total RNA from human liver, placenta, and heart was transferred to nitrocellulose paper from 1%agarose gel containing 2.2 M formaldehyde and hybridized with the 32P-labeledFAEES-111insert. Liver, placenta, and heartshow an intense mRNA band of 0.7-kilobase size (Fig. 2), demonstrating expression of FAEES-111 mRNAin these organs. Comparison of FAEES-111 with GSTr-1-We have shown previously by biochemical studies that FAEES-I11 is very similar to theGSTs. Since FAEES-111has an isoelectric point of 4.9 it is a member of the acidic GST class (6), a group that has not been cloned or sequenced from human organs other than GSTT-1 from MCF-7 cells (14). Comparison of the nucleotide sequences for GST7r-1 and FAEES-I11 reveals a marked similarity, with only six differences out of 683 nucleotides. As shown in Fig. 1, these differences occur at nucleotide positions 95,96,117,154,580, and585, and theseproduce changes in four amino acids, at positions 32, 39, 52, and 194. We have also compared the amino acid sequence of FAEES111 with that of therat anionic GST-Pand basic GST.

P

-P

Cloning Fatty Acid Ester Ethyl

16776

Synthase-111 cDNA

FAEES-I11 has an 84% homology with rat anionic GST-P (Table I) but only less than 10% homology with basic GST. Most of the homology between these two cDNAs occurs in two distinct areas (Table I). RNA blot hybridization analysis demonstrated synthesis of FAEES-I11 mRNA only in MCF-7 cells transfected with the appropriate FAEES-I11 cDNA (Fig. 2). The transfected cells have 4.2 units/mg protein synthase activity, and control cells have 0.30 units/mg protein synthase activity. These cells were Origin

28s

+

18s

0.7 kb

also assayed for GST activity and were found to have82 units/mg protein whereas controlcells have only 7 units/mg protein GST activity. Thus, the transfectedcells have 14-fold more synthase and 12-fold more GST activities compared with control cells. We haveobserved similar results when COS-7 cells transfected with FAEES-I11 cDNA and control cells were assayed forFAEE synthase and GST activities. We havemeasuredsynthaseactivity from GSTr-1-transfected MCF-7 cells and control MCF-7 cells. The GSTr-l-transfected cells have 0.18 units/mg protein synthase activity and 80 units/mg protein GST activity whereas the control cells have 0.24 units/mg protein synthase activity and 6 units/mg protein GST activity. Thus, these studies indicate that the differences in the amino acid sequence between FAEES-111 and that of GSTr-1 are importantfor synthase activity. Specific FAEES-I11 protein was also demonstrated inCOS7cells transfectedwith FAEES-I11 cDNA comparedwith control cells transfected with SFFV.neo with no cDNA. After lysis, proteins were precipitated and subjected to SDS-polyacrylamide gel electrophoresis. The proteinswere then transferred onto nitrocellulose paper and immunoblotted. Results show a veryclear banda t 24 kDa in the transfectedcells with FAEES-I11 cDNA; however, no band was observed in control cells transfected with SFFV.neo (Fig. 3). DISCUSSION

1

2

3

4

A full-length cDNA for human heart FAEES-I11 has been isolated by screening a Xgtll cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNA is consistent with results obtained from partial amino acid sequencing of FAEES-111, except for positions 1, 14, 15, and 21, which were ambiguous in the original peptide sequence analysis. A computer search of the GenBank revealed that the sequence of the isolated FAEES-I11 cDNAwas highly

5

FIG. 2. Northern blot analysis of total RNA from various tissues. About 20 pg each of total RNA from liver (lane I ) , placenta (lane 2 ) , heart (lane 31, MCF-’7 control cells transfected with SFFVmeo with no cDNA (lane 4 ) , and MCF-7 cells transfected with FAEES-111 cDNA (lane 5 ) were electrophoresed on a 1%agarose gel, transferredonto a nitrocellulose paper,and hybridized with “‘Plabeled FAEES-111 cDNA as described under “Experimental Procedures.”

TABLE I Amino acid sequence comparison between FAEES-111 and anionic rat GST-P (20) The star on the topof the amino acid marks the difference in amino acids. The table also shows the homology in the aminoacid sequence betweenFAEES-111 cDNA and humanbasic GST cDNA, pGTH-1(21). Thehomologous amino acids are in the box.

* FAEES-111 Rat GST-P pGTH-1

FAEES-I11 Rat Human

M P P Y T V I * * * * * T V E T C Q I D V W L

*

31

*

V Y F P V R G R C A A L R M L L A D Q G Q S W K E G V V E T E * * * 65 E G S L K A S C L Y G E L P K F Q D G D L T L Y Q S N T Q S T * * Q [ aa Q A

*.

FAEES-111 Rat GST-P Human pGTH-1 133

FAEES-111 Rat Human pGTH-1 FAEES-111 Rat Human pGTH-1

K Y I S L I Y T N Y E A G K D D Y V K A L P G Q L K P F E T L L S Q G T N H

* * * 167 N Q G G K T F I V G D Q I S F A D Y N L L D L L L I H E V L A P G C A N V Q 20 1

*

*

FAEES-111 Rat Human pGTH-1

D H L 210

FAEES-111 Rat GST-P Human D G T H - ~

N G N G K Q

*

* *

I

L S

* * * R

Cloning Fatty Acid Ester Ethyl

29 kD24 kD-

1

2

FIG. 3. Immunoblot analysis was performed in COS-7 cells transfected without and with FAEES-I11 cDNA, and cell culture media were isolated as described under “Experimental Procedures.” Lane 1 contained sample from control cells transfected with SFFV.neo without FAEES-111 cDNA.Lane 2 contained sample from transfected cells with the full-length FAEES-I11 cDNA. 25 pg of protein was loaded to each lane.

homologous to thesequence of a GSTr-1 cDNA from multidrug-resistant MCF-7 cells(14). Differences were observed in only six nucleotides, resulting in a change of 4 amino acid residues (Fig. 1). Gly-32 and Cys-39 in the FAEES-I11 sequences were reported to be glutamic acid and tryptophan, respectively, in the GSTn-1. Likewise, Glu-52and Val-194 in FAEES-I11were substituted by glutamine and leucine, respectively, in GSTn-1. The other nucleotide differences between the two cDNA sequences were observed at the5’- and 3”untranslated region of mRNA, which did not affect the translated sequence of the protein. The sequence of FAEES-I11 was also compared with that of the anionic GST-P from rat,and 84% homologywas observed. Sixteen of the 34 differences in amino acid sequence of these two cDNAsare conservative in nature. However, less than 10% homology exists between FAEES-I11 and the deduced amino acid sequence of a human basic GST pGTHl cDNA (15). Previous studies have also suggested that there are four base differences or two amino acid differences in rat liver glutathione S-transferase Y b l cDNA and rat prostate androgen-repressedcDNA (16). Thus thepresent comparison studies suggest that FAEES-I11and anionic GSTs may belong to the same gene family but may differ for most of the previously studied GSTs which have basic isoelectric points. FAEES-I11 cDNA was subcloned in a SFFV.neo expression vector and transfected into MCF-7 and COS-7 cells. These transfected cells wereassayed for synthase activity as well as GST activity. Transfected cells have 14-fold more synthase activity and 12-fold moreGST activity compared with control cells. Since there isno synthase activity in MCF-7cells transfected with GSTn-1 it is likely that the six nucleotide and four amino acids differences in FAEES-I11cDNA are encoding for protein structural changes responsible for specific enhancement of synthase activity. Immunoblotting analysis clearly showsthat theprotein secreted by transfected COS-7 cells is recognized by the rabbit antibody raised against FAEES-111. Thus, the differences between the sequence of FAEES-I11 and GSTn-1 reflect inherent functional differences rather than trivial ones or sequence errors.

Synthase-111cDNA

16777

We have shown previously that both FAEE synthase and GST can catalyze the formation of fatty acid ethyl esters and glutathione conjugates. Our present findings further complement thepeptide structural andfunctional findings that place the human FAEES-I11 within a family of detoxification enzymes (6-8). In this regard, our observation from segregation analysis that FAEE synthase activity is heritable as a recessivegeneforhigh activity (17, 18) is consistent with the concept of detoxification pathways modulating development of alcohol-induced disease. Northern blot analysis shows that liver, placenta, and heart express the FAEES-I11 mRNA. We have shown in our previous reports (2-4, 19) that liver, placenta, and heart have significant FAEE synthase activity. Thepresent findings confirm the existence of FAEES-I11 in these organs. In summary, the present investigation is the first to report the cloning and sequencing of an FAEES-I11 cDNA whichis a member of GSTs andcould beresponsible for nonoxidative ethanol metabolism. Further studies on genomic cloning, gene polymorphism, and characterization are under way to help us elucidate potential mechanisms of vulnerability to alcoholinduced diseases. Acknowledgments-We appreciate the helpful suggestions of Kathryn Liszewski, Drs. Khalid Masood, Vijaya Kumar, and Ted Post. We greatly appreciate Dr. Jeffrey Moscow and Dr. Kenneth Cowan from NCI for providing us the GSTr-1-transfected cells and control cells. We also greatly appreciate Dr. Curtis Spilburg for the critical review of this manuscript. We thank Glenda Chrisman and Helen Nikolaisen for their skillful help in preparing the manuscript and Nancy G. Kohler for growing the MCF-7 and COS-7 cells. REFERENCES L. G . (1991) in Alcohol and Drug Abuse Reviews (Watson. R. R.., ed). Vol. 2,.DD. _- 350-358, Humana Press Inc., Clifton, NJ ’ 2. Laposata, E. A., and Lange, L. G. (1986) Science 231,497-499 3. LaDosata. E. A., Scherrer, D.E.,Mazow,C., and Lange, L. G. (1987) 2. Biol.’Chem. 262,4653-4657 4. Laposata, E. A., Scherrer, D. E., and Lange, L. G. (1989) Arch. Pathol. Lab. Med. 113,762-766 5. Lange, L. G., and Sobel, B. E. (1983) J. Clin. Invest. 72,724-731 6. Bora, P. S., Spilburg, C. A., and Lange, L. G . (1989) Proc. Natl. Acad. Sei. U. S. A. 86,4470-4473 7. Bora, P. S., Spilburg, C.A., and Lange, L.G. (1981) J. Clin. Invest. 84,1942-1946 8. Bora, P. S., Spilburg, C. A., and Lange, L. G. (1989) FEBS Lett. 258,236-239 9. Hanahan, D., and Meselson, M. (1980) Gene (Amst.) 10,63-67 10. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sei. U.S. A. 74,5463-5467 11. Fuhlbrigge, R. C., Fine, S. M., Unanue, E. R., and Chaplin, D. D. (1988) Proc. Natl. Acad. Sci. U.S. A. 85,5649-5653 12. Laemmli, U. K. (1970) Nature 227,680-685 13. Burnette, W. N. (1981) Anal. Biochem. 112,195-203 14. Moscow, J. A., Fairchild, C. R., Madden, M. J., Ranson, D. T., Wieand, H. S., O’Brien, E. E., Poplack, D. G., Cossman, J., Myers, C. E., and Cowan, K. H.(1989) Cancer Res. 49, 14221428 15. Rhoads, D. M., Zarlengo, R. P., and Tu, C. P. D. (1987) Biochem. Biophys. Res. Commun. 145,474-481 16. Chang, C., Saltzman, A. G., Sorensen, N. S., Hiipakka, R. A., and Liao, S. (1987) J. Biol. Chem. 262, 11901-11903 17. Wright, M., Bieser, K. J., Kinnunen, P. M., and Lange, L. G . (1987) Bwchem. Biophys. Res. Commun. 142,979-985 18. Gilligan, S. B., Lange, L.G., Reich, T., and Cloninger, C. R. (1987) Am. J. Hum. Genet. 41, 255 (abstr.) 19. Bora, P. S., Bora, N. S., and Lange, L. G. (1991) Clin. Res. 39, 295 (abstr.) 20. Suguoka, Y.,Kano, T., Okuda, A., Sakai, M., Kitagawa, T., and Muramatsu, M. (1985) Nucleic Acids Res. 13, 6049-6057 21. Tu, C. P. D., and Qian, B. (1986) Biochem. Biophys. Res. Commun. 141,229-237 1. Bora, P. S., and Lange,