Molecular markers for kernel bitterness in almond | SpringerLink

Tree Genetics & Genomes (2010) 6:237–245 DOI 10.1007/s11295-009-0244-7

ORIGINAL PAPER

Molecular markers for kernel bitterness in almond Raquel Sánchez-Pérez & Werner Howad & Jordi Garcia-Mas & Pere Arús & Pedro Martínez-Gómez & Federico Dicenta

Received: 9 December 2008 / Revised: 29 July 2009 / Accepted: 23 September 2009 / Published online: 13 October 2009 # Springer-Verlag 2009

Abstract Upon crushing, amygdalin present in bitter almonds is hydrolysed to benzaldehyde, which gives a bitter flavour, and to cyanide, which is toxic. Bitterness is attributable to the recessive allele of the Sweet kernel (Sk/sk) gene and is selected against in breeding programmes. Almond has a long intergeneration period due to its long juvenile phase, so breeders must wait 3 or 4 years to evaluate fruit traits in the field. For this reason, it is important to develop molecular markers to distinguish between sweet and bitter genotypes. The Sk gene is known to map to linkage group five (G5) of the almond genome, but its function is still undefined. Candidate genes involved in the amygdalin pathway have been mapped, but none of them were located to G5. We have saturated G5 with additional Simple Sequence Repeats (SSRs) using the progeny from the cross “R1000”דDesmayo Largueta” and found six SSRs (UDA045, EPDCU2584, CPDCT028, BPPCT037, PceGA025, and CPDCT016) closely linked to the Sk locus. The genotypes of four of these SSRs flanking the Sk locus, in a number of parents and a few seedlings of the CEBAS-CSIC almond breeding programme, allowed us to estimate the haplotypes of Communicated by E. Dirlewanger Electronic supplementary material The online version of this article (doi:10.1007/s11295-009-0244-7) contains supplementary material, which is available to authorized users. R. Sánchez-Pérez (*) : P. Martínez-Gómez : F. Dicenta Departamento de Mejora Vegetal, CEBAS-CSIC, Apdo. 164, 30100 Espinardo, Murcia, Spain e-mail: [email protected] W. Howad : J. Garcia-Mas : P. Arús IRTA, Centre de Recerca en Agrigenòmica CSIC-IRTA-UAB, Ctra. Cabrils Km 2, 08348 Cabrils, Barcelona, Spain

the parents, identifying the marker alleles adequate for an early and highly efficient selection against bitter genotypes. This analysis has established the usefulness of SSRs for screening populations of fruit trees such as almond by an easy, polymerase chain reaction-based method. Keywords Almond . Amygdalin . Bitterness . Candidate genes . Marker-assisted selection . SSRs

Introduction Recent inheritance studies have provided evidence that more than one gene is involved in bitterness in other Prunus species such as apricot (Prunus armeniaca), where five unlinked genes involved in two distinct biochemical pathways (three in the biosynthesis of cyanoglucosides or their transport and two involved in the breakdown of cyanoglucosides) have been associated with bitterness (Negri et al. 2008). In contrast, genetic studies in peach (Prunus persica) have proposed a monofactorial inheritance, with bitterness dominant to sweetness in kernels (Werner and Creller 1997). In the case of almond, the determination of sweetness or bitterness depends on the genetic background of the sporophyte. Therefore, all fruits of an almond tree will have either sweet or bitter kernels (Kester and Asay 1975), and thus, the influence of both genitors can only be shown in the following generation (Dicenta et al. 2000). Kernel bitterness is determined by the Sk (Sweet kernel) locus, the sweet allele being dominant to the bitter one (Heppner 1923, 1926; Dicenta and García 1993; Vargas et al. 2001; Dicenta et al. 2007). Metabolic and genetic studies of sweet and bitter almonds show that a seed coat UDP-glucosyltransferase (GT1; see Fig. 1) is associated with bitterness (Franks et al. 2008). Distinct

238

Tree Genetics & Genomes (2010) 6:237–245

apricot, almond, and plum) (Dirlewanger et al. 2004). The Sk locus has been located to linkage group five (G5) (Joobeur 1998; Sánchez-Pérez et al. 2007). Two RFLPs (FG202 and AG46) were identified close to the Sk locus by Joobeur et al. (1998). However, RFLPs are not adequate for routine plant breeding applications as they require considerable amounts of high quality DNA (microgram) and a hybridisation step using probes against genomic DNA. Instead, SSRs require only nanogram of DNA and a simple and relatively cheap polymerase chain reaction (PCR) better suited to the large-scale determinations needed for marker-assisted breeding. Several SSRs were mapped in T×E in the region of G5 where Sk is located (Dirlewanger et al. 2004; Howad et al. 2005); we have studied these markers in an almond population segregating for the bitterness character and have found some of them to be tightly linked to this gene and useful for its selection (Sánchez-Pérez et al. 2007). In this work, we have analysed a number of these SSRs in a range of cultivars and selections, to determine their usefulness in a wide range of breeding materials and to obtain molecular markers closer to the Sk locus. In addition, we have mapped candidate genes involved in the metabolic and catabolic pathways of amygdalin (three glucosyltransferases, one prunasin hydrolase, and one amygdalin hydrolase) as a complementary approach for the identification of markers suitable for the selection of this character and to elucidate further its biochemical basis.

cellular localisations of the enzymes involved in the degradation pathway, possibly involving a seed coat prunasin hydrolase, have also been suggested to be related to bitterness in almond (Sánchez-Pérez et al. 2008). However, the gene(s) determining bitterness in almond and in other Prunus species remains to be identified. The bitter taste in almond kernels is related to the content of the cyanogenic diglucoside amygdalin (McCarty et al. 1952; Chandler 1957; Woodroof 1967). Upon crushing mature, bitter almond kernels, amygdalin is degraded by the activity of three enzymes: the β-glucosidases amygdalin hydrolase (AH), prunasin hydrolase (PH), and mandelonitrile lyase 1 (MDL1). This is accompanied by the release of glucose, benzaldehyde (which confers a bitter flavour), and hydrogen cyanide (Fig. 1; Evreinoff 1952). Prunus fruit crops are woody perennial species characterised by a long intergeneration period due to their juvenile phase. For this reason, early selection of desired fruit/kernel traits based on molecular markers allows screening of seedlings several years before fruit/kernel characters can be evaluated in the field. The development of densely populated linkage maps using transferable markers, such as restriction fragment length polymorphisms (RFLPs) and simple sequence repeats (SSRs), has provided a foundation for more effective stone fruit genetics and breeding (Dirlewanger et al. 2004). A linkage map of 246 markers in an almond (“Texas”)×peach (“Earlygold”) F2 progeny was constructed (Joobeur et al. 1998). This map (T×E) has been designated as the Prunus reference map and currently has 826 markers (361 RFLPs, 11 isoenzymes, 449 SSRs, and 5 sequence-tagged sites; Dirlewanger et al. 2004; Howad et al. 2005). By using the data from different linkage maps anchored to this reference map, it has been possible to establish the position of 28 major genes affecting agronomic and fruit traits (kernel taste, blooming time, fruit flesh colour, etc.) in different species (peach,

Materials and methods Plant material The F1 progeny (n = 167) obtained from a cross between the French selection “R1000” (a seedling of the cross

N

C CH2O H

HO

O

O

OH

C H2

OH

H O

O

C

O

OH OH

GT2

OH

OH

OH

Amygdalin

PH

H

MDL1 + HCN

GT1

Prunasin

Mandelonitrile

O

OH

O

N

H O

AH

OH

OH

C

C H CH 2OH

N

H

H

CYP79

NH2

Benzaldehyde

1 P7 CY

N HO

Phenylalanine

Fig. 1 The metabolic pathways involved in the synthesis and catabolism of the cyanogenic glucosides prunasin and amygdalin in almonds. Catabolic enzymes (black lines): AH amygdalin hydrolase, PH prunasin hydrolase, MDL1 mandelonitrile lyase 1. Biosynthetic

Z-Phenylacetaldoxime

enzymes (dotted lines): CYP79 and CYP71 cytochrome P450 monooxygenases, GT1 Uridin 5’-diphosphoglucose (UDPG)-mandelonitrile glucosyltransferase, GT2 UDPG-prunasin glucosyltransferase

Tree Genetics & Genomes (2010) 6:237–245

239

“Tardy Nonpareil”דTuono”) and the Spanish cultivar “Desmayo Largueta” (R×D) was used to identify new SSR markers for G5 of the genetic linkage map previously developed by Sánchez-Pérez et al. (2007). Both parents were heterozygous (Sk/sk) and the progeny was segregated for sweet (Sk/Sk or Sk/sk) and bitter (sk/sk) kernels. The parents and the bin mapping F2 individuals of the T×E Prunus reference bin map were used to map the candidate genes for which we did not find polymorphisms in the R× D population. In addition, 86 almond genotypes (29 cultivars and 57 seedlings) belonging to the almond breeding programme of the CEBAS-CSIC, Murcia (Spain; see additional online material, Table A) were studied for allelic variation of SSRs close to the Sk locus. Young almond leaves were collected in spring, and DNA was extracted using the DNeasy® Plant Mini Qiagen kit. Search of SSRs linked to the Sk locus Twelve SSRs, previously located near the Sk locus in G5 by the bin mapping procedure (Howad et al. 2005) or mapped to G5 by Dirlewanger et al. (2004), were screened with a view to increasing the marker density in the region around the bitterness locus Sk. Of these 12 SSRs, six (CPDCT016, CPDCT028, EPDCU2584, UDA-043, UDA-045, and UDA-046) had been developed in almond (Mnejja et al. 2005; http://www.genome.clemson.edu/gdr; Testolin et al. 2004), and six (BPPCT037, EPPCU0004, EPPCU0863, EPPCU5504, EPPCU8871, and EPPCU9830) had been developed in peach (Dirlewanger et al. 2002; www.bioinfo. wsu.edu/gdr/). PCR amplification, automated capillary sequencing, and polyacrylamide and agarose gel electrophoresis were performed as described in the study of Sánchez-Pérez et al. (2007). Candidate gene search and analysis Five candidate genes (CGs) were selected in this study, based on a search in public databases for Prunus sequences with homology to enzyme sequences known to be involved

in amygdalin metabolism (Tables 1 and 2). Primers with lengths between 18 and 22 bp were designed for each CG using the Primer3 programme (http://frodo.wi.mit.edu/). PCR reactions were performed as described in the study of Sánchez-Pérez et al. (2007), with the following parameters: 2 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at (45–65°C), and 30 s at 72°C, with a final step of 5 min at 72°C. Amplified fragments were separated in 2% agarose gels with pUC Mix Marker (MBI Fermentas) as size standard. PCR fragments were purified and either directly sequenced or first cloned in pGEM-T Easy (Promega) and then sequenced. Sequencing was performed using the ABI Prism Big Dye-Terminator Cycle Sequencing Ready Reaction Kit 1.1 (PE Applied Biosystems) in the ABI Prism 377 sequencer (PE Applied Biosystems). Single nucleotide polymorphisms (SNPs) were analysed using the Staden software package (Bonfield et al. 1995). Once SNPs were detected between the parents, suitable restriction enzymes (New England BioLabs) were chosen to convert the SNPs into Cleaved Amplified Polymorphic Sequence (CAPS) markers. These were then mapped, either with the T×E bin mapping individuals or in the whole R× D population. Restriction fragments were resolved in 2% agarose gels and stained with ethidium bromide. In case the detected SNP could not be converted into a CAPS marker, the SNaPshot Kit (Applied Biosystems) was used to map the candidate gene. SNaPshot-labelled fragments were separated in an ABI® Prism 3100 (PE Applied Biosystems) sequencer. Each candidate gene was genotyped in the almond accessions “R1000” (Sk/sk), “Desmayo Largueta” (Sk/sk), “Texas” (Sk/sk), “S3067” (sk/sk), “Garrigues” (Sk/sk), and “Peraleja” (Sk/Sk) in the peach “Earlygold” (sk/sk) and in the “Texas”דEarlygold” hybrid (Sk/sk). This strategy was used to map the CGs in the T×E map (Howad et al. 2005) or the R×D map (Sánchez-Pérez et al. 2007) and to check, at the same time, the CG genotypes in the accessions “S3067” (bitter), “Garrigues” (sweet), and “Peraleja” (sweet), of known kernel taste alleles, as an additional control.

Table 1 Characteristics of the candidate genes for bitterness used for mapping Candidate gene

GenBank ID

Species

Size

Related sequence

E value blastx

Origin

GenBank ID

Gt1

BQ641080

Prunus dulcis

367 bp

Putative glucosyltransferase

3×10−19

Arabidopsis thaliana

AK221589

Gt2 Gt3 Ah1

BQ641082 AY354512 AF411130

P. dulcis P. persica P. serotina

474 bp 804 bp 1,915 bp

2×10−50 3×10−116 0

A. thaliana A. thaliana P. serotina

BT003687 NP_565485 AF414606

Ph

BU645544

P. dulcis

584 bp

Putative glucosyltransferase Glucosyltransferase Amygdalin hydrolase isoform I precursor Putative prunasin hydrolase isoform PH C precursor

1×10−22

P. serotina

AF411131

240

Tree Genetics & Genomes (2010) 6:237–245

Table 2 Designed primers for five candidate genes (CGs), annealing temperatures (°C), expected size (base pairs), SNPs positions (base pairs), and location in the linkage maps (R1000×Desmayo=R×D, or Texas×Earlygold bin map=T×E) Candidate Sequences (5′-3′) gene

Annealing Expected size temperature

Gt1

WH01: ACTAATTCGAAATTAGTG (→) WH02:TTATTAATAATAAAGTTGAAGG(←)

52,4

WH01/WH02: 334 Monomorphic

Unmapped

Gt2

JG03: TGGATGGTAGTGCAAAAGCA (→) WH04:CCTTAATTGGTCTAAGATAAA(←)

52,4

JG03/WH04: 458

G8 (R×D map)

Gt3

WH05: AACTATGATCATGAGACTG (→)

52,4

WH05/WH10: 777 49, 68, 251 365, 393, 398,

GT2_SNP: TTAATGGGTAAGTGCTATAC(→)

SNPs position

424 (C-A; C in “Desmayo L.“ and A in “R1000“)

Location of the CGs in the linkage map

G3 (T×E bin map)

418 (T-G; T in “Texas“ and G in“Earlygold“),

WH10: TCAAAATGTGCTCTTATGAG (←) GT3_SNP: ATTGAGGTTCAAAAATTTGC (→)

431, 512, 662

Ah1

AH-01: AATGGAGGAAGCCCTCAAAG (→) 53,4 AH-02: CACAAAGGGTCGAAACACCT (←)

AH01/AH02: 537

Indel

Ph

PH-01: GGATTCTTTGCATGGTCGTT (→) PH-02: AATCAAATGCATCGGTGGTC (←)

PH01/PH02: 456

54, G1 (T×E bin map) 105 (C-T; C in “Peraleja“and T in“S3067“),

65,0

G1 (T×E bin map)

192

The positions of SNPs used for mapping are italicised. Arrows indicate the direction of the primers → forward, ← reverse

Linkage analysis

Results and discussion

SSRs were added to the “R1000”דDesmayo Largueta” F1 progeny map using using MapMaker version 3.0 (Lander et al. 1987). A map for each parent was constructed, considering them as first backcross progenies. To include in the linkage analysis markers that segregate 1:2:1, we used only the homozygous markers and considered as missing data all heterozygous markers. Then, one of the homozygous classes was noted as homozygotic and the other as heterozygotic for the purpose of the MapMaker analysis. For the 1:1:1:1 segregations, they were divided into two 1:1 segregations, one segregating for “R1000” and the other for “Desmayo Largueta”. Segregation data for every CG were either added to the dataset of the R×D map (Sánchez-Pérez et al. 2007) and mapped using MapMaker or were “bin mapped” on T×E, using the eight plants of the bin set as described in the study of Howad et al. (2005). To estimate the linkage disequilibrium (LD) between SSRs and the Sk locus, we used the GenePop programme (http://genepop.curtin.edu.au/) that uses a test for independence based on the contingency table using a Fisher exact test. The accessions to be included in this analysis were the cultivars of unknown pedigree (most of them traditional cultivars) and the cultivars of known pedigree that did not have both parents selected. Known bud sports from other cultivars (i.e. “Tardy Nonpareil” with respect to “Nonpareil”) were also excluded.

SSR saturation of the region around the bitterness locus A total of 15 SSRs have now been located to G5 of the R× D map, including eight (BPPCT026, UDP97-401, BPPCT017, PceGA025, EPDCU4658, EPDCU5183, BPPCT038, and BPPCT014) previously mapped by Sánchez-Pérez et al. (2007) and seven (EPDCU9830, UDA045, EPDCU2584, BPPCT037, CPDCT016, CPDCT028, and EPDCU0004) from the total of 12 analysed in this study (Fig. 2). Together, these SSRs cover distances of 58 cM in the “R1000” map and 51 cM in the “Desmayo Largueta” map (Fig. 2), which are slightly longer than G5 (49 cM) of the T×E reference map (Dirlewanger et al. 2004). The five SSRs (EPPCU5504, EPPCU8871, EPPCU9830, UDA-043, and UDA-046) that were not mapped did not amplify or were homozygous in both parents. From the 15 SSRs located in G5, six (UDA-045, EPDCU2584, BPPCT037, CPDCT016, PceGA025, and CPDCT028) were close to Sk, in a region spanning 6.2 cM around the locus for the “R1000” map (G5R) and 11.7 cM for the “Desmayo Largueta” map (G5D; Fig. 2). Only EPDCU2584, BPPCT037, and PceGA025 were heterozygous in both parents, showing either a 1:1:1:1 (BPPCT037 and PceGA025) or a 1:2:1 (EDPCU2584) segregation (Table 3). The bitterness trait was also heterozygous in both parents (Sk/sk x Sk/sk) but was scored as dominant (sweet vs bitter), since we could not

Tree Genetics & Genomes (2010) 6:237–245

distinguish between sweet homozygous and heterozygous, providing a 3:1 segregation with lower resolution for mapping than the codominant SSRs. In G5R, the Sk locus cosegregated with BPPCT037 and PceGA025 and separated by a single recombination event (0.6 cM), and its position was estimated to be in the region where these two SSRs map (Fig. 2). In G5D, BPPCT037 and PceGA025 were 9.9 cM apart, and Sk could be mapped between them, suggesting that its position in the G5R map is also between these markers. These data also indicate a higher frequency of recombination for this region in “Desmayo Largueta” compared with “R1000”. Different overall or regionspecific rates of recombination have been observed in Prunus (Arús et al. 2005), which may depend on the specific genotypic composition of each individual, as it may happen in the two parents of R×D. UDA-045, CDPCT016, and CPDCT028 were heterozygous in only one parent (Table 3). With them, we could only tag the sk allele coming from this parent. Selection against this allele with one of these markers would allow most of the bitter kernel individuals to be discarded, but a number of the sweet kernel ones that would have inherited the Sk allele from the other parent would also be discarded. For example, CPDCT016 segregates 1:1, where genotype 211/211 bp was found mainly in sweet descendants (68%) and in only 3% of bitter ones. However, if the 211/211 bp genotype for CPDCT016 were used for selection in the R× D population, the breeder would lose the 32% of the individuals with 211/228 bp accessions that are also sweet from the total population (Table 3). If we measure the efficiency of marker-assisted selection (MAS) by a coefficient (EC=the number of correctly classified plants per total; maximum efficiency is EC=1, and we typically seek values close to 1), we find that, for this case, it has a relatively low value: EC= 0.77. Therefore, this marker should either be discarded or used with another SSR that tags the allele coming from the other parent. Efficiency can be improved by using markers that are heterozygous in both parents, as in the case of EPDCU2584, BPPCT037, and PceGA025 (Table 3). For example, selection against the genotype 193/201 of PceGA025, which segregates 1:1:1:1, would eliminate most (93.5%) of the bitter kernel individuals. However, 4% of the seedlings for which there is information on this marker and the kernel taste trait would have been misclassified (EC = 0.96): 2% being accepted and having the bitter taste and 2% being rejected and sweet. A third approach to additionally reduce the chances of selecting bitter kernel individuals would consist of selecting two markers heterozygous in both parents and flanking the Sk gene. The two closest are BPPCT037 and PceGA025 (Fig. 2). Selecting against the alleles associated with the sk allele in each marker (132/148 and 193/201, respectively) for the 159

241 G5R BPPCT026 (0)

G5D BPPCT026 (0)

UDP97-401 (6.0)

UDP97-401(5.7)

BPPCT017(21.7)

EPPCU9830(11.8)

EPDCU2584(28.2)

BPPCT017(27.8) BPPCT037(32.0)

Sk

UDA-045(31.7) PceGA025(32.6)

CPDCT016(34.4)

BPPCT037(33.5)

Sk

(35.7)

EPPCU2584(37.0) EPDCU4658(45.0)

CPDCT028(39.0)

PceGA025(43.4) BPPCT038(46.2)

EPPCU0004(49.0)

EPDCU5183(51.4)

BPPCT014(58.1)

Fig. 2 Saturation of linkage group 5 around the kernel taste locus Sk/ sk in the maps of the two parents (G5R and G5D) of the progeny “R1000”דDesmayo Largueta”. The number in parentheses represents the genetic distance in centimorgan

plants that had complete data, it was possible to discard 100% of the bitter seedlings, plus an additional five plants (3% of the total seedlings) that included a recombination event between the two markers but were sweet. The EC was 0.97, the same as with one marker heterozygous in both parents, but the objective of selecting only sweet against bitter kernels was fully achieved. Analysis of EPDCU2584, BPPCT037, CPDCT028, and PceGA025 in a collection of almond accessions We analysed the variability of Sk/sk and the two closest markers on each side of it, EPDCU2584 and BPPCT037 on one side and CPDCT028 and PceGA025 on the other, in 86 almond accessions (29 cultivars and 57 seedlings) of the CEBAS-CSIC almond breeding programme (see additional online material, Table A). LD was studied among these five

242

loci in the collection of 24 unrelated almond accessions, under the assumption that these genotypes were an unstructured sample of the almond population. Structure, which may lead to the detection of spurious associations between loci, was not checked because the markers used in this research were inappropriate, as they were too few and located in a small region of the almond genome. Significant LD (P