Molecular identification and diversity of Asian Citrus

Pest Management in Horticultural Ecosystems, Vol. 22, No. 1 pp 51-57 (2016)

Molecular identification and diversity of Asian Citrus Psyllids using mtCoI gene sequences B. N. CHAITANYA1* , R. ASOKAN1* , K. B. REBIJITH1, C. N. RAO2, P. RAM KUMAR1 and N. K. KRISHNA KUMAR3 1

Division of Biotechnology, Indian Institute of Horticultural Research, Hessaraghatta Lake Post, Bengaluru-560089, India. Division of Entomology, National Research Centre for Citrus, Nagpur, Maharashtra-440033. 3 Bioversity International, NASC, New Delhi-110012, India. *E-mail: [email protected], [email protected] 2

ABSTRACT: The current study involves identification of 10 specimens of Asian citrus psylla infesting citrus in different geographical regions of India through DNA barcoding. Psyllids are phloem feeding insects that cause a serious devastation to citrus. Considering the invasiveness of the pest, it is necessary to identify them rapidly and accurately. The classical taxonomy is associated with certain limitations while, COI based identification comes handy as it is applicable on developmental stages. The technique uses 51 region of mitochondrial cytochrome oxidase-I for reliable and accurate species identification. Further, our study revealed that among 794 bp there were 23 variable nucleotides with 7 nucleotides being Parsimony informative, also overall Transition (ti) / Transversion (tv) bias was found to be R=4.95. In addition, the Neighbour-Joining (NJ) tree showed clear clades with an out group Pachypsylla venusta (NCBI accession numberAY278317). Hence our study showed that DNA barcoding will assist in rapid and accurate identification of species which will be a valuable tool in pest management. Keywords: Asian citrus psylla, DNA barcoding, Huanglongbing, novel COI primer

bacterium, Candidatus liberi bacterasiaticus (Lallem and et al., 1986; Pluke et al., 2008) causes the disease, the affected plant shoots turn to characteristic yellow. In addition, it causes mottling, chlorosis which resembles zinc deficiency (Capoor et al., 1974). Eventually brings down the marketability and economical blow-off to the growers as well as the citrus processing industries. In view of the invasiveness of this pest, an effective, rapid and timely identification has to be carried out so that the epidemic of the pe st c an be ma na ge d. T hough morphological identification is useful and has limiting fac tors like availa bility of adult spec imens for identification, in experienced specialists, unavailability of identification ‘keys’ at all developmental stages or damaged specimens,where not only a trained person but even the specialist may face difficulty in identification. In this regard, the current study adopts molecular species identification based on mitochondrial cytochrome oxidase I (COI), obviate since the technique not only the ne ce ss itie s as sociated with the morphologica l identification but expedite in quarantine at the ports of entry (Asokan et al., 2015).

INTRODUCTION Diaphorina citri Kuwayama (Hemiptera: Psyllidae), commonly known as Asian Citrus Psyllid (ACP) or Asiatic psylla is a phloem feeding pest on citrus. It is widely distributed in many parts of Asia viz. India, China, Burma, Malaysia, Indonesia, Taiwan, Mauritius, Arabia (Hoy and Nguyen, 1996). In India, as compared to southern parts it is distribute d in northern part because of high cultivation of citrus (Randhawa and Srivastava, 1986). Apart from Asian continent, it is observed in several parts of Africa (Bové, 2006). The damage caused by psyllid leads to deformation in plant shoots because of toxic substance present in their saliva. Also, the insect excretes copious amounts of honey dew which forms sooty mould on the lea f surfac e whic h hinders the photosynthesis their by leads to eventual death of plant (Chien and Chu, 1996). The ACP is most devastating when accompanied by pathogens causing yellow shoot disease known as huang long bing (HLB) often called as yellow dragon disease in China (Anonymous, 1996). When the vectored pathogen i.e., phloem-inhabiting

51

Chaitanya et al.

Use of molecular markers envisioned the versatility as sociated with mitochondria l DNA, in spec ie s identification, phylogenetic (Caterino et al., 2000) and population genetic studies (Behura, 2006). Over past three decades, molecular markers are extensively used in species identification which augmented conventional taxonomy. The uniqueness like quick, precise and ease to use properties, maternal inheritance,high copy number and less interspecific variations as compared with other markers allied with mitochondrial gene made them popular in molecular systematic (Savolainen et al., 2005). The concept of DNA barcoding was put forward by Hebert et al., 2003a. The aim of DNA barcoding is to facilitate a proficient and reliable method in species identification across the taxa. The barcoding is carried out from a short segment of DNA sequence from the mitochondrial cytoc hrome oxidase-I gene, which is termed as a standard region or barcode region.At present, iBOL (International consortium for barcode of life) upholds the us e of universa l s tandard-COI for spe cie s level identification since it exhibits reliable interspecific variations (Savolainen et al., 2005). Currently, our study employed COI specific primer for molecular species identification of ten Asian citrus psylla from different regions of India (Table1).

[100mMNaCl, 10mM TrisHcl (pH-8.0) and 1m MEDTA (pH-8.0)]. The homogenized tissue was taken in sterile Eppendorf tube and incubated for 1 hour at 65°C with frequent tapping of the tube for every 15-20 min for proper homogenization. After completion of incubation, the homogenate was centrifuged at 8000rpm for 15 min at room temperature followed by ethanol precipitation. The precipitated DNA was dissolved in 20.0 µl of nuclease free water (Eppendorf, Germany). Quantification of the DNA was carried out using Nanodrop (Thermo scientific, Germany) as per the standard operational procedures. Further dilution is carried out, such that the working solution reaches 20-25ng/µl concentration. Glycerol stock (10%) of total DNA was made and pres erved at -80°C for future refere nce purpose. Polymerase Chain Reaction (PCR) was carried out in a thermal cycler (AB-Applied Biosystems, Veriti 96 wells, USA) with following PCR cocktail for 25µl of reaction volume: two micro litres of DNA template, 20 Pico mole of both forward and reverse primers (DCITRI COI-L and DCITRI COI-R respectively),2.5mM of Taq buffer, 0.25mM of dNTP mix, 2.5 mM of Mgcl2, 0.5U of Taq DNA polymerase (Fermentas Life Sciences) and with temperature conditions set as 94°C for 4 minutes as initial denaturation, followed by 35 cycles of 94°C for 40 seconds, annealing 48°C for 40seconds extension at 72°C for 45 seconds, 72°C for 10 minutes as final extension and 10°C as hold . The amplicons were resolved in 1.0% agarose gel with ethidium bromide (10ìg/mL) a nd documented under UVP (Gel documentation system).

MATERIALS AND METHODS Samples of Asian citrus psylla, were collected from different geographical locations of India and preserved in ethyl alcohol (70%). Samples were stored in -20°C until DNA was extracted.

Molecular Cloning and Sequencing

Amplification using novel COI primers

The amplicons were eluted using Nucleospin ExtractII kit (Ma cherey Nagel, Ge rmany) a cc ording to manufacturer protocol. Using PTZ57R/T a general purpose cloning vector (Fermentas GmBH, Germany), the PCR product was ligated as per the manufacturer proc edure s. Tra ns forma tion is ca rried out using Escherichia coli (DH5á- strain) cells according to standard protocol (Fermentas GMBH, St. Leon-Rot, Germany; Thermo scientific). Further, the cells were incubated overnight at 37 °C on LB-Agar comprising ampicillin (100mg/mL) to develop colonies. Blue/White screening was carried out and white colonies harbouring positive transformants were inoculated into LB broth and was incubated overnight in a shaker incubator at 37° C and 220 rpm for proliferation of clones. Plasmids were isola te d us ing Ge ne J ET Pla smid MiniPre p Kit (Fermentas, Germany) as per manufacturer protocol. Sequencing was carried out in an automated sequencer

An amplification of 794bp fragment of COI region was successful using novel primers [generated form EST library generated USDA (Hunter et al., 2008)]. The primer used in the present study was DCITRI COI-L 51 - AGGAGGTGGAGACCCAATCT and DCITRI COI-R 51 - TCAATTGGGGGAGAGTTTTG.

DNA Isolation, In-vitro Amplification and Sequencing Total DNA was isolated from a small incised portion of specimen abdomen. Re st of the specime n was deposited as specimen voucher at IARI, New Delhi in the division of Entomology. Total DNA was extracted us ing ce tyltrime thyl a mmonium Bromide method (Rugman-Jones et al., 2006) which involved grinding of tissue in a sterile mortar and pestle with liquid nitrogen. Later, it was homogenized with 300µl of STE buffer Pest Management in Horticultural Ecosystems, Vol. 22, No. 1 pp 51-57 (2016)

52

Molecular identification and diversity of Asian Citrus Psyllids

Fig. 1. Consensus sequence of 794 bp from the mitochondrial cytochrome oxidase I (COI) gene for Citrus psylla species collected from different locations in India Pest Management in Horticultural Ecosystems, Vol. 22, No. 1 pp 51-57 (2016)

53

Chaitanya et al.

Fig. 2. Phylogenetic tree of citrus psylla based on nucleotide sequences using MEGA 7.0 (NJ method with 1000 bootstrap replicates). Out group used is Pachypsylla venusta (NCBI accession number AY278317). there were no report of indels. The sequences generated in this study were deposited in NCBI-Gen Bank under the following ac ce ss ions KF702297, KF702298, KF702299, KF702300, KF702301, KF702302, KF702303, KF702304, KF702305 and KF702306.

(ABI Prism® 3730 XL DNA Analyser; Applied Biosystems, USA) using M13 universal primers both forward and reverse directions. Homology search was carried out using NCBI-BLAST (http://www.ncbi.nlm.nih.gov), and the differences in COI sequences were determined using the sequence alignment editor BioEdit version 7.0.5.3 (Hall, 1999). Neighbour-joining trees were constructed using Kimura-2-parameter (K2P) distance model (Kimura, 1980; Saitou and Nei, 1987) employing MEGA.5.0. (Tamura et al., 2011). Sequences were deposited with NCBI database.

Pairwise alignment of all the psylla species under study showed 23 variations out of 794bp accounting to 2.89 % difference (Fig. 1). Sequence analysis showed 7 parsimony informative(Pi) sites. A bootstrap test for resolution of clustering patterns in the tree was conducted using MEGA 5.0 with 1,000 replications (Fig. 2) (Tamura et al., 2011). The nucleotide frequencies of all the psylla specimens were 32.39% (A),36.79% (T/U), 16.94% (C) and 13.88% (G). The overall Transition (ti)/ Transversion (tv) bias was found to be (R=) 4.95.

RESULTS AND DISCUSSION The PCR amplified 10 distinct specimens, using COI specific novel primer was successfully sequenced. It revealed a length of 794bp and showed maximum hits for the respective species when BLAST search was carried out. To rule out the possibility associated with the sequencing error, triplicates sequencing for individual psylla specimen was carried out. Also, all the triplicate sequences were devoid of nuclear copies amplification since there were no stop codons within the region and Pest Management in Horticultural Ecosystems, Vol. 22, No. 1 pp 51-57 (2016)

Reliable, accurate and timely identification of notorious insect pests like D. citri is vital and challenging worldwide, since they occupy predominantly to all other insects both in diversity as well as in population (Whitcomb et al., 1988). More clarity is required to 54

Molecular identification and diversity of Asian Citrus Psyllids

Table 1. Specimens collected from different locations in India and NCBI accessions Species

Location

NCBI Accession

Citrus psylla

Sriganganagar (Rajasthan)

KF702297

Citrus psylla

Ludhiana (Punjab)

KF702298

Citrus psylla

Harayana

KF702299

Citrus psylla

Uttarkhand

KF702300

Citrus psylla

Kinkhede (Nagpur)

KF702301

Citrus psylla

Warud (Amravati)

KF702302

Citrus psylla

NRCC, Nagpur

KF702303

Citrus psylla

Pipla (Kinkhede)

KF702304

Citrus psylla

NRCC (Nagpur)

KF702305

Citrus psylla

Delhi

KF702306

ACKNOWLEDGMENT

distinguish and to identify these pests which are of quarantine significance (Armstrong and Ball, 2005). In such an occasion, molecular species identification using COI marker has added advantages like, it is independent of life stages, polymorphism and gender (Asokanet al., 2011). Mitochondrial cytochrome oxidase marker is versatile because of its prevalence in cells by having a high copy number in comparison with nuclear genes. Mitochondrial cytochrome oxidase I gene also possess unique properties like maternal inheritance, highly conserved with short intragenic regions and absence of introns (Simon et al., 1994). Apart from routine molecular identifications, COI is also employed in discovery of new species (Foottit, 1997; Sallum et al., 2008, 2010; Bourke et al., 2013; Foster et al., 2013) and to interpret the prelavance of biotypes (Shufran et al., 2000). Recently, Boykin et al., (2012), studied the existence of relationship between different collections of D.citri around the world employing mitochondrial cytochrome oxidase-I.

This work was carried out under “Out Reach Program on the management of sucking pests” funded by Indian Council of Agricultural Research (ICAR), New Delhi, India.The authors are thankful to the Director, Indian Institute of Horticultural Research, Bengaluru for providing all the facilities.

REFERENCES Anonymous. 1996. Preface, pp. v-vi In J. V. da Graça, P. Moreno, and R. K. Yokomi [eds.], Proc. 13th Conference of the International Organization of Citrus Virologists (IOCV). University of California, Riverside. Armstrong, K. F. and Ball S. L. 2005. DNA barcodes for bio secu rity: invasi ve speci es i dent ificatio n. Philosophical Transactions of the Royal SocietySeries B, Biological Science, 360: 1813-1823. Asokan, R., Chaitanya, B. N., Rebijith, K. B., Krishna Kumar, N. K., Viraktamath, C. A. and Ramamurthy, V. V. 2015. COI based molecular identification of mango leaf hoppers (Hemiptera: Cicadellidae) in India. Indian Journal of Biotechnology, 14(4): 260-263.

Moreover, none of the citrus growing country in the world has successfully managed in eradication of HLB (Citrus greening disease) completely. This can be achieved only on successful and timely identification of the invasive pest. In this context, more research is required in priority on a timely and reliable diagnosis irrespective of the life stages and gender. Data procured in current study provides information which can be used in identification, management and quarantine purposes.


Asokan, R., Rebijith, K. B., Shakti, K. S., Sidhu, A. S., Siddharthan, S.et al., 2011. Molecular identification and phylogeny of Bactrocera species (Diptera: Tephritidae). Florida Entomology, 94: 1026-1035. Behura, S. K. 2006. Molecular marker systems in insects: current trends and future avenues. Molecular Ecology, 15: 3087–3113.

55

Chaitanya et al. Bourke, B. P., Oliveira, T. P., Suesdek, L., Bergo, E. S., Sallum, M. A. 2013. A multi-locus approach to barcoding in the Anopheles strodei subgroup (Diptera: Culicidae) 111. Parasites and Vectors, 6.

Hunter, W., Katsar, C. S., Shatters, R, G. Jr., McKenzie, C. L., Weathersbee, A. A. and Hall, D. G. 2008. Psyllid biology: Expressed genes in adu lt Asian ci trus psyllids, Diaphorina citri Kuwayama. The Open Entomology Journal, 3: 18–29.

Bové, J. 2006. Huanglongbing: a destructive, newlyemerging, century-old disease of citrus. Journal of Plant Pathology, 88: 7–37.

Ki mura, M. 198 0. A simple met hod for esti mati ng evolut ionary rate of base substit utio ns t hrou gh comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16: 11-120.

Boykin, L. M., De Barro, P., Hall, D. G., Hunter, W. B., McKenzie, C. L. et al., 2012. Overview of worldwide diversity of Diaphorina citri Kuwayama mitochondrial cytochrome oxidase I haplotypes: two Old World lineages and a New Wo rld invasion, Bul letin of Entomological Research, 102: 573–582.

Lallemand, J., Fos, A. and Bové, J. M. 1986. Transmission de la bacterieassocié à la formeafricaine de la maladie du “greening” par le psylleasiatique Diaphorina citri Kuwayama. Fruits, 41: 341-343.

Capoor, S. P., Rao, D. G. and Viswanath, S. M. 1974. Greening disease of citrus in the Deccan Trap Country and its relati onship with the vector, Di apho rina Cit ri Kuwayama, In L. G. Weathers and M. Cohen [eds.], Proc. 6th Conference of the International Organization of Citru s Viro logists., Universit y of Cali fornia, Richmond, pp. 43-49.

Pluke, R. W. H., Quershi, J. A. and Stansly, P. A. 2008. Citrus flu shing pat terns, Dia phorin a cit ri (Hemi ptera: Psyllidae) populations and parasitism by Tamarixia radiate (Hymenoptera: Eulophidae) in Peurto Rico. Florida Entomologist, 91(1): 36-42. Randhawa, G. S. and Srivastava, K. C. 1986. Insects Pests in Cit ri cultu re i n India. Hi ndustan Publ ishi ng Corporation, pp 316-334.

Caterino, M. S., Cho, S. and Sperling, F. A. H. 2000. The current state of insect molecular systematics: a thriving tower of Babel. Annual Review of Entomology, 45: 1–54.

Rugman-Jones, P. F., Hoddle, M. S., Mound, L. A. and Stouthamer, R. 2006. Molecular identification key for pest species of Scirtothrips (Thysanoptera: Thripidae). Journal of Economic Entomology, 99: 1813–1819.

Chien, C. C. and Chu, Y. I.1996. Biological control of citrus psyllid, Diaphorina citri in Taiwan. Biological Pest Control in Systems of Integrated Pest Management – 1996. Reprinted from Food and Fertilizer Technology Center Book Series No. 47 (ed. byG Grey), Food and Fertilizer Technology Center for the Asian and Pacific Region, Taipei, Taiwan, pp. 93–104.

Saitou, N. and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4): 406-25. Sallum, M. A. M., Foster P. G., dos Santos, C. L., Flores, D. C., Motoki, M. T., Bergo, E. S. 2010. Resurrection of two species from synonymy of Anopheles (Nyssorhynchus) st rodei Ro ot and characterization of a di stinct morphological form from the Strodei complex (Diptera: Culicidae). Journal of Medical Entomology, 47: 504–526.

Foottit, R. G. 1997. Recognition of parthenogenetic insect species. In: Species. The Units of Biodiversity (eds Claridge MF, Dawah HA, Wilson MR). Chapman and Hall. London, pp. 291–307. Foster, P. G., Bergo, E. S., Bourke, B. P., Oliveira, T. P., Nagaki, S. S., Sant’Ana, D. C., Sall um, M. A. M. 20 13. Phylogenet ic analysis and DNA-based speci es confirmation in Anopheles (Nyssorhynchus). PLoS ONE, 8.

Sallum, M. A. M., Marrelli, M. T., Nagaki, S. S., Laporta, G. Z., dos Santos, C. L. 2008. Insight into Anopheles (Nyssorhynchus) (Diptera: Culicidae) species from Brazil. Journal of Medical Entomology, 45: 970–981.

Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/ 98/NT. Nucleic Acids Symposium Series, 41: 95-98.

Savolainen, V., Cowan, R. S., Vogler, A. P., Roderick, G. K. and Lane, R. 2005. Towards writing the encyclopaedia of life: an introduction to DNA barcoding. Philosophical Transactions of the Royal Society of London Series B, Biological Science, 360: 1805-1811.

Hebert, P. D. N., Cywinska, A., Ball, S. L. and deWaard, J. R. 2003a. Biological identifications through DNA barcodes. Proceeding of the Royal Society of Biological Sciences, 270: 313-321.

Shufran, K. A., Burd, J. D., Anstead, J. A. and Lushai, G. 2000. Mitochondrial DNA sequence divergence among green bug (Homoptera: Aphididae) biotypes: evidence for host-adapted races. Insect Molecular Biology, 9: 179–184.

Hoy, M. A. and Nguyen, R. 1996. Classical biological control of potential new pests of Florida citrus. Citrus Industry, 77(11): 18-19. Pest Management in Horticultural Ecosystems, Vol. 22, No. 1 pp 51-57 (2016)

56

Molecular identification and diversity of Asian Citrus Psyllids Simon, C., Frati, F., Bechenbach, A. and Crespi, B. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequ ence and compilation of conserved polymerase chain reaction primers. Annals of Entomological Society of America, 87: 651-701.

evolut ionary distance, and maximum parsimo ny methods. Molecular Biology and Evolution, 28: 2731-2739. Whitcomb, R. F. and Hicks, A. L. 1988. Genus Flexamia: new species, phylogeny and ecology. Great Basin Naturalist Memoirs, 12: 224-323.

Tamura, K., Peterson, D., Peterson, N., Steker, G., Nei, M. and Kumar, S. 2011. MEGA5: Molecular evolutionary geneti cs analysis using maximum l ikel ihoo d,


MS Received : 16 January 2016 MS Accepted : 29 March 2016

57