Multiplex Polymerase Chain Reaction Assay for Simultaneous

J. Dairy Sci. 84:1140–1148  American Dairy Science Association, 2001.

Multiplex Polymerase Chain Reaction Assay for Simultaneous Detection of Staphylococcus aureus and Streptococcal Causes of Bovine Mastitis P. Phuektes1, P. D. Mansell, and G. F. Browning Department of Veterinary Science, The University of Melbourne, Parkville, Victoria 3010, Australia

ABSTRACT To improve diagnosis of mastitis in dairy cattle, a multiplex polymerase chain reaction (PCR) assay was developed for the simultaneous detection of the four major bacterial causes of bovine mastitis, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae, and Streptococcus uberis. The target sequence was the 16S to 23S rRNA spacer regions. The performance of the assay was examined with 117 milk samples collected from a subclinically infected herd, and the diagnostic specificities and sensitivities of the multiplex PCR were compared with conventional culture. PCR was significantly more sensitive than culture for detection of S. aureus and S. uberis, but there were no significant differences in sensitivities between PCR and culture for the detection of S. agalactiae and S. dysgalactiae. The results suggest that this multiplex PCR assay could be used as an alternative method in routine diagnosis for rapid, sensitive, and specific simultaneous detection of S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis in milk samples. (Key words: multiplex, PCR, diagnosis, mastitis) Abbreviation key: Tm = melting temperatures. INTRODUCTION Mastitis is the most common infectious disease affecting dairy cows and remains the most economically important disease of dairy industries around the world. The major cause of bovine mastitis is the infection of the udder by pathogenic bacteria. A wide variety of bacteria can be involved, but the most common mastitis pathogens are S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis.

Received September 12, 2000. Accepted December 29, 2000. Corresponding author: G. F. Browning; e-mail: glenfb@unimelb. edu.au. 1 Current address: Bacteriology Section, National Institute of Animal Health, Jatujak, Bangkok, 10900 Thailand.

Identification of bacterial pathogens in milk from cows with mastitis is regarded as the definitive diagnosis of mastitis infections. It also provides information important for prevention and control of this disease. In most clinical laboratories, identification methods are based on microbiological culture of milk and biochemical tests on the bacteria isolated. Advantages of microbiological culture are that the causative bacteria can be identified and that antimicrobial sensitivities can be determined, thus providing information on which antibiotics should be administered for treatment of clinical cases or for dry cow therapy. However, there are several disadvantages associated with microbiological culture. It is limited by the dynamic nature of infections. Subclinically infected cows are intermittent shedders of organisms and may cycle through low and high shedding patterns during lactation. Milk culture may yield no bacteria from truly subclinically infected glands due to the presence of very low numbers of pathogens when samples are collected. Negative cultures may also be due to the presence in submitted samples of residual therapeutic antibiotics that may inhibit bacterial growth in vitro. The presence of leukocytes in milk samples from cases of clinical mastitis and in milk samples with high SCC may also potentially inhibit growth of bacteria. Moreover, microbiological culture of milk is time consuming. Species identification by standard biochemical methods requires more than 48 h to complete. Due to the limitations of cultural methods, PCR has been developed to identify various mastitis pathogens (Forsman et al., 1997; Ghadersohi et al., 1997; Khan et al., 1998). The development of PCR-based methods provides a promising option for the rapid identification of bacteria. With this method, identification of bacterial pathogens can be made in hours, rather than the days required for conventional cultural methods. PCR can also improve the level of detection due to its high sensitivity. Theoretically, only a few cells of the pathogen are necessary to yield a positive diagnosis. The presence of pathogens may thus be able to be detected at earlier stages of infection and in carrier animals, when the numbers of bacteria in milk may be very low. The major

1140

1141

MASTITIS DIAGNOSIS BY MULTIPLEX PCR

disadvantage of using PCR as an identification method might be excessive sensitivity, as minor contaminants in samples could lead to misdiagnosis. In addition, PCR cannot provide the information on antimicrobial sensitivity that is necessary for choosing drugs for treatment of clinical mastitis cases. Many modifications to the basic PCR process have been described. Of particular relevance to diagnosis of mastitis, multiplex PCR, in a single assay, allows simultaneous screening for multiple pathogens that might be causing the disease. In multiplex PCR, multiple pairs of primers specific for different DNA segments are included in the same reaction to enable amplification of multiple target sequences in one assay. In many cases, more than four pairs of PCR primers can be used (Henegariu et al., 1997). Primers used in multiplex PCR amplification are chosen to have similar melting temperatures (Tm) as a difference of more than 10°C in the Tm of the two sets of primers may result in differential yields of amplification products (Atlas and Bej, 1994), and no visible amplification for one or the other target. The target DNA in multiplex PCR should also have similar lengths, as large differences in the lengths of the target DNA will favor the amplification of the shorter target fragments over the longer ones, resulting in differential amounts of amplified products. The major advantage of multiplex PCR over conventional PCR is its cost effectiveness. It reduces the amount of reagents, such as Taq DNA polymerase, used for each diagnosis. Moreover it requires less preparation and analysis time than systems in which several tubes of simplex PCR are used. Multiplex PCR has now been used to simultaneously detect and type several bacteria and viruses (Corne et al., 1999; Fedele et al., 1999; Tong et al., 1999). The identification of bacteria at the species level is based on amplification of a target gene, which is highly conserved within the species, but variable between species. The rRNA genes are highly conserved in bacteria. In addition to the 16S rRNA gene, which is well established as a standard target for the identification of species of bacteria (Amann et al., 1995), the 16S to 23S rRNA intergenic spacer of the rRNA operon has proven useful for identification of bacteria at the species level (Barry et al., 1991; Jensen et al., 1993; Gurtler and Stanisich, 1996). Considerable variation in both the length and the sequence of the 16S to 23S rRNA spacer region has been found between many bacterial species (Gurtler and Stanisich, 1996). This region is considered nonfunctional and is consequently argued to be under minimal selective pressure (Barry et al., 1991). The rate of evolution of this spacer region is 10 times greater than that of the 16S rRNA gene (Leblondbourget et al., 1996), which makes it a suitable option for

differentiation of closely related bacterial species. The sequence variation in the 16S to 23S rRNA spacer region has been determined in staphylococcal and streptococcal mastitis pathogens, and has been successfully used in simplex PCR assays for rapid identification of these pathogens to the species level (Forsman et al., 1997). The aim of this study was to develop a multiplex PCR assay for the simultaneous detection of the four major bacterial causes of bovine mastitis, S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis based on amplification of the 16S to 23S rRNA spacer region. MATERIALS AND METHODS Bacterial Strains The control strains of S. aureus, S. agalactiae, S. dysgalactiae and S. uberis were isolated from bovine mastitis cases and stored at −70°C in 50% (vol/vol) glycerol, 50% (vol/vol) Todd Hewitt broth. Bacterial isolates were grown at 37°C on sheep blood agar plates and in Todd Hewitt broth before DNA extraction. Chromosomal DNA of S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis was isolated based on methods described by Jayarao et al. (1991). Oligonucleotide Primers All oligonucleotide primers were derived from published sequences (Forsman et al., 1997). To establish a combination of four sets of primers for multiplex PCR, primer sequences for S. agalactiae, S. dysgalactiae, and S. uberis were adjusted from the oligonucleotide sequences described by Forsman et al. (1997) to have similar Tm values as predicted by the computer program Cprimer (Greg Bristol and Robert Anderson, School of Medicine, University of California, Los Angeles, CA, USA). The primers developed are listed in Table 1. Optimization of Individual PCR Assays PCR reactions for S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis were initially optimized separately. The PCR was carried out in 0.5-ml tubes in a reaction volume of 50 µl. All PCR reactions contained 200 µM each of dATP, dTTP, dCTP, and dGTP, 10 mM Tris HCl (pH 8.3), 50 mM KCl and 200 ng of extracted DNA. Preliminary trials with different magnesium concentrations (1.5, 2, 2.5, and 3 mM), Taq DNA polymerase concentrations (0.5, 1, 2, and 2.5 U per reaction), and primer concentrations (0.4, 1, and 2 µM) were performed to define the optimal PCR conditions for each individual PCR assay. PCR reactions were overlaid with mineral oil and the amplification performed in an Journal of Dairy Science Vol. 84, No. 5, 2001

1142

PHUEKTES ET AL. Table 1. Oligonucleotide primers from the 16S to 23S rRNA intergenic spacer region for Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae, and Streptococcus uberis.

Species

Oligonucleotide

Sequence (5′–3′)

S. aureus

STAA-AuI* STAA-AuII* STRA-AgI STRA-AgII STRD-DyI STRD-DyII STRU-UbI STRU-UbII

TCTTCAGAAGATGCGGAATA TAAGTCAAACGTTAACATACG AAGGAAACCTGCCATTTG TTAACCTAGTTTCTTTAAAACTAGAA GAACACGTTAGGGTCGTC AGTATATCTTAACTAGAAAAACTATTG TAAGGAACACGTTGGTTAAG TTCCAGTCCTTAGACCTTCT

S. agalactiae S. dysgalactiae s. uberis

PCR Product size (bp) 420 270 264 330

*Oligonucleotides previously described by Forsman et al. (1997).

automated thermocycler, with an initial denaturation at 95°C for 5 min, followed by 36 cycles of 95°C for 1 min, 50°C for 30 s, and 72°C for 30 s, then a final incubation at 72°C for 7 min. The annealing temperature and number of cycles were subsequently optimized for each individual assay. Optimization of Multiplex PCR Assay Multiplex PCR was performed with 2.5 U Taq DNA polymerase (Boehringer Mannheim, Mannheim, Germany) in 50-µl reactions containing 500 ng of extracted DNA in 10 mM Tris HCl (pH 8.3), 2.5 mM MgCl2, 50 mM KCl, 200 µM each of dATP, dTTP, dCTP and dGTP, and 0.4 µM of each primer. Reactions were incubated at 5 min at 95°C, then 36 cycles of 95°C for 1 min, 59°C for 30 s, and 72°C for 30 s and finally incubated at 72°C for 7 min. The optimal conditions for the assay were determined by testing different magnesium concentrations (2, 2.5, and 3 mM), Taq DNA polymerase concentrations (1, 2, 2.5, and 3 U per reaction) and different combinations of primer concentrations (0.1, 0.2, 0.3, and 0.4 µM). Specificity of Simplex and Multiplex PCR The PCR primers were also examined for their specificity in this study with bacterial species commonly found in milk samples; Staphylococcus epidermidis, Staphylococcus intermedius, Enterococcus faecalis, Escherichia coli, Streptococcus bovis, Streptococcus zooepidemicus, and Mycoplasma bovis. These bacterial species were isolated and kept at −70°C at the School of Veterinary Science, The University of Melbourne. DNA from the Staphylococcus spp. and S. zooepidemicus was prepared by the Instagene method (Bio-Rad, Hercules, CA). DNA from S. bovis, E. faecalis, and E. coli was isolated using the phenol-chloroform method (Jayarao et al., 1991). M. bovis DNA was obtained from R. Hirst, James Cook University of North Queensland. Journal of Dairy Science Vol. 84, No. 5, 2001

Sensitivity of Simplex and Multiplex PCR Assays The concentrations of purified DNA extracted from S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis were determined spectrophotometrically. With distilled water as a diluent, 10-fold serial dilutions of the purified DNA were made and subjected to simplex and multiplex PCR to determine the sensitivity of each PCR assay. Sensitivity tests were performed at the optimized PCR conditions. Determination of PCR Sensitivity The sensitivity of PCR and the sensitivity of each extraction method were examined using milk samples to which S. aureus, S. agalactiae, S. dysgalactiae, or S. uberis had been added. Tenfold serial dilutions were made from the inoculated milk samples using uninoculated pasteurized milk as a diluent. Parallel dilutions of S. dysgalactiae were also made in distilled water. These dilutions were then plated on sheep blood agar and, after incubation, numbers of bacterial colonies were counted. DNA was extracted by both phenol-chloroform and spin column methods and the sensitivity of PCR was then compared on dilutions containing organisms at 107 cfu/ml to 1 cfu/ml. Phenol-Chloroform Extraction of DNA from Milk Samples Milk samples were mixed thoroughly and a 300-µl sample mixed with 300 µl of NTE buffer (0.1 M NaCl, 20 mM Tris-HCl [pH 7.4], 1 mM EDTA [pH 7.5]) containing 0.5% SDS, and 100 µg of proteinase K/ml. The solution was then incubated at 37°C for 4 h. An equal volume of phenol-chloroform-isoamylalcohol (25:24:1) was added, and the solution was gently mixed for 3 min. The solution was centrifuged at 10,000 × g for 3 min, and the upper phase collected without disturbing the interface. This process was repeated twice. The upper phase was

1143


collected and 60 µl of 3 M sodium acetate (pH 4.8) and 1.2 ml of cold 100% ethanol were added. The solution was mixed and held at −20°C for 30 min to precipitate the DNA. The DNA was recovered by centrifugation at 10,000 g for 15 min at 4°C. The supernatant was discarded and the pelleted DNA was washed with 70% ethanol and centrifuged at 10,000 g for 5 min at room temperature. The DNA pellet was then air-dried and 50 µl of TE (10 mM Tris HCl − 5 mM EDTA, pH 7.8) buffer was added to dissolve the DNA. Spin Column Extraction of DNA from Milk Samples One hundred microliters of each milk sample was mixed vigorously with 350 µl of RLT buffer (Qiagen, Hilden, Germany) containing 1% 2-mercaptoethanol, then 300 µl of 100% ethanol was added, followed by 15 µl of Qiaex II matrix (Qiagen). The suspension was loaded onto a spin column (Axygen, Hayward, CA). Columns were centrifuged for 30 s at 9000 × g, and the flowthrough was discarded. The columns were washed once with 600 µl of RLT buffer and then washed twice with 500 µl of RPE buffer (Qiagen). For each wash, the columns were centrifuged at 9000 × g for 30 s. After the final wash, the columns were centrifuged for an additional 1.5 min at 16,000 × g to remove any excess ethanol. Thirty microliters of RNase-free water was placed directly on the matrix. The DNA was eluted from the matrix by centrifugation at 9000 × g for 1 min and 5 µl of the extract was subjected to PCR. Extraction of DNA from Broth Cultures of Milk Samples One milliliter of milk was inoculated into 9 ml of Todd Hewitt broth and incubated at 37°C for 8 to 12 h prior to extraction. Three hundred microliters of broth culture was used for DNA extraction using the phenolchloroform method and 100 µl was used for extraction using the spin column method as described above. Analysis of PCR Products Twelve microliters of amplified sample was electrophoresed in a 2% agarose gel containing ethidium bromide at 0.1 µg/ml. Gels were run at 6 V/cm for 45 min in 0.5 × TPE buffer (1 × TPE = 0.35 M Tris HCl, 0.3 M NaH2PO4ⴢ2H2O, 10 mM EDTA), and PCR products were visualized by ultraviolet light transillumination. Seven microliters of amplified product was used for analysis by 20% polyacrylamide gel electrophoresis. The gels were run at 6 V/cm for 2 h and then stained with silver (Herring et al., 1982). Fragments from a HaeIII restriction endonuclease digest of plasmid

pUC18 or the 50 bp step ladder (Sigma, St. Louis, MO) were used as molecular weight markers. Source of Milk Samples A total of 117 milk samples were collected from individual quarters of cows within a subclinically infected Holstein/Friesian dairy herd from South Gippsland, Victoria, Australia. Based on previous microbiological culturing of milk samples and on BMCC data, this herd was suspected to have a high prevalence of subclinical S. agalactiae and S. aureus mastitis. Before milk collection, the teat end was scrubbed with a cotton swab soaked in 70% ethanol. The first squirt of milk was discarded and approximately 5 ml of milk collected into a sterile plastic container. All milk samples were frozen at −20°C within 36 h of collection and kept frozen until bacteriological culture and PCR analysis. Bacteriological Culture Milk samples were thawed, and 10 µl from each was streaked onto 5% sheep blood agar. The plates were incubated for 24 h at 37°C. The bacteria were identified by standard laboratory methods (Claxton and Ryan, 1993). Isolates were identified as S. aureus if they were gram-positive cocci, and yielded a positive catalase reaction and a positive coagulase reaction, although this could potentially include some S. hyicus. Isolates were identified as streptococci if they were gram-positive cocci with a negative catalase reaction. S. agalactiae were identified on the basis of a positive CAMP test and a negative esculin hydrolysis test. S. dysgalactiae were identified on the basis of a negative CAMP test and a negative esculin hydrolysis test. S. uberis were identified on the basis of a negative CAMP test and a positive esculin hydrolysis test. Statistical Methods The diagnostic sensitivities of culture and PCR on milk samples were compared using an adjusted McNemar’s χ2 test. P values of less than 0.05 were considered significant. RESULTS

Optimization of Individual PCR Assays for S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis The optimized conditions for each individual PCR assay were not significantly different. The optimized Journal of Dairy Science Vol. 84, No. 5, 2001

1144

PHUEKTES ET AL.

for 30 s, followed by final incubation of 7 min at 72°C. The 59°C annealing temperature was a compromise between the annealing temperatures of the original individual PCR assays. The S. agalactiae and S. dysgalactiae PCR products only differed in length by six bases, which made them difficult to distinguish using 2% agarose gels but they could be clearly separated by electrophoresis through 20% polyacrylamide gels. Specificity of Simplex and Multiplex PCR Assays Figure 1. The effect of concentration of primers on simultaneous detection by PCR. Series A are multiplex PCR mixtures containing equal amounts of each primer. Series B are multiplex PCR mixtures containing the optimized concentrations of primers. Lane 1 shows PCR products from a mixture of Streptococcus agalactiae and Streptococcus uberis DNA; lane 2 shows PCR products from a mixture of Streptococcus dysgalactiae and Streptococcus uberis DNA; lane 3 shows PCR products from a mixture of Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberis DNA. Molecular size standards (pUC18 digested with HaeIII) are shown in base pairs on the left for comparison. S. agalactiae and S. dysgalactiae products could only be distinguished by polyacrylamide gel electrophoresis.

reaction mixture contained 0.4 µM of each primer, 2 to 2.5 mM MgCl2, 0.5 U Taq polymerase, 200 µM of each of the four deoxyribonucleotide triphosphates, 10 mM Tris HCl (pH 8.3), and 50 mM KCl. The optimal annealing temperature for each individual assay was determined by performing PCR using annealing temperatures of 55, 57, 59, 60, 61, and 62°C. The optimal annealing temperature for S. agalactiae and S. uberis assays was 59°C and that for S. aureus and S. dysgalactiae PCR assays was 61°C. No differences in intensity of amplification products seen whether 36 or 40 cycles were used.

None of the primer pairs yielded products with DNA from the other bacterial species at the optimized conditions. However, when PCR assays were run at lower annealing temperatures (50°C and 55°C), other bacterial species yielded products. For example, S. aureus DNA yielded a product of the same size as the S. dysgalactiae product with S. dysgalactiae primers. The multiplex PCR containing all the species specific primers only amplified products of the expected size from DNA S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis or from combinations of these DNA. No PCR products were amplified from DNA of other bacterial species by the multiplex PCR (Figure 2). Sensitivity of Simplex and Multiplex PCR Assays The sensitivity of the multiplex PCR was found to be lower than for each of the individual simplex PCR (Figure 3). The S. aureus, S. dysgalactiae, and S. uberis PCR could detect as little as 5 pg of DNA while the S. agalactiae PCR detected 50 pg of DNA. In the multiplex PCR assay, 500 pg of DNA from S. agalactiae and S. aureus and 50 pg of DNA from S. dysgalactiae and S. uberis could be detected.

Optimization of the Multiplex PCR Assay The multiplex PCR mixture was optimized for MgCl2, primer, and DNA polymerase concentrations. There were no amplification products from S. agalactiae and S. dysgalactiae DNA when equal concentrations of each primer were used (Figure 1). Primer concentrations were titrated to achieve the simultaneous amplification of all four target products. The concentration of Taq DNA polymerase had to be increased to 2 U per reaction to increase the intensity of amplified products. The final optimized reaction contained 0.4 µM of each of the S. agalactiae and S. dysgalactiae primers, 0.1 µM of the S. uberis primers and 0.3 µM of each of the S. aureus primers, 2 mM MgCl2, and 2 U of Taq DNA polymerase. The reaction profile was 5 min of denaturation at 95°C and 36 cycles of 95°C for 1 min, 59°C for 30 s, and 72°C Journal of Dairy Science Vol. 84, No. 5, 2001

Figure 2. Specificity of multiplex PCR. Products amplified from DNA from 1, Streptococcus bovis; 2, Enterococcus faecalis; 3, Mycoplasma bovis; 4, Streptococcus zooepidemicus; 5, Staphylococcus epidermidis; 6, Staphylococcus intermedius; 7, Escherichia coli; 8, Streptococcus agalactiae; 9, Streptococcus dysgalactiae; 10, Streptococcus uberis; 11, Staphylococcus aureus; 12, Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus uberis, and Staphylococcus aureus; 13, negative control. Molecular size standards (pUC18 digested with HaeIII) are shown in base pairs on the left for comparison.

1145


Differential Sensitivity of Multiplex PCR and Cultural Methods on Milk Samples

Figure 3. Sensitivity of multiplex PCR in detection of DNA isolated from Streptococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberis. The molecular weight markers are pUC18 digested with HaeIII.

Bacteriological Culture of Milk Samples Of 117 milk samples, S. aureus was isolated from seven samples, S. agalactiae from 17 samples, S. dysgalactiae from 2 samples, and S. uberis from 1 sample. Coagulase-negative staphylococci were isolated from one sample. Escherichia coli was found in one sample. Eight samples contained Corynebacterium bovis and 13 samples contained other Corynebacterium spp. Sixtysix samples were negative by culture.

A preliminary assessment of PCR was performed on 24 quarter milk samples containing S. aureus, S. agalactiae, S. dysgalactiae, or S. uberis using direct DNA extraction with the spin column method, as the sensitivity of this method was higher than the phenol-chloroform method. It was found that PCR had lower sensitivity than conventional culture, with only two samples positive by PCR. Enrichment was then used before extraction of DNA with the spin column method to improve the detection rate of PCR. The culture and PCR results are presented in Table 2. The sensitivities of culture and PCR for detection of S. agalactiae were not significantly different (P = 0.375). Similarly, there was no significant difference between culture and PCR for detection of S. dysgalactiae (P = 0.5). However, PCR was more sensitive than culture for detection of S. uberis (P = 0.001) and S. aureus (P = 0.001). PCR was found to be specific for detection of these pathogens in milk samples (Figure 5). Milk samples positive for E. coli and coagulase-negative staphylococci by culture were found to be negative for other pathogens by PCR. Only one sample positive for C. bovis by culture was positive for S. aureus by PCR and two samples positive for Corynebacterium spp. by culture were positive for S. uberis by PCR. These results are probably due to multiple infections with these pathogens in the same quarter, as other samples that were positive for C. bovis and Corynebacterium spp. by culture were not positive by PCR. Two samples that were positive by

Determination of PCR Sensitivity When DNA was extracted directly from dilutions of milk using the phenol-chloroform method, the multiplex PCR had a detection limit of 106 cfu/ml for all four organisms (Figure 4). The sensitivity of PCR when the spin column method was used to extract DNA directly from dilutions of milk was 104 cfu/ml for S. aureus, S. agalactiae, and S. dysgalactiae and 103 cfu/ml for S. uberis (Figure 4). The sensitivity of PCR was found to be higher in direct detection of organisms from dilutions in distilled water than dilutions in milk, with detection limits of 10 cfu/ml and 102 cfu/ml for the phenol-chloroform and spin column methods, respectively. After enrichment, the threshold for detection by multiplex PCR was 1 cfu/ ml in the original sample for all four organisms with both phenol-chloroform and spin column methods.

Figure 4. Sensitivity of multiplex PCR in direct detection of Streptococcus dysgalactiae (top) and Staphylococcus aureus (bottom) in dilutions of milk samples. DNA extracted using the phenol-chloroform method (A); DNA extracted using the spin column method (B); Dilutions of milk containing S. dysgalactiae or S. aureus at 107 cfu/ml (1); 106 cfu/ml (2); 105 cfu/ml (3); 104 cfu/ml (4); 103 cfu/ml (5). Molecular size standards (pUC18 digested with HaeIII) are shown in base pairs on the left for comparison. Journal of Dairy Science Vol. 84, No. 5, 2001

1146

PHUEKTES ET AL. Table 2. Comparison of detection of Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae, and Streptococcus uberis in milk samples by culture and PCR. PCR Organism

Culture

Positive

S. aureus

Positive Negative Total

4 17 21

1 95 96

5 112 117

S. agalactiae

Positive Negative Total Positive Negative Total

16 4 20 2 2 4

1 96 97 0 113 113

17 100 117 2 115 117

Positive Negative Total

1 15 16

0 101 101

1 116 117

S. dysgalactiae

S. uberis

culture but negative by PCR were cultured after enrichment. One sample was negative on repeated culture and the other was contaminated with other bacterial species. DISCUSSION Species specific PCR based on detection of the 16S to 23S rRNA spacer region were developed for the four common bacterial causes of bovine mastitis, S. aureus, S. agalactiae, S. dysgalactiae, and S. uberis. A multiplex PCR was developed to allow the simultaneous detection of multiple pathogens in a single reaction, using smaller amounts of reagents and less time to set up and analyze than simplex PCR, thus making it more applicable to routine diagnostic use. One disadvantage of the assay was that the products amplified from S. agalactiae and S. dysgalactiae only differed in size by

Figure 5. PCR amplifications from some of the milk samples. Lanes 1 and 3, samples negative for PCR; 2 and 4, samples positive for Staphylococcus agalactiae; 5, sample positive for Streptococcus dysgalactiae; 6, sample positive for Staphylococcus aureus, 7, sample positive for Streptococcus dysgalactiae, and Staphylococcus aureus; 8, sample positive for Streptococcus uberis; 9 to 12, positive controls for S. agalactiae, S. dysgalactiae, S. uberis, and S. aureus; 13, negative control. Species identification in samples positive for S. agalactiae and S. dysgalactiae was confirmed by electrophoresis through 20% polyacrylamide gels. The molecular weight markers are the 50 bp step ladder (Sigma, St. Louis, MO). Journal of Dairy Science Vol. 84, No. 5, 2001

Negative

Total

six base pairs, making them indistinguishable in agarose gels. However, this could be overcome by using polyacrylamide gels. It was not possible, with the sequence information available, to design primers that would distinguish these species, and that could be predicted to be sufficiently specific, and also to amplify products with a larger size difference. Further sequencing of streptococcal species infecting the bovine mammary gland may allow an improved assay to be developed in the future. All four PCR primers were designed to have similar melting temperatures. In agreement with the findings of Henegariu et al. (1997), the relative concentrations of the primers was found to be the most important factor in determining approximately equal yields of amplification products from each of the organisms in a single reaction. One possible explanation of this result might be the different copy numbers of the 16S to 23S spacer within the different bacterial species. Little is known about the important factors and common difficulties influencing a multiplex PCR. Other critical factors in multiplex PCR include the concentration of the PCR buffer, the balance between the magnesium chloride and deoxyribonucleotide triphosphate concentrations, and the cycling temperatures (Henegariu et al., 1997). One of the problems often encountered with multiplex PCR is a reduction in sensitivity. In this study, multiplex PCR had a 10- to 100-fold lower sensitivity compared with simplex PCR when tested on DNA extracted from each of the target pathogens. This may be because of the competition between individual reactions for dNTPs and Taq polymerase when multiple primer sets are combined in a single reaction (Madico et al., 2000). However, we were able to demonstrate that products could be amplified from all four targets in the same reaction. In addition, testing of samples of milk from cows with subclinical mastitis demonstrated that at


least two different pathogens could be detected in the same milk sample using this assay and that one of the two pathogens in a sample had not been detected by conventional cultural examination. Nevertheless, it is likely that low concentrations of one bacterial species will not be detected in our multiplex assay if there are high concentrations of a second species also present. While this may not be important in herd surveys, a complete diagnosis on individual cows is probably best achieved by testing samples in which one species has been detected by the multiplex assay with the simplex assays for the three other species. Approaches used to improve the sensitivity of multiplex PCR assays include methods to improve the sensitivity of the reaction, such as nested PCR (Messmer et al., 1997), or methods to improve the sensitivity of product detection, such as hybridization with radiolabeled probes. However, such approaches increase the expense, labor and time for analysis. Nested PCR assays are also subject to contamination problems due to their high sensitivity and the need to open reaction tubes. It has been suggested (Dragon et al., 1993; Moe et al., 1994) that their use minimized for routine diagnosis. When PCR was used to detect pathogens directly in milk samples, it was less sensitive than conventional culture. Lower sensitivity was also seen when PCR was applied to the dilutions of bacteria in milk compared with dilutions of bacteria in distilled water, whether the phenol-chloroform or spin column extraction methods were used. These findings suggest that PCR inhibition was the problem encountered when PCR was used on milk samples. PCR-inhibiting substances may remain in the samples despite the use of DNA purification methods. The presence of inhibitors in milk and a variety of other clinical samples, including urine, blood, and feces, has been reported previously (Higuchi, 1989; Toye et al., 1998). Heme in blood samples and lipopolysaccharide have been implicated in PCR inhibition due to inference with Taq polymerase (Higuchi, 1989; Greenfield and White, 1993). However, little is known about the inhibitory components present in milk samples. Comparison of direct extraction from milk samples using the phenol-chloroform or spin column methods revealed higher sensitivity using the spin column method, suggesting that the spin column method removes inhibitors more effectively than does the phenolchloroform method. Although the sensitivity using the spin column method was quite high when it was used to extract DNA from organisms in inoculated milk, the sensitivity of PCR was still lower than culture when this method was used to extract DNA from clinical specimens. This may be because PCR-inhibiting substances

1147

are in higher concentrations in individual clinical samples than in pasteurized milk. To overcome PCR inhibition problems and to increase the sensitivity of the assay, enrichment was used. After the enrichment step, sufficient bacteria were present to allow pathogens to be detected when the original sample had had as little as 1 cfu/ml, and there was no difference in sensitivity between the phenol-chloroform and the spin column methods. The higher sensitivity of the assay may be due to the dilution of inhibitory substances in the enrichment broth and the increased number of organisms. Another effect of enrichment before PCR may be reduced detection of DNA from nonviable bacteria in milk samples. Different sensitivities of PCR obtained from different DNA extraction methods suggest that not only the PCR conditions but also the DNA extraction protocols are important for optimization of the assay if it is to be applied to clinical specimens. As the purpose of this study was to assess this method for routine diagnostic use, a simple and rapid DNA extraction method using spin columns was chosen. This method is easy to perform and requires minimal sample manipulation, making it more suitable for handling larger numbers of samples than classical phenol-chloroform extraction methods. Samples for PCR can be prepared within 1 h without a risk of cross-contamination. While some assays for other pathogens have used PCR directly on broth cultures, thus increasing the speed and simplicity of analysis, our experience with other assays (Amavisit et al., 2001) is that there is a significant loss in sensitivity if DNA extraction is not used. Compared with culture, this PCR is less time consuming. It takes less than 24 h to complete, while identification of bacteria to the species levels by conventional microbiological and biochemical methods requires more than 48 h. Rapid identification systems, such as the RapID STR system (Jayarao et al., 1991), can take less time than conventional biochemical methods, but still take longer and are also more expensive than PCR. The results of this study show that multiplex PCR, if used with enrichment, is more sensitive than culture for the detection of S. aureus and S. uberis in milk, while the sensitivities of both are similar for the detection of S. agalactiae and S. dysgalactiae. This may be partly explained by the fact that S. agalactiae is shed in large numbers in milk from infected quarters, making it relatively easy to detect by culture. In contrast, S. aureus is shed in relatively low numbers in infected milk. The low prevalence of S. dysgalactiae infection in the herd used in this study may have reduced the capacity to distinguish the sensitivities of culture and PCR for this species. Journal of Dairy Science Vol. 84, No. 5, 2001

1148

PHUEKTES ET AL.

This study has shown that this multiplex PCR assay can be used as a rapid diagnostic tool to detect the presence of S. aureus, S. agalactiae, S. uberis, and S. dysgalactiae in milk samples. ACKNOWLEDGMENTS P. Phuektes was supported by an AusAid scholarship. We would like to thank R. Hirst, James Cook University of North Queensland, for supplying M. bovis DNA. REFERENCES Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143–169. Amavisit, P., G. F. Browning, D. Lightfoot, S. Church, G. A. Anderson, K. G. Whithear, and P. F. Markham. 2001. Rapid PCR detection of Salmonella in horse faecal samples. Vet. Microbiol. 79:63–74. Atlas, R. M., and A. K. Bej. 1994. Polymerase chain reaction. Pages 418–435 in Methods For General And Molecular Bacteriology. P. Gerhardt, R.G.E. Murray, W. A. Wood and N. R. Krieg, ed. American Society for Microbiology. Washington, DC. Barry, T., G. Colleran, M. Glennon, L. K. Duncan, and F. Gannon. 1991. The 16S–23S ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl. 1:51–56. Claxton, P., and D. Ryan. 1993. Bovine mastitis. In Australian Standard Diagnostic Techniques For Animal Diseases. L. Corner and T. Bagust, ed. CSIRO for the Standing Committee on Agriculture and Resource Management, East Melbourne, Victoria. Corne, J. M., S. Green, G. Sanderson, E. O. Caul, and S. L. Johnston. 1999. A multiplex RT-PCR for the detection of parainfluenza viruses 1-3 in clinical samples. J. Virol. Methods. 82:9–18. Dragon, E. A., J. P. Spadoro, and R. Madej. 1993. Quality control of polymerase chain reaction. Pages 160–168 in Diagnostic Molecular Microbiology: Principles and Applications. D. H. Persing, T. F. Smith, T. F. Tenover and T. J. White, ed. American Society for Microbiology, Washington, DC. Fedele, C. G., M. Ciardi, S. Delia, J. M. Echevarria, and A. Tenorio. 1999. Multiplex polymerase chain reaction for the simultaneous detection and typing of polyomavirus JC, BK and SV40 DNA in clinical samples. J. Virol. Methods. 82:137–144. Forsman, P., A. Tilsalatimisjarvi, and T. Alatossava. 1997. Identification of Staphylococcal and Streptococcal causes of bovine mastitis using 16S–23S rRNA spacer regions. Microbiology. 143:3491–3500. Ghadersohi, A., R. J. Coelen, and R. G. Hirst. 1997. Development of a specific DNA probe and PCR for the detection of Mycoplasma bovis. Vet. Microbiol. 56:87–98.

Journal of Dairy Science Vol. 84, No. 5, 2001

Greenfield, L., and T. J. White. 1993. Sample preparation methods. Pages 121–137 in Diagnostic Molecular Microbiology: Principles and Applications. D. H. Persing, T. F. Smith, T. F. Tenover and T. J. White, ed. American Society for Microbiology, Washington, DC. Gurtler, V., and V. A. Stanisich. 1996. New approaches to typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology. 142:3–16. Henegariu, O., N. A. Heerema, S. R. Dlouhy, G. H. Vance, and P. H. Vogt. 1997. Multiplex PCR-critical parameters and step-by-step protocol. Biotechniques. 23:504–511. Herring, A. J., N. F. Inglis, C. K. Ojeh, D. R. Snodgrass, and J. D. Menzies. 1982. Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver strained polyacrylamide gels. J. Clin. Microbiol. 16:473–477. Higuchi, R. 1989. Simple and rapid preparation of samples for PCR. Pages 31–38 in PCR Technology: Principles And Applications For DNA Amplification. H. A. Ehrlich, ed. Stock Press, New York, NY. Jayarao, B. M., S. P. Oliver, J. R. Tagg, and K. R. Matthews. 1991. Genotypic and phenotypic analysis of Streptococcus uberis isolated from bovine mammary secretions. Epidemiol. Infect. 107:543–555. Jensen, M. A., J. A. Webster, and N. Straus. 1993. Rapid identification of bacteria on the basis of polymerase chain reaction amplified ribosomal DNA spacer polymorphisms. Appl. Environ. Microbiol. 3:186–194. Khan, M. A., C. H. Kim, I. Kakoma, E. Morin, R. D. Hansen, W. L. Hurley, D. N. Tripathy, and B. K. Baek. 1998. Detection of Staphylococcus aureus in milk by use of polymerase chain reaction analysis. Am. J. Vet. Res. 59:807–813. Leblondbourget, N., H. Philippe, I. Mangin, and B. Decaris. 1996. 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifidobacterium phylogeny. Int. J. Syst. Bacteriol. 46:102–111. Madico, G., T. C. Quinn, J. Boman, and C. A. Gaydos. 2000. Touchdown enzyme time-release-PCR for detection and identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci using the 165 and 165–235 spacer rRNA genes. J. Clin. Microbiol. 38:1085–1093. Messmer, T. O., S. K. Skelton, J. F. Moroney, H. Daugharty, and B. S. Fields. 1997. Application of a nested, multiplex PCR to psittacosis outbreaks. J. Clin. Microbiol. 35:2043–2046. Moe, C. L., T. J. Gentsch, T. Ando, G. Grohmann, S. S. Monroe, X. Jiang, J. Wang, M. K. Estes, Y. Seto, C. Humphrey, S. Stine, and R. I. Glass. 1994. Application of PCR to detect Norwalk Virus in fecal specimens from outbreaks of gastroenteritis. J. Clin. Microbiol. 32:642–648. Tong, C.Y.W., C. Donnelly, G. Harvey, and M. Sillis. 1999. Multiplex polymerase chain reaction for the simultaneous detection of Mycoplasma pneumoniae, Chlamydia pneumoniae, and Chlamydia psittaci in respiratory samples. J. Clin. Pathol. 52:257–263. Toye, B., W. Woods, M. Bobrowska, and K. Ramotar. 1998. Inhibition of PCR in genital and urine specimens submitted for Chlamydia trachomatis testing. J. Clin. Microbiol. 36:2356–2358.