Restriction enzymes were obtained from New England Biolabs, were prepared by standard methods, or were a giftof Charles. Yanofsky. E. coli DNA-dependent ...
Proc. Natl. Acad. Sci. USA Vol. 77, No. 4, pp. 1862-1866, April 1980
Biochemistry
Multivalent translational control of transcription termination at attenuator of iHvGEDA operon of Escherichia coli K-12 (DNA sequence/leader RNA/RNA structure/in vitro transcription/multivalent attenuation)
ROBERT P. LAWTHER* AND G. WESLEY HATFIELD Department of Microbiology, College of Medicine, University of California, Irvine, California 92717
Communicated by Charles Yanofsky, December 31, 1979
ABSTRACT The regulatory region for the ivGEDA operon of Escherichia coli K-12 has been located and characterized. ilv leader RNA transcribed from this region is described, and the DNA sequence of the region is presented. This DNA sequence contains a transcription promoter, a region coding for a 32-amino-acid polypeptide containing multiple isoleucine, valine, and leucine codons, and a transcription termination site preceding the first structural gene. The mutually exclusive secondary structures of the leader RNA have been analyzed. On the basis of these data, a model for the multivalent attenuation of the ilvGEDA operon is proposed. The ilvGEDA genes of Escherichia col' K-12 are multivalently regulated by the percent aminoacylation of tRNAVal, tRNAIle, and tRNALeu (1, 2), and strains containing altered Rho factor exhibit increased expression of this operon (3, 4). It has, therefore, been suggested that this operon might be regulated by an attenuator mechanism (3-5) similar to that proposed for several other amino acid biosynthetic operons (6-11). We have now defined the location of the regulatory region for the ilvGEDA operon as being promoter proximal to the livG gene. We show that a previously described short RNA transcript is an ilv leader RNA which is transcribed from the regulatory region. We designate the probable sites of transcriptional initiation and termination of this leader RNA by in vitro transcription. We also report here the DNA sequence of the IlvGEDA promoter-attenuator region and show that it contains multiple codons for isoleucine, valine, and leucine within a potential coding region for a short leader polypeptide. On the basis of these results and by analysis of the possible secondary structures of the ilv leader RNA, we conclude that this operon is regulated by translational control of transcription termination at an attenuator site (12, 13).
MATERIALS AND METHODS Restriction enzymes were obtained from New England Biolabs, were prepared by standard methods, or were a gift of Charles Yanofsky. E. coli DNA-dependent RNA polymerase was obtained from New England Biolabs. Plasmid pVH153, containing the regulatory-region of the trp operonwith a G-to-A transition at base pair 130 of the attenuator (14), was a generous gift of G. Zurawski and C. Yanofsky. The plasmid, pRL5, was constructed and DNA was prepared as described (15). In vitro RNA transcription was performed as described (6, 15) with the addition of heparin as described by Majors (16). The DNA sequence analysis was performed as described by Maxam and Gilbert (17). The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U. S. C. §1734 solely to indicate this fact.
RESULTS The in vitro transcription of two plasmids that contain the regulatory region for the ilvGEDA operon. yields two short leaderlike RNAs 180 and 250 nucleotides long (see Fig. 4, lane 1; ref. 15). This in vitro labeled RNA was hybridized to a Southern blot (18) of a restriction endonuclease digest of the regulatory region. Both transcripts hybridized to the 300base-pair Hae III/HinfI fragment (see Fig. 2) located 1.8 kilobase pairs in front of the DNA sequence encoding the ilvE gene (data not shown). The DNA sequencing strategy is shown in the lower portion of Fig. 1. The DNA sequence of this region is presented in Fig. 2, and a representation of the possible base pairing of the leader RNA transcribed from this region is shown in Fig. 3. The DNA sequence presented in Fig. 2 contains a series of structures that indicate that the 180-nucleotide RNA is transcribed from a site near the Hae III restriction site toward livG, consistent with it being a leader RNA for the ilvGEDA operon. The region -40 to 2 base pairs, prior to the start of the sequence encoding the leader polypeptide, contains a DNA sequence strikingly similar to the sequences reported for a number of E. coil promoters (19, 20). Nucleotides -I to 2, C-A-T, are identical with the trinucleotide region proposed to be important for the start of transcription (19). The base pairs -15 to -7, GG-T-A-A-C-T-C-T, include a region for RNA polymerase function similar to that initially described by Pribnow (21). Further removed, at -38 to -27 base pairs, is a second sequence, C-T-T-G-T-A-C-T-A-T-T-T, similar to sequences reported to be important for promoter function (22). Approximately 180 base pairs from the proposed C-A-T initiator trinucleotide is a string of eight thymidine residues preceded by a G- and C-rich inverse repeat region presumed to be a site of transcription termination by analogy to other sequenced transcription teminators (20). That transcription indeed originates from and terminates at the sites discussed above and that it proceeds toward the iivGEDA structural genes are indicated by the results of in vitro transcriptions of restriction fragments (Fig. 4). As described (15), in vitro transcription of the plasmid pRL5 yields two short RNAs, 180 and 250 nucleotides long, specific to the ilvGEDA regulatory region (Fig. 4, lane 1). Transcription of the 300base-pair Hae III/HinfI fragment (Figs. 1 and 2) yields only the 180-nucleotide transcript (Fig. 4, lane 2). Transcription of the shorter 220-base-pair Hae III/Hpa II restriction fragment that ends just prior to the eight thymidine residues (Figs. 1 and 2) yields a 175-nucleotide transcript (Fig. 4, lane 3). The still shorter 180-base-pair Hae III/Sau3Al restriction fragment that ends just after the proposed leader polypeptide sequence (Figs. 1 and 2) yields, upon transcription, a 135-nucleotide transcript (Fig. 4, lane 4). Lane 5 of Fig. 4 contains the transcription *
1862
Present address: Department of Biology, University of South Carolina, Columbia, SC 29208.
Biochemistry:
Lawther and Hatfield
Proc. Natl. Acad. Sci. USA 77 (1980)
1863
pRL5
Hindell
kbt
'I
0
ilv E ilv G Kpn I SalI I HindIII I
HaeI III
7,,2
1
' 3
-4
5
Hae III 'Taq I Sau3Al Hpall Hinfl Hha I
bp
I 100
I 200
ilv D -
ilv A
6
7
A GA U G A C USA
128
Hinf
I
I
400
300
C.G
G*C
Ih" 500
Hae 111,
122
G*C
AG
A*U
GA
G C A G
Hinfit Taq I
G AAAoU AoU
FIG. 1. Restriction endonuclease map of the ilvGEDA regulatory region of E. coli K-12. Thickened black lines in the lower portion of the figure show the DNA fragments that were end labeled and whose sequences were determined according to the methods of Maxam and Gilbert (17). kb, kilobase; bp, base pairs.
/
186
GoC AoU AC-G G-U A*Uocou AUAU GC CG 41 CeC-CG CoGoC.C AUUAGUGAGC A C U CGoCG GoCoG G CC UG G UC G U G A U U A GCGC
,/UAC-G-CC 72. GoUoAoU
16
GC C G GCG A UeA AA GOC
82\GCCgo aU C//eg GoU
A
A
U
U
U A U
FIG. 3. Proposed secondary structure of the ilvGEDA leader RNA.
end of the restriction fragment (Fig. 5, lane 3). Transcription of the 325-base-pair Hae III/Hha I restriction fragment (Figs. 1 and 2) again yields the 180-nucleotide leader RNA plus a longer 265-nucleotide transcript, again consistent with reading through the attenuator from the proposed start site to the end -10
-M
-D
C/151
32
products of a 570-base-pair Hpa II restriction fragment that contains the regulatory region of the trp operon. The 140nucleotide leader RNA and 260-nucleotide runoff RNA, resulting from transcriptional readthrough of the trp attenuator, are indicated as molecular weight standards. Back calculations with the length of these transcripts from the known restriction sites are consistent with the idea that the adenine in the trinucleotide C-A-T, at -I to 2 base pairs (Fig. 2), denotes the start of transcription and, therefore, that transcription terminates within the series of thymidine residues at positions 179-186 (Fig. 2). In vitro transcription of restriction fragments that contain the ilvGEDA regulatory region does not yield detectable readthrough transcripts. It has been shown that substituting ITP for GTP in in vitro RNA synthesis decreases the efficiency of transcription termination (6). Transcription of the ilvGEDA regulatory region in the presence of ITP also results in less efficient termination and permits transcriptional readthrough at the IlvCEDA attenuator. Lane 1 of Fig. 5 presents the products of transcription of pRL5 with GTP. Transcription of the 300-base-pair Hae III/HinfI fragment (Figs. 1 and 2) with GTP yields the 180nucleotide RNA (Fig. 5, lane 2). Transcription of this same fragment in the presence of ITP yields not only the 180-nucleotide RNA, but also a 240-nucleotide transcript consistent with RNA polymerase reading through the attenuator to the -4
A A C G A A
2)
10
-1
CAAAAAATATCTTGTACTATTTACAAAACCTATGGT AACTCTTTAGGCATTCCTTCGAACAAGATGCAAGAAAA Hae III
30
40 It Mr Ala ni
50 Lu Ag Vma
6d ar Li
ie
Va
Via
70 ie ar Val
Val
80 Val
90 ie
e
li A
mn
RD
GACAAAATGACAGCCCTTCTACGAGTGATTAGCCTGGTCGTGATTAGCGTGGTGGTGATTATTATCCCACCG (1A) (iB) 130
1mD
110
100
150
14)
10D
ma AZ ht c w Qs G Ala Ah Leu ( aLy TGCGGGGCTGCACTTGGACGAGGAAAGGCTTAGAGATCAAGCCTTAACGAACTAAGACCCCCGCACCGAAAG (5) (3) (4) (2)
Sau3Al
M9
1.0
170
21
20
22D
230
ago
GTCCGGGGGTTTTTTTTGACCTTAAAAACATAACCGAGGAGCAGACAATGAATAACAGCACAAAATTCTGTT
(6) Hpa II 310 2D 300 m290 Gly Ala GCn TIp Val Val His Ala Lau Ag Ala Gin TCTCAAGATTCAGGACGGGGAACTAACTATGAATGGCGCACAGTGGGTGGTACATGCGTTGCGGGCACAG
250
Hinfl
29D
270 Nbt
Am
Hha I
FIG. 2. DNA sequence of the ilvGEDA regulatory region. The DNA sequence is numbered arbitrarily from the proposed point of transcription initiation. Underlinedsections indicate the juxtaposition of base-pairing regions of the leader RNA shown in the schematic representation in Fig. 3.
1864
Biochemistry: Lawther and Hatfield 1
2
3
4
Proc. Natl. Acad. Sci. USA 77 (1980)
5
1
2
3
4
de,,w
260
250
250
180
*__o
265 240
180 140
I.
4S1w "..
FIG. 4. In vitro transcription of DNA restriction fragments from the ilvGEDA regulatory region. RNA transcribed from: lane 1, pRL5; lane 2, the 300-base-pair Hae III/Hinfl restriction fragment; lane 3, the 220-base-pair Hae III/Hpa II restriction fragment; lane 4, the 175-base-pair Hae III/Sau3AI restriction fragment; lane 5, the 570-base-pair Hpa II restriction fragment that contains the trp regulatory region. Unlabeled nucleotides were at 150 ,M each and [a32P]UTP (300 Ci/mol; 1 Ci = 3.7 X 1010 becquerels) was at 15 mM (6, 15).
of this fragment. The origins of the shorter transcripts formed under conditions of in vitro transcription in the presence of ITP are unknown. An abundance of in vivo evidence indicates a role for Rho factor in ilvGEDA regulation (3, 4). Yet, the data presented here indicate that in vitro transcription termination at the ilvGEDA attenuator site is independent of the addition of Rho factor. DISCUSSION We report here the DNA sequence that we believe to be the beginning of the ilvG gene. This DNA sequence, beginning at base pair 270 (Fig. 2), contains the initial 42 base pairs of an open translation frame that extends for at least another 740 base pairs (unpublished data). On the basis of restriction enzyme analysis and phage deletion mapping, it appears that the ilvG gene covers a region that extends approximately half the distance from the HindIII site in the beginning of ilvE to the HindIII site prior to iivG in Fig. 1 (D. Calhoun, personal
communication). On the basis of our in vitro transcription data (Figs. 4 and 5) and by analogy to other sequenced DNA transcription termination sites (20), we have identified a site that terminates transcription of a 180-nucleotide leader RNA formed from the regulatory region of the ilvGEDA operon. This site is located in a sequence of eight thymidine residues preceded by a region
FIG. 5. Effect of substitution of ITP for GTP on in vitro transcription of DNA from the ilvGEDA regulatory region. Lanes 1 and 2 are the products of transcription of pRL5 and the 300-base-pair Hae III/HinfI restriction fragment, respectively, with GTP. Lanes 3 and 4 are the transcription products of the Hae III/HinfI restriction fragment and the 325-base-pair Hae III/Hha I restriction fragment, respectively, with ITP.
rich in cytosine and guanine residues containing extensive rotational symmetry (regions 5 and 6; Figs. 2 and 3). Thus, the secondary structure that can form in the RNA transcribed from this region is the presumed terminator stem-loop structure of this attenuator. Other regions of symmetry include the sequences designated 1A, lB, 2, 3, and 4 in Fig. 2. It can be seen in Fig. 3 that RNA transcribed from this region can form secondary structures by base pairings between regions 3 and 4 and regions 2 and 5. Also, RNA transcribed from regions LA and 1B of this DNA sequence can base pair with the 3' half and 5' half of the region-2 RNA, respectively. With the exception of the 3-4 stem-loop structure, the secondary structures shown in Fig. 3 are mutually exclusive. Further analysis of this sequence reveals a potential coding region for a 32-amino-acid leader polypeptide preceding the transcription termination site (Fig. 2). Fourteen of the first 20 codons of the sequence encoding this leader polypeptide encode the amino acids involved in the multivalent regulation of this operon. Most of these codons are positioned such that limitation of aminoacylation of the respective tRNAs will result in relief of attenuation according to the current model of translational control of transcription termination (12, 13). In keeping with this model, we can interpret the critical interactions between ribosomes translating the ilv leader polypeptide and the iiv leader RNA secondary structure. If nascent leader RNA is not translated, then complementary sequences in the structure will base pair as they are synthesized, as shown
Biochemistry:
Lawther and Hatfield
Proc. Natl. Acad. Sci. USA 77 (1980)
1865
FIG. 6. Postulated effect of ribosome positioning on the secondary structure of ilvGEDA leader RNA. Shaded circles represent RNA protection sphere of ribosome. Juxtaposed black bars represent base-paired regions; juxtaposed black and open bars represent nonpaired regions. (A) No translation; (B) ribosome stalled at tandem leucine codons; (C) ribosome stalled at tandem valine or isoleucine codons; (D) ribosome stalled at tandem isoleucine or valine codons with attachment of second ribosome.
in Fig. 6A. The formation of the 5-6 terminator stem-loop structure should result in transcription termination. This pre-
diction is consistent with the efficient termination observed during in vitro transcription in the absence of translation (Figs. 4 and 5). Under in vivo conditions of coupled transcriptiontranslation, the initial two tandem codons for leucine at the fourth and fifth positions of the leader peptide are situated such that a ribosome pausing or stalling at these positions should disrupt base pairing between regions IA and the 3' half of region 2. This should in turn free the 3' half of region 2 to base pair with complementary sequences in region 5 of the terminator. This would be expected to destabilize the top half of the terminator stem-loop structure, presumably resulting in increased transcription of the structural genes (Fig. 6B). If this is so, it would also follow that impeding ribosome movement through the threonine and alanine codons at positions two and three of the leader peptide would similarly cause deattenuation of the operon. We do not know whether these amino acids do, in fact, affect the regulation of this operon although, in order to preserve regulatory specificity, we would predict they do not. It is of interest to note that the codon for alanine (GCC) in the IA region of the leader is complementary to sequences in region 2 that encode two tandem alanine codons (GCU, GCA; Figs. 2 and 3). Therefore, it appears that if translation of the leader were impeded by a limitation for charged alanyl-tRNA, then ribosomes pausing at these latter alanine codons in region 2 would protect the integrity of the terminator stem-loop structure. Because "regulatory" codon sequences in other attenuators are present two or more in a row, a single codon might not effectively stall a ribosome due to mistranslation observed under conditions of amino acid limitation (23, 24). Evidence that the early tandem leucine codons do participate in attenuation comes from the fact that the regulation of the ilvGEDA operon in E. coli K-12 is affected by the hisT mutation (25) and that these two codons are probably the only ones present in the leader that can base pair to the anticodons of tRNAs affected by the hisT mutation (26, 27). It has been reported that ribosomes mask about three codons 3' to the codon being read (12). If so, then the arginine, valine, isoleucine, serine, leucine, and valine codons at the sixth through eleventh positions of the leader should not participate in attenuator regulation. However, the fact that four out of six of these codons are "regulatory" codons might suggest some kinetic parameters of attenuation that we currently do not understand. The tandem valine codons at positions 11 and 12 and the three valine codons followed by three isoleucine codons at positions 15 through 20 are situated in the leader such that they would be expected to disrupt base pairing between region 1B
and the 5' half of region 2. This should inhibit the formation of the bottom half of the stem-loop terminator structure, which should presumably result in deattenuation of the structural genes (Fig. 6C). Stalling of ribosomes at these latter codons might expose enough of the 5' end of the leader message for a sufficient time to load another ribosome. This situation would allow both halves of region 2 to base pair with all of region 5 and completely disrupt the stem-loop terminator structure (Fig. 6D). In order to accommodate the current mode, stalling of a ribosome at either of the last two isoleucine codons would appear to require the attachment of another ribosome in order to affect deattenuation. The presence of a ribosome at these isoleucine codons would be expected to promote the formation of the bottom half of the terminator stem-loop structure. If there were not another ribosome present in the IA region, then the entire stem-loop terminator structure would form. The base pairing that occurs between regions 3 and 4 appears to be most important in the stabilization of the base pairing between regions 2 and 5, which preempts the formation of the terminator under conditions that affect deattenuation. As shown in Table 1, the AG of the stem-loop structure that preempts the formation of the terminator by base pairing regions 3 with 4 and regions 2 with 5 is -27.6 kcal (1 cal = 4.184 joules). If region 3 could not base pair with region 4, this would decrease the stability of the 2-5 stem-loop structure by 6.9 kcal. The estimated free energies of base pairing of each of the other regions is presented in Table 1, calculated as described (28, 29). The free energies of association of these regions are similar to those calculated for other attenuator regions (12). There are several facets of this structure that are not readily explained by the attenuator model (12, 13). For example, the model would predict that a ribosome pausing at the threonine Table 1. Estimated free energies of the base-paired regions of ilv leader RNA Nucleotides Base-paired base paired AG, kcal* regions 1A and 1B with 2
31-41 and 72-82 with 90-112
36.3
3 with 4; 2 with 5
122-128 with 136-142 and 95-106 with 154-165
-27.6
5 with 6
151-164 with 169-182
-27.8
* Calculated at 298 K.
1866
Biochemistry: Lawther and Hatfield
and serine codons at positions 2 and 14 of the RNA encoding the leader polypeptide would cause deattenuation of the ilvGEDA structural genes. Also, regulation of the previously described attenuators appears to be explained by assuming that only one ribosome translates the leader mRNA at a time, whereas the structure presented here seems to require the participation of two ribosomes under certain circumstances. Further, unlike other attenuators, four regulatory codons for branched-chain amino acids located at positions 7, 8, 10, and 11 in the leader RNA polypeptide coding region do not appear to be involved in the disruption of possible RNA secondary structures. Finally, the base pairing and the regulatory codon positions in the ilv leader RNA are such that the top half, the bottom half, or the entire terminator stem-loop structure can be disrupted depending on the positioning and the number of ribosomes in the leader polypeptide coding region. The magnitude of each of these destabilizing affects on relief of transcription in this attenuator is not easily interpreted at this time. Although we do not know the origin of the longer 250-nucleotide RNA transcript (Fig. 4), we do know that it hybridizes to the same Hae III/Hinf restriction fragment that produces the 180-nucleotide transcript (unpublished data). it is possible that it is synthesized in the opposite direction from the shorter transcript. It is equally likely that there exists a second promoter for the ilvGEDA operon which initiates transcription about 20 base pairs upstream of the Hae III site at the beginning of the attenuator region and terminates at the transcription termination site within the attenuator region. After this paper was written, on the basis of in vitro transcription of appropriate DNA restriction fragments, we found that the 250-base RNA transcript is synthesized in the same direction as the 180-base leader RNA transcript and that it is apparently terminated at the same transcription termination site. We thank Kevin Bertrand for many helpful discussions and for critically reading this manuscript. We are grateful to Marie Pollack and Twyla Miner for their expert technical assistance. This work was supported in part by grants from the National Institutes of Health (GM 24330) and the National Science Foundation (PCM 78-08564). R.P.L. was the recipient of a National Institutes of Health Postdoctoral
Traineeship (GM 07307). 1. Brenchley, J. E. & Williams, L. S. (1975) Annu. Rev. Microbiol.
59,251-274. 2. Smith, J. M., Smith, F. J. & Umbarger, H. E. (1979) Mol. Gen. Genet. 169, 299-314.
Proc. Natl. Acad. Sci. USA 77 (1980) 3. Smith, J. M., Smolin, D. E. & Umbarger, H. E. (1976) Mol. Gen. Genet. 148, 111-124. 4. Lawther, R. P. & Hatfield, G. W. (1978) Mol. Gen. Genet. 167, 227-234. 5. Bertrand, K., Korn, L., Lee, F., Platt, T., Squires, C. L., Squires, C. & Yanofsky, C. (1975) Science 189, 22-26. 6. Lee, F. & Yanofsky, C. (1977) Proc. Natl. Acad. Sci. USA 74, 4365-4369. 7. Zurawski, G., Brown, K., Killingly, D. & Yanofsky, C. (1978) Proc. Natl. Acad. Sci. USA 75,4271-4275. 8. DiNocera, P. P., Blasi, F., LiLauro, R., Frunzio, R. & Bruni, C. B. (1978) Proc. Natd. Acad. Sci. USA 75,4276-4280. 9. Barnes, W. M. (1978) Proc. Natl. Acad. Sci. USA 75, 42814285. 10. Gardner, J. F. (1979) Proc. Natl. Acad. Sci. USA 76, 17061710. 11. Gemmill, R. M., Wessler, S. R., Keller, E. B. & Calvo, J. M. (1979) Proc. Nat!. Acad. Sci. USA 76,4941-4945. 12. Oxender, D. L., Zurawski, G. & Yanofsky, C. (1979) Proc. Natl. Acaed. Sci. USA 76,5524-5528. 13. Keller, E. B. & Calvo, J. M. (1979) Proc. Natl. Acad. Sci. USA 76, 6186-6190. 14. Stauffer, G. V., Zurawski, G. & Yanofsky, C. (1978) Proc. Nat!. Acad. Sci. USA 75,4833-4837. 15. Lawther, R. P. & Hatfield, G. W. (1979) Nucleic Acids Res., 7, 2289-2301. 16. Majors, J. (1975) Proc. Natl. Acad. Sci. USA 72, 4394-4398. 17. Maxam, A. M. & Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA
74,560-564. 18. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517. 19. Scherer, G. E. F., Walkinshaw, M. D. & Arnott, S. (1978) Nucleic Acids Res. 5, 3759-3773. 20. Rosenberg, M. & Court, D. (1979) Annu. Rev. Genet. 13, 319-353. 21. Pribnow, D. (1975) Proc. Natl. Acad. Sci. USA 72,784-788. 22. Gilbert, W. (1976) in RNA Polymerase, eds. Losick, R. & Chamberlin, M. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) pp. 193-205. 23. Parker, J., Pollard, J. W., Friesen, J. D. & Stanners, C. P. (1978) Proc. Natl. Acad. Sci. USA 75,1091-1095. 24. Holmes, W. M., Hatfield, G. W. & Goldman, E. (1978) J. Biol. Chem. 253,3482-3486. 25. Lawther, R. P. & Hatfield, G. W. (1977) J. Becteriol. 130, 552-557. 26. Turnbough, C. L., Jr., Neill, R. J., Landsberg, R. & Ames, B. N. (1979) J. Biol. Chem. 254,511-519. 27. Harada, F. & Nishimura, S. (1974) Biochemistry 13,300-307. 28. Tinoco, I., Jr., Borer, P. N., Dengler, B., Levine, M. D., Uhlenbeck, 0. C., Crothers, D. M. & Cralla, J. (1973) Nature (London) New Biol. 246, 40-41. 29. Borer, P. N., Dengler, B., Tinoco, I., Jr. & Uhlenbeck, 0. C. (1974) J. Mol. Biol. 86,843-853.
