Multiple Mechanisms for Degradation of ... - Semantic Scholar

Copyright  2002 by the Genetics Society of America

Multiple Mechanisms for Degradation of Bacteriophage T4 soc mRNA Toshie Kai1 and Tetsuro Yonesaki2 Department of Biology, Graduate School of Science, Osaka University, Osaka 560-0043, Japan Manuscript received July 23, 2001 Accepted for publication October 29, 2001 ABSTRACT The dmd gene of bacteriophage T4 is required for regulation of mRNA stability in a stage-dependent manner during infection. When this gene is mutated, late genes are globally silenced because of rapid degradation of mRNAs. To investigate the mechanism of such mRNA degradation, we analyzed the late gene soc transcripts. The degradation of soc mRNA was remarkably stabilized when its ability to be translated was impaired; either disruption of translation initiation signals or elimination of termination codons was effective in stabilization of soc mRNA and removal of elongation modestly stabilized it. Even in the absence of translation, however, the residual activity was still significant. These results suggested that the degradation of soc transcripts was promoted by two different mechanisms; one is dependent on translation and the other independent of translation. We found several cleavages introduced into soc RNA specifically when the dmd gene was mutated; some of them could be linked to polypeptide chain elongation and termination, suggesting the correlation with ribosomal action, and the others were independent of translation.

B

ACTERIOPHAGE T4 expresses its hundreds of genes separately at early, middle, and late stages of infection primarily by differential transcription from stage-specific promoters (Stitt and Hinton 1994; Wilkens and Ruger 1994; Williams et al. 1994). Recent discovery of the dmd gene (formerly gene 61.5), however, suggests that the regulation of mRNA degradation may play an integral part in ordered gene expression. The dmd gene is required for the stability of late-gene mRNAs: When a mutant altered in this gene infects Escherichia coli cells at low temperatures, late genes are globally silenced because of rapid degradation of their mRNAs (Kai et al. 1996). Since the dmd mutant-specific degradation of late-gene mRNA is activated during T4 infection (Kai et al. 1998; Ueno and Yonesaki 2001), the dmd gene appears to be required for the control of this activity. In addition to late-gene mRNAs, the stability of middle-gene mRNA is also affected by a dmd mutation: The expression of middle genes starts normally but is abruptly decreased presumably because of mRNA degradation between middle and late stages. Nevertheless, remaining middle-gene mRNAs are stabilized at late stages and their expression is prolonged (Ueno and Yonesaki 2001). Therefore, the dmd gene is required for both the stabilization and subsequent destabilization of middle-gene mRNA as well as the stabilization of lategene mRNA. In other words, the dmd gene plays a role in the regulation of mRNA stability in a stage-dependent manner, discriminating mRNA species. 1 Present address: Carnegie Institution of Washington, Department of Embryology, 115 W. University Pkwy., Baltimore, MD 21210. 2 Corresponding author: Department of Biology, Graduate School of Science, Osaka University, 1-16 Machikaneyama-cho, Toyonaka-shi, Osaka 560-0043, Japan. E-mail: [email protected]

Genetics 160: 5–12 ( January 2002)

To investigate the molecular mechanism of the dmdmediated discrimination and degradation of mRNAs, it would be essential to characterize the mRNA-degrading activity. Analysis of degradation intermediates of lategene mRNA in a dmd mutant reveals that the degradation occurs in a dmd mutant-specific manner. It was, however, too rapid and extensive to detect the fulllength transcripts, ranging from 1.8 to 5 kb, of late genes 23, 37, and 51 (Kai et al. 1996). Such rapid degradation places us in a difficult situation for understanding the initial action of mRNA degradation. During the course of our experiments, we noticed that low-molecularweight proteins encoded by late genes were occasionally expressed, although weakly, in dmd mutant-infected cells. This observation implies that the mRNA-degrading activity associated with a dmd mutation correlates with the length of the mRNA. If this is the case, then the choice of a short mRNA should alleviate the difficulty for understanding the initial action of mRNA degradation. In the present study, we focused on the late gene soc for three reasons. First, the soc gene is transcribed from its own late promoter as a monocistronic mRNA that is only 300 nucleotides long (McDonald et al. 1984) and may be the shortest among T4 late gene mRNAs. Second, since the soc protein is one of the major components of the T4 phage capsid (Ishii and Yanagida 1977; Black et al. 1994), its mRNA may be abundant enough to be easily analyzed. Third, the soc gene is entirely dispensable for phage growth, so that our manipulation of this gene would not affect the expression of other T4 genes. Here, we report our analysis of late-gene soc transcripts to investigate the mechanism of mRNA degradation responsible for late-gene silencing. The results shed light on the mechanism and also open a way to unravel the mechanism further.

6

T. Kai and T. Yonesaki MATERIALS AND METHODS

Bacteria and phage: growth and infection conditions: We routinely used the E. coli K12 strains MH1 (hsdR⫺ supo) as a nonpermissive host and CR63 (supD) as a permissive host. MH1 cells were also used for cloning T4 genes. Wild-type bacteriophage T4 is T4D. The T4 amSF16 phage contains a nonsense mutation in the dmd gene (Kai et al. 1996; Ueno and Yonesaki 2001). T4 soc mutations were constructed in this study (see below). The amBL292 phage (laboratory stock) contains a nonsense mutation in gene 55. For the preparation of total RNA from T4-infected cells, MH1 cells were grown to a density of 5 ⫻ 108 cells/ml in M9 minimal medium supplemented with 0.3% casaminoacids, 1 ␮g/ml thiamine, and 20 ␮g/ml tryptophan and infected at 30⬚ with T4 phage at a multiplicity of 10. Northern blot analysis: Total RNA from a 1.5-ml culture of infected cells was isolated as described previously (Kai et al. 1996). Northern blot analysis was performed as follows. Each RNA sample was suspended at 1 ␮g/␮l in a buffer consisting of 10 mm Tris-HCl (pH 7.0), 94% (v/v) deionized formamide, 10 mm EDTA, 0.1% (w/v) bromophenol blue, and 0.1% (w/v) xylene cyanol; incubated for 5 min at 65⬚; and electrophoresed through a 4% polyacrylamide gel containing 7 m urea in TBE buffer. After electrophoresis, the gels were stained with ethidium bromide to monitor the exact loading of ribosomal RNAs. Then the RNAs were transferred to a nylon membrane and crosslinked by UV irradiation. The membrane was hybridized with a 32P-labeled DNA probe at 45⬚ overnight in 50% formamide, 0.25 m sodium phosphate (pH 7.0), 0.2 mm EDTA (pH 8.0), 0.25 m sodium chloride, 100 ␮g/ml sonified and heat-denatured herring-sperm DNA, and 3.5% SDS. The membrane was washed at 45⬚ with 2⫻ SSC containing 0.1% SDS and then washed at 45⬚ with 1⫻ SSC containing 0.1% SDS. A soc probe was prepared by PCR using the wild-type soc gene in pTK40 (see below) as a template and two primers, soc5⬘ (5⬘-cctgcagtaacaagttcggctc) and soc3⬘ (5⬘-cctgcagtactctcctctata). Before PCR, the 5⬘ end of the soc3⬘ primer was labeled with T4 kinase and [␥-32P]ATP (HAS, 259 TBq/mmol). Primer extension: Primer extension was carried out as follows. A total of 1 pmol of DNA primer 1 or 2 (refer to Figure 1) was labeled with 32P at the 5⬘ end and mixed with 5 ␮g of purified RNA in 2 ␮l of 50 mm Tris-HCl (pH 8.3) containing 60 mm NaCl and 10 mm dithiothreitol (DTT). After incubation for 3 min at 60⬚, the mixture was quickly chilled on ice. For analysis of soc-nst RNA, the incubation was conducted for 3 min at 50⬚, and then the temperature was gradually lowered to 43⬚. Avian myeloblastosis virus reverse transcriptase (1.4 units) was then added to the mixture, and the final volume was brought to 5 ␮l by the addition of 50 mm Tris-HCl (pH 8.3) containing 60 mm NaCl, 10 mm DTT, 6 mm Mg(OAc)2, and a 0.4 mm concentration of each 2⬘-deoxyribonucleoside 5⬘triphosphate. The DNA primer was extended at 37⬚ for 3 min and then at 54⬚ for an additional 20 min. The reaction was terminated by the addition of 10 ␮l of a solution containing 0.1% (w/v) xylene cyanol, 0.1% (w/v) bromophenol blue, 10 mm EDTA (pH 8.0), and 95% (v/v) deionized formaldehyde. The reaction products were denatured by boiling for 2 min and analyzed by electrophoresis through a 5% polyacrylamide gel containing 7 m urea. Construction of plasmid and phage mutants for soc gene: A DNA fragment containing the entire soc gene was amplified by PCR using T4 DNA as a template with the primers soc5⬘ and soc3⬘ and ligated into the PstI site of pBlueScript KS⫺ (Stratagene, La Jolla, CA) to construct pTK40. Plasmids containing various base-substituted soc alleles were pTK50, -61, -70, -80, and -90, harboring the soc-als, soc-sls, soc-nel, soc-hlf, and soc-nst alleles, respectively. These were constructed by PCR

with pTK40 as a template and mutagenic oligonucleotide primers. Briefly, PCR was performed with each mutagenic primer and the soc3⬘ primer and then with the DNA fragment amplified by the first PCR and the soc5⬘ primer. The mutagenic oligonucleotides used were the following: for pTK50, 5⬘-aaaggagaattacatcgatagtactcgcggtta; for pTK61, 5⬘-gtaatttaaa taaagcttaattacatggctagt; for pTK70, 5⬘-ccgcgagtttattacatgtaat; for pTK80, 5⬘-tgagcgccttattatttgtgaa; and for pTK90, 5⬘-aactgg ttctagactcaagg. The base substitutions introduced into soc alleles are summarized in Figure 1. The deletion mutants soc⌬-1, soc⌬-2, soc⌬-3, and soc⌬- 4 were also constructed by PCR with pTK40 as a template and deletion-generating primers in the same manner as above: for pI/ Ssoc⌬-1, 5⬘-tactcacccgtccgccactc; for pI/Ssoc⌬-2, 5⬘-aaccgcgag tacatgattat; for pI/Ssoc⌬-3, 5⬘-taaccgcgagtttatttaaa; and for pI/ Ssoc⌬-4, 5⬘-aatttctgctcaaattttatttaaattaca. The thus constructed deletion mutants lacked 57 nucleotides from position 3 to 59, inclusive, of the soc mRNA in soc⌬-1; 31 nucleotides from position 3 to 33 in soc⌬-2; 20 nucleotides from position 14 to 33 in soc⌬-3; and 45 nucleotides from position 15 to 59 in soc⌬- 4 (refer to Figure 1). Each soc allele in a plasmid was transferred into the phage genome by the insertion/substitution method (Selick et al. 1988) or by homologous recombination with the T4 chromosome (Kai et al. 1999). Each soc mutant phage was screened for by its sensitivity to alkaline pH (Ishii and Yanagida 1977) and confirmed by sequencing of the soc gene.

RESULTS

Northern blot analysis of soc transcripts: Northern blot analysis of soc transcripts at a late stage (19 min) of wild-type infection unexpectedly detected two major transcripts (Figure 2A). The slower migrating species (0.3 kb) was the full-length monocistronic soc mRNA transcribed from a late promoter just upstream of the soc coding region, as revealed by primer extension analysis (Figure 2B; also refer to Figure 6A). In agreement with transcription from the stage-specific promoter, this species was undetectable at an early stage (4 min). Moreover, it was much reduced in gene 55⫺-infected cells, indicating that its transcription depended highly on gene 55, which encodes a T4 sigma factor required for the recognition of late promoters (Williams et al. 1994). On the other hand, the faster migrating species (0.25 kb) did not depend on gene 55. Primer extension analysis revealed that this species suffered a truncation of its 5⬘-terminal 59 nucleotides relative to soc mRNA (Figure 2B; also refer to Figures 1 and 6A). The soc gene can be transcribed at early and middle stages from early and middle promoters 0.8 and 1.2 kb upstream of the soc gene (Macdonald et al. 1984; Macdonald and Mosig 1984). Therefore, the above results suggested that the faster migrating species had been transcribed at early and middle stages and processed. In support of this suggestion, the truncated transcript was occasionally detectable even at an early stage (4 min). This conclusion, however, does not necessarily exclude the possibility that the truncation also occurs at late stages. Consistent with the idea that the activity of dmd mutant-specific degradation correlates with mRNA length,

Degradation of T4 Phage soc mRNA

7 Figure 1.—Base substitutions and cleavage sites in soc RNA. Nucleotide sequence of full-length wild-type soc mRNA is shown in a DNA form, and the locations of Shine-Dalgarno sequence (S), initiation codon (I), termination codon (T), and transcription terminator containing an inverted repeat are indicated above this sequence. The 5⬘-terminal G is the transcription start site, and the late promoter of the soc gene is located 6 nucleotides upstream of the transcription start site (Williams et al. 1994). Base substitutions introduced into each allele of the soc gene are shown by arrows with an allele name. als, AUG -less; hlf, half; nel, no elongation; nst, nonstop; sls, SD-less. Cleavage sites are specified by letters with an arrowhead (see details in text). Primers 1 and 2 used for primer extension are also shown. Nucleotide number is given for the leftmost base in each lane.

we were able to detect full-length soc mRNA even in dmd⫺-infected cells (Figure 2A). Its abundance in dmd⫺infected cells was, however, only one-fifth of that in wildtype phage-infected cells, reflecting the instability of

Figure 2.—Analysis of soc transcripts. (A) MH1 cells were grown to a density of 3 ⫻ 108 cells/ml and infected with wildtype or mutant T4 phage as indicated. RNAs were extracted from infected cells at 4 or 19 min after infection, and 2 ␮g of each RNA was analyzed by Northern blotting as described in materials and methods. Infecting phage were wild type, gene dmd⫺ (amSF16), and gene 55⫺ (amBL292). The arrowhead and arrow indicate the full-length and the 5⬘-truncated soc RNA, respectively. (B) The RNAs extracted at 19 min in A were utilized for primer extension analysis as described in materials and methods, using primer 1 (Figure 1). cDNAs were electrophoresed through a 4% polyacrylamide gel containing 7 m urea. The size markers, 32P-labeled and heat-denatured HaeIII-fragments derived from pBlueScript II KS⫺ DNA, were electrophoresed in the rightmost lane and their lengths are given in nucleotide number in the right margin. The arrowhead and the arrow indicate the cDNA band corresponding to the full-length and the 5⬘-truncated soc RNA, respectively.

this RNA caused by a dmd mutation. In contrast to fulllength soc mRNA, the 5⬘-truncated RNA did not appear to suffer from dmd mutant-specific degradation and remained as abundant in dmd⫺ as in the wild type. In fact, the half-life of this truncated RNA was not affected by a dmd mutation and was 10-fold greater than that of the full-length soc mRNA in dmd⫺ (see below). The 5⬘-truncated RNA must be untranslatable, because this truncation removed the Shine-Dalgarno (SD) sequence, which is required for ribosome binding, and the translation initiation codon of the soc gene (Figure 1). Therefore, the above results raised the possibility that the degradation of soc mRNA was dependent on its ability to be translated. Translation-dependent degradation of soc RNA: To investigate the above possibility, we disrupted the signals of translation initiation by base substitutions (Figure 1) to examine the abundance of soc RNA (Figure 3). By disruption of either the SD sequence (soc-sls) or the initiation codon (soc-als), the abundance of full-length soc RNA in dmd⫺ relative to that in dmd⫹ was markedly increased from 22 to 85–90% of that in the wild type, suggesting an increase in stability. The effects of translation on soc RNA stability were further evaluated by the decay rates of RNA. This experiment involved an additional mutant, soc⌬-3 (Figure 4A), which lacked both the SD and initiation codon. We measured the decay rate of soc RNA in the presence of rifampicin, a transcription inhibitor. After transcription was blocked by addition of rifampicin at 18 min postinfection, total RNA was extracted from T4-infected cells at 20, 26, and 32 min. The abundance of each full-

8

T. Kai and T. Yonesaki

Figure 3.—Effects of translation signals on the abundance of soc transcripts. RNAs were isolated from MH1 cells infected with T4 mutants at the time points indicated above the figure and analyzed by Northern blotting as in Figure 2. Infecting T4 phage had a soc allele plus either the wild-type (designated ⫹) or mutated (⫺) dmd gene as indicated above the figure. Alleles of the soc gene were wt (wild type), als (soc-als), and sls (soc-sls). The amounts (percentage) of full-length transcript of each soc allele at 25 min after T4 infection in the absence of a functional dmd gene relative to that in its presence are presented below the figure. The arrowhead and arrow indicate the full-length and the 5⬘-truncated soc RNA, respectively.

length soc RNA at these time points was examined by Northern blotting (Figure 4B) and its half-life was determined by plotting the relative abundance (Figure 4C). The half-life of the full-length soc mRNA was 26 min

in wild-type-infected cells, and it was 2.7 min in dmd⫺infected cells. As expected, the soc-sls full-length RNA had a fourfold longer half-life (11 min) than wild-type soc mRNA in dmd⫺-infected cells. Similarly, the fulllength RNA of soc⌬-3 had a threefold longer half-life (8.5 min). These results strongly suggest that the rapid degradation of soc mRNA in the dmd mutant is dependent on translation, that is, that translation of soc mRNA triggered the degradation of the template RNA. Effects of translation phase on soc RNA stability: Translation consists of three phases, i.e., initiation, elongation, and termination. To estimate the contributions of elongation and termination to translation-dependent RNA degradation, we eliminated each of these phases: Two termination codons were placed in tandem immediately downstream of the initiation codon to eliminate the elongation phase (soc-nel) or the original termination codon was disrupted to eliminate the termination phase (soc-nst; Figure 1). As shown in Figure 5, the relative abundance of the full-length soc-nst transcript in dmd⫺ was threefold (77%) greater than that (24%) of the wild-type soc full-length transcript, suggesting a large contribution of translation termination to the degradation process. Removal of the elongation phase also increased the relative abundance of the full-length soc-nel transcript to 37%. Although this increase was modest,

Figure 4.—Decay rates of soc RNAs. (A) The structures of soc RNAs are presented schematically. Letters S and I indicate the SD sequence and the initiation codon, respectively. The coding region is indicated in black area, and a deleted region in gray. Alleles of the soc gene were wt, wild type; als, soc-als; sls, soc-sls; ⌬-1 to -4, soc⌬-1 to -4. See materials and methods for sequence information about deletions. (B) MH1 cells were grown and infected at time 0 with a wild type or a dmd mutant carrying various soc alleles as indicated above the figure. Rifampicin was added at 18 min to MH1 cell cultures at the final concentration of 200 ␮g/ml, and RNAs were extracted at 20, 26, and 32 min. After polyacrylamide gel electrophoresis of each 5-␮g RNA sample, Northern blotting was performed as described in materials and methods. The arrowhead and arrow indicate the full-length and the 5⬘-truncated soc RNA, respectively. (C) Each full-length soc RNA was quantified by the National Institutes of Health image program. The amount of this RNA at 26 or 32 min relative to that at 20 min is plotted. 䊉, wild type; 䊏, dmd⫺; 䉬, dmd⫺ socsls; 䉱, dmd⫺ soc⌬-1; 䉲, dmd⫺ soc⌬-2; and 䉴, dmd⫺ soc⌬-3.


Figure 5.—Effects of elongation and termination on the abundance of soc transcripts. (A) The structures of soc RNAs are presented schematically as in Figure 4. T indicates the termination codon. Alleles of the soc gene were wt, wild type; nel, soc-nel; nst, soc-nst. (B) RNAs were isolated at 25 min after T4 infection and analyzed as in Figure 2. Infecting T4 phage had a soc allele plus either the wild-type (designated ⫹) or mutated (⫺) dmd gene as indicated above the figure. The amount (percentage) of each soc allele full-length transcript of dmd mutant relative to that of the wild-type (dmd⫹) transcript is presented below the figure. The arrowhead and arrow indicate the full-length and the 5⬘-truncated soc RNA, respectively.

it was reproducibly observed in several independent experiments. We also constructed soc-hlf, in which nonsense codons were placed to terminate translation prematurely (Figure 1). When assessed by Northern blotting, the soc-hlf mutation had an effect on the stability of full-length soc RNA as modest as that of the soc-nel mutation (data not shown). These results reveal that translation-dependent degradation of soc mRNA depends on both elongation and termination. This conclusion, however, does not exclude the possibility that translation initiation by itself also contributes to translation-dependent degradation of soc mRNA. Unfortunately, this possibility cannot be tested under the present circumstances. Translation-independent degradation of soc RNA: Although the blockade of translation was effective in the stabilization of soc RNA, such an effect could not account for all of the dmd mutant-specific RNA-degrading activity; soc-sls and soc⌬-3 full-length RNAs were still degraded

9

two- to threefold faster in dmd⫺ than soc mRNA in wildtype-infected cells (Figure 4). Therefore, an activity independent of translation was also suggested to contribute to the soc RNA degradation. The truncated RNA lacking the 5⬘-terminal 59 nucleotides had a half-life of ⵑ30 min, regardless of the dmd mutation and soc allele (Figure 4B; data not shown), and was threefold longer than those of soc-sls and soc⌬-3 full-length RNAs in dmd⫺. This observation suggested that the 5⬘-terminal 59 nucleotides are required for the RNA-degrading activity independent of translation. To investigate this possibility, we constructed other soc deletion mutants, soc⌬-1, soc⌬-2, and soc⌬-4. All of these mutants lacked both the SD and initiation codon and differed in length of sequence deleted from the 5⬘-terminal 57 nucleotides of soc mRNA (Figure 4A). When the 5⬘ or 3⬘ moiety of this region was deleted in soc⌬-2 or soc⌬-4, the half-lives of their full-length RNAs were 12 min for soc⌬-2 (Figure 4C) and 14 min for soc⌬-4 (data not shown), respectively, as short as that of soc-sls. soc⌬-1 had the largest deletion and its primary structure was similar to that of the 5⬘-truncated transcript except for an extra 5⬘-terminal GU. We were not able to determine the half-life of full-length soc⌬-1 RNA by Northern blotting because it comigrated with its 5⬘-truncated form during gel electrophoresis (Figure 4B). To calculate the half-life of full-length soc⌬-1 RNA, we performed primer extension using the same RNA preparation and analyzed the products through a sequencing gel to estimate the relative abundance of full-length and 5⬘-truncated RNA (refer to Figure 6B). The ratio of cDNA corresponding to full-length soc⌬-1 RNA to that of its 5⬘-truncated form was 2.0, 1.8, and 1.5 at 20, 26, and 32 min, respectively. On the basis of these values and the combined signal intensity of fulllength and 5⬘-truncated soc⌬-1 RNA in Figure 4B, we deduced the abundance of full-length soc⌬-1 RNA at each time point and plotted the relative abundance in Figure 4C. The estimated half-life of full-length soc⌬-1 RNA was 30 min: Thus, this species was more stable than fulllength soc⌬-2 and -4 RNA and as stable as the 5⬘-truncated RNA. These results suggest that the 5⬘-terminal 57 nucleotides deleted in soc⌬-1 RNA are required for the translation-independent degradation. Cleavage of soc RNA: In prokaryotes, degradation of mRNA is usually initiated by endonucleolytic cleavage (Coburn and Mackie 1999; Grunberg-Manago 1999). The possibility that rapid degradation of late-gene mRNA in dmd mutant may be initiated by endonucleolytic cleavage led us to investigate cleavage introduced into soc transcripts. For this purpose, we produced cDNAs with various soc transcripts from T4-infected cells as a template by primer extension and resolved them by electrophoresis through a sequencing gel (Figure 6A). A cDNA fragment common to all phage, indicated by the letter F in Figure 6, corresponds to full-length soc RNA. The band indicated by the letter T, which was also detected with all phage, corresponds to 5⬘-truncated

10


Figure 6.—Primer extension analysis of soc transcripts. (A) T4 mutants used are indicated above the figure. RNAs from T4 mutant-infected MH1 cells were extracted at 20 min after infection and utilized as a template for primer extension as described in materials and methods, using primer 2 (Figure 1). Labeled cDNAs were analyzed by electrophoresis through a 5% polyacrylamide gel containing 6 m urea. A set of sequence ladders for wild-type soc obtained by dideoxysequencing method with the same primer was run in parallel. The bands detected reproducibly and specific to the dmd mutation are indicated by letters (see text). (B) After MH1 cells were infected with dmd mutant carrying a soc deletion as indicated above the figure, rifampicin was added at 18 min at the final concentration of 200 ␮g/ml and RNAs were extracted at 20, 30, 40, and 50 min. For each lane, 7 ␮g RNA was subjected to primer extension and labeled cDNAs were analyzed in the same manner as above. A dot indicates cDNA corresponding to each full-length soc RNA.

transcripts. In addition, comparison of cDNAs from dmd⫺ infection (even-numbered lanes) with those from dmd⫹ infection (odd-numbered lanes) revealed several cDNAs associated only with dmd⫺ infection, corresponding to the dmd mutant-specific cleavages. Two cDNAs, designated as TC1 and TC2, were detected for wild-type soc (lane 4). Although the intensities of these cDNAs were rather weak, their detection was highly reproducible. Interestingly, these bands were also detected for soc-nst (lane 2), while they were insignificant with the RNA of soc-sls (lane 6), soc-als (lane 8), soc-nel (lane 10), and sochlf (lane 12). Since both cleavages at TC1 and TC2 are located in a region that is translatable in soc-nst as well as in wild type but not in the others (Figure 1), they appear to be linked with polypeptide chain elongation. The present experiment did not permit detection of cleavages in the vicinity of the termination codon of the wild-type soc gene because the termination codon was located within the sequence used for the primer (Figure 1). This situation arose because of the region downstream from the primer; since it contains a transcriptional terminator with a strong secondary structure (Macdonald et al. 1984), the sequence downstream of the original termination codon was not suitable for a primer. Instead, we attempted to detect such cleavage using two soc alleles, soc-nel and soc-hlf. A specific band indicated by NE (lane 10) or HL (lane 12) in Figure 6

was reproducibly observed for the soc-nel and soc-hlf alleles, respectively. This result suggests the correlation of a cleavage at NE or HL with translation termination. A band indicated by TU was common to all soc alleles when dmd was mutated (even-numbered lanes). This band was also detected for all deletion mutants in dmd⫺infected cells (data not shown; refer to Figure 6B). In addition to TU, two bands indicated by U1 and U2 were occasionally detected, although very weakly, for all soc alleles in dmd⫺-infected cells (even-numbered lanes). Accordingly, these cleavages are suggested to be independent of translation. In spite of the fact that the cleavage at TU was prominent, its contribution to degradation of soc RNA at late stages was unclear, because it was observed even for rather stable soc⌬-1 RNA; it seemed possible that this cleavage occurred before late stages, like the 5⬘ truncation. To clarify whether or not this cleavage can occur at late stages, we isolated RNAs of soc⌬-1, soc⌬-2, and soc⌬-4 after rifampicin was added at 18 min postinfection and analyzed them by primer extension analysis. Figure 6B shows a kinetic change in the quantity of full-length, 5⬘-truncated or TU-cleaved RNA of each soc allele. The intensity of each full-length or 5⬘-truncated RNA decreased with time, roughly consistent with the decay rate assessed by Northern blotting (Figure 4 and data not shown). On the other hand, the amounts of TU-cleaved RNA of all soc alleles apparently


increased from 20 to 30 min and thereafter decreased. This result clearly indicated that the cleavage at TU occurred during late stages. DISCUSSION

Our present study was conducted to investigate the mechanism of rapid mRNA degradation that leads many T4 late genes to become silenced in dmd mutant-infected cells. For this purpose, we chose the short mRNA of the soc gene. The full-length soc RNA was remarkably stabilized when its ability to be translated was impaired either by disruption of the translation signals (soc-sls and soc-als) or by removal of them (soc⌬-2 to -4). However, soc RNA-degrading activity was still significant even in the absence of translation. Therefore, two different mechanisms, one dependent on, and the other independent of, translation, may account for the rapid degradation of soc mRNA in the dmd mutant-infected cells. The translation-dependent mechanism was further dissected into two categories depending on elongation or termination. Elimination of termination codons in soc-nst was effective in stabilization of soc mRNA. In contrast, removal of the elongation phase in soc-nel modestly stabilized soc mRNA. However, since an elongation-dependent activity would correlate with the length of the mRNA, this activity should contribute more to degradation of long mRNAs. Among untranslatable soc RNAs, soc⌬-1 was more stable than soc⌬-2, soc⌬-3, soc⌬-4, and soc-sls. Accordingly, it is likely that the 57-nucleotide sequence from position 3 to 59, which was deleted in soc⌬-1 RNA, has a role as a destabilizer of soc RNA and that it is required for the translation-independent mechanism. A translation-independent cleavage at site TU was detected during the late stages of dmd mutant-infection. The quantity and kinetic change of TU-cleaved RNA was very similar in the soc⌬-1, soc⌬-2, and soc⌬-4 mutants, indicating that the cleavage at TU was little affected in soc⌬-1 RNA in comparison to more unstable soc⌬-2 or soc⌬-4 RNA. These facts strongly suggest that this cleavage occurs apart from the destabilizing effect of the 5⬘ region as discussed above. Accordingly, the translation-independent mechanism for degradation of soc RNA can be comprised of two categories, one accompanying the cleavage at TU and the other independent of this cleavage, the latter of which should be inactive against soc⌬-1 RNA. Cleavages of soc RNA at several specific sites (HL, NE, TC1, and TC2) were detected when the recognition of RNA for translation by ribosomes was allowed (Figure 1). Site NE is 23 bases downstream of the first termination codon introduced into soc-nel RNA, and site HL is 6 bases downstream of the first termination codon introduced into soc-hlf RNA. The E. coli 70S ribosome covers ⬎30 nucleotides of mRNA (Steitz 1969; Schneider et al. 1986) and is suggested to slide in a 5⬘ to 3⬘ direction along the mRNA after translation termination (reviewed by Gold 1988; Janosi et al. 1998). Accordingly, cleavages

11

at NE and HL are suggested to be introduced concomitantly with translation termination. On the other hand, cleavages at TC1 and TC2 are suggested to be introduced during polypeptide chain elongation. At present, we have two possibilities to explain these cleavages, depending on translation. One is that these cleavages would be introduced by the ribosome itself or by ribosome-associated factors during translation. The other is that binding and translocation of the ribosome might lead to exposition of a target site in soc mRNA for a nuclease. In either case, the RNA cleavage activity linked with translation suggests the intimate involvement of ribosomal action. All the cleavages introduced in the cis-translationdependent manner are between dinucleotides with sequence 5⬘-YR or 5⬘-YY (Figure 1), where Y is a pyrimidine and R is a purine. This preference is especially interesting for elongation-dependent cleavages at sites TC1 and TC2. If we assume that the sequence preference of elongation-dependent cleavage for soc mRNA is the same for other late-gene mRNAs, then we can easily explain the previous results in which dmd mutant-specific cleavages in the coding region of gene 23 mRNA occurred between the dinucleotides 5⬘-YR or 5⬘-YY (Kai et al. 1996). Regardless of whether dmd was normal or mutated, the 5⬘-truncated soc RNA was produced. Our results suggest that the truncated RNA originated from early and middle transcripts. The soc gene can be transcribed as a part of a long polycistronic mRNA from upstream early and middle promoters, but it is not expressed until late stages, when this gene is transcribed from its own late promoter (Macdonald et al. 1984). Previously, the inability of the polycistronic mRNA to direct the synthesis of soc protein was explained by masking of the initiation codon of soc mRNA; it is hindered by a secondary structure formed between a region containing the initiation codon and a region upstream of the soc gene (Macdonald et al. 1984). Our present study adds an alternative possibility that is not mutually exclusive; i.e., a cleavage resulting in the 5⬘ truncation inactivates the polycistronic mRNA such that the message cannot direct the synthesis of the soc protein. This study suggests that multiple mechanisms of RNA degradation lead T4 late genes to become silenced in dmd mutant-infected cells. The extensive degradation may be originally aimed at middle-gene mRNAs when they finish their mission, and the dmd may have a role in discriminating middle- and late-gene mRNAs (Ueno and Yonesaki 2001). At present, we do not know whether all or a part of the soc RNA-degrading activities is utilized for degradation of other late-gene mRNAs when dmd is mutated or for degradation of middle-gene mRNAs when dmd is normal, nor how dmd controls RNA-degrading activities. To settle these issues, it would be necessary to identify RNase(s) involved in soc RNA degradation. Identification of RNase(s) undoubtedly would help to solve the mechanism of regulated mRNA degradation and its control mediated by the dmd gene.

12


We thank the staff of the Radioisotope Research Center at Toyonaka, Osaka University, for facilitation of our research; all of our experiments using radioisotopes were carried out at the center.

LITERATURE CITED Black, L. W., M. K. Showe and A. C. Steven, 1994 Morphogenesis of the T4 head, pp. 218–258 in Molecular Biology of Bacteriophage T4, edited by J. D. Karam, J. W. Drake, K. N. Kreuzer, G. Mosig, D. H. Hall et al. American Society for Microbiology, Washington, DC. Coburn, G. A., and G. A. Mackie, 1999 Degradation of mRNA in Escherichia coli: an old problem with some new twists. Prog. Nucleic Acid Res. Mol. Biol. 62: 55–108. Gold, L., 1988 Posttranscriptional regulation mechanisms in Escherichia coli. Annu. Rev. Biochem. 57: 199–233. Grunberg-Manago, M., 1999 Messenger RNA stability and its role in control of gene expression in bacteria and phages. Annu. Rev. Genet. 33: 193–227. Ishii, T., and M. Yanagida, 1977 The two dispensable structural proteins (soc and hoc) of the T4 phage capsid: their purification and properties, isolation and characterization of the defective mutants, and their binding with the defective heads in vitro. J. Mol. Biol. 109: 487–514. Janosi, L., S. Mottagui-Tabar, L. A. Isaksson, Y. Sekine, E. Ohtsubo et al., 1998 Evidence for in vivo ribosome recycling, the fourth step in protein biosynthesis. EMBO J. 17: 1141–1151. Kai, T., E. H. Selick and T. Yonesaki, 1996 Destabilization of bacteriophage T4 mRNAs by a mutation of gene 61.5. Genetics 144: 7–14. Kai, T., H. Ueno and T. Yonesaki, 1998 Involvement of other T4 genes in the blockade of protein synthesis and mRNA destabilization by a mutation of gene 61.5. Virology 248: 148–155.

Kai, T., H. Ueno, Y. Otsuka, W. Morimoto and T. Yonesaki, 1999 Gene 61.3 of bacteriophage T4 is the spackle gene. Virology 260: 254–259. MacDonald, P. M., and G. Mosig, 1984 Regulation of a new bacteriophage T4 gene, 69, that spans an origin of DNA replication. EMBO J. 3: 2863–2871. MacDonald, P. M., E. Kutter and G. Mosig, 1984 Regulation of a bacteriophage T4 late gene, soc, which maps in an early region. Genetics 106: 17–27. Schneider, T. D., G. D. Stormo, L. Gold and A. Ehrenfeucht, 1986 Information content of binding sites on nucleotide sequences. J. Mol. Biol. 188: 415–431. Selick, H. E., K. N. Kreuzer and B. M. Alberts, 1988 The bacteriophage T4 insertion/substitution vector system. J. Biol. Chem. 263: 11336–11347. Steitz, J. A., 1969 Polypeptide chain initiation: nucleotide sequences of the three ribosomal binding sites in bacteriophage R17 RNA. Nature 224: 957–964. Stitt, B., and D. Hinton, 1994 Regulation of middle-mode transcription, pp. 142–160 in Molecular Biology of Bacteriophage T4, edited by J. D. Karam, J. W. Drake, K. N. Kreuzer, G. Mosig, D. H. Hall et al. American Society for Microbiology, Washington, DC. Ueno, H., and T. Yonesaki, 2001 Recognition and specific degradation of bacteriophage T4 mRNAs. Genetics 158: 7–17. Wilkens, K., and W. Ruger, 1994 Transcription from early promoters, pp. 132–141 in Molecular Biology of Bacteriophage T4, edited by J. D. Karam, J. W. Drake, K. N. Kreuzer, G. Mosig, D. H. Hall et al. American Society for Microbiology, Washington, DC. Williams, K. P., G. A. Kassavetis, D. R. Herendeen and E. P. Geiduschek, 1994 Regulation of late-gene transcription, pp. 161– 175 in Molecular Biology of Bacteriophage T4, edited by J. D. Karam, J. W. Drake, K. N. Kreuzer, G. Mosig, D. H. Hall et al. American Society for Microbiology, Washington, DC. Communicating editor: G. R. Smith