Myc represses differentiation-induced p21CIP1 expression ... - Nature

Oncogene (2003) 22, 351–360

& 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc

Myc represses differentiation-induced p21CIP1 expression via Miz-1-dependent interaction with the p21 core promoter Siqin Wu1, Cihan Cetinkaya1, Maria J Munoz-Alonso2, Natalie von der Lehr1, Fuad Bahram1, Vincent Beuger3, Martin Eilers3, Javier Leon2 and Lars-Gunnar Larsson*,1,4 1 Department of Plant Biology, Swedish University of Agricultural Sciences, Uppsala, Sweden; 2Departamento de Biologia Molecular and Unidad Asociada-CSIC, Universidad de Cantabria, Santander, Spain; 3Institute for Molecular Biology and Tumour Research, Marburg, Germany

Inhibition of cellular differentiation is one of the wellknown biological activities of c-Myc-family proteins. We show here that Myc represses differentiation-induced expression of the cyclin-dependent kinase (CDK) inhibitor p21CIP1 (CDKN1A, p21), known to play an important role in cell fate decisions during growth and differentiation, in hematopoietic cells. Our results demonstrate that the c-Myc-responsive region is situated in the p21 core promoter. c-Myc binds to this region in vitro and in vivo through interaction with the initiator-binding Zn-finger transcription factor Miz-1, which associates directly with the promoter. Association of Myc with the promoter in vivo correlates inversely with p21 expression. Using mutants of c-Myc with impaired binding to Miz-1, our results further show that repression of p21 promoter/ reporters as well as the endogenous p21 gene by Myc depends on interaction with Miz-1. Expression of Miz-1 increases during hematopoietic differentiation and Miz-1 activates the p21 promoter under conditions of low Myc levels, indicating a positive role for free Miz-1 in this process. In conclusion, repression of differentiation-induced p21 expression through Miz-1 may be an important mechanism by which Myc blocks differentiation. Oncogene (2003) 22, 351–360. doi:10.1038/sj.onc.1206145 Keywords: Myc; Miz-1; p21Cip1; differentiation; cell cycle; transcription Introduction Proto-oncogenes of the MYC family encode transcription factors that play an important role in the control of cellular growth, differentiation and apoptosis. Deregulated expression of MYC genes as a result of chromosomal rearrangements contributes to the development of a variety of cancers. Two regions of c-Myc are absolutely required for these biological effects: (i) the

*Correspondence: Lars-Gunnar Larsson, Uppsala Genetic Center, Department of Plant Biology, Swedish University of Agricultural Sciences, Box 7080, Uppsala 750 07, Sweden. E-mail: [email protected] Received 27 August 2002; revised 10 October 2002; accepted 16 October 2002

C-terminal basic region, helix–loop–helix and leucine zipper domains (bHLHZip), involved in specific DNAbinding to E-box recognition sequences via interaction with the obligatory partner Max; and (ii) the N-terminal transactivation domain (TAD) including the evolutionary conserved Myc Box 1 and Myc Box 2 (MB1 and MB2) (for a review, see Grandori et al., 2000). MB2 associates with the cofactor TRRAP, thereby recruiting SAGA-like complexes containing the histone acetyl transferase (HAT) activity to target promoters (McMahon et al., 1998, 2000; Bouchard et al., 2001; Frank et al., 2001; for a review, see Amati et al., 2001). These play a role in modulating chromatin structure during gene activation. An increasing number of target genes activated by c-Myc, involved in cell growth, metabolism and proliferation, have been identified (for a review, see Levens, 2002). Activation of target genes through E-boxes does, however, not account for all biological activities of Myc (James and Eisenman, 2002). c-Myc also represses transcription of certain genes of relevance for its biological effects, including the CDK inhibitors p15INK4B, p21CIP1 and p27KIP1, as well as genes involved in cellular differentiation and metabolism (Li et al., 1994; Mitchell and El-Deiry, 1999; Warner et al., 1999; Wu et al., 1999; Claassen and Hann, 2000; Coller et al., 2000; O’Hagan et al., 2000; Gartel et al., 2001; Yang et al., 2001). The mechanism for repression by Myc is less clear, but the repression of p15INK4B by Myc has recently been shown to involve direct interaction with the Zn-finger transcription factor Miz-1, which binds to the initiator (Inr) sequence of the p15 promoter (Seoane et al., 2001; Staller et al., 2001). Downregulation of c-Myc is an essential part of the antiproliferative response to differentiation signals (for a review, see Grandori et al., 2000). We have shown previously that constitutive expression of v-Myc blocks induced differentiation and growth arrest of human U937 monoblasts (Larsson et al., 1988; Bahram et al., 1999). Since the rapid induction of the CDK inhibitor p21Cip1, here referred to as p21, by differentiation signals seems to play an important decisive role for the differentiation process in a number of cell types, including U-937 cells (Jiang et al., 1994; Steinman et al., 1994; Liu et al., 1996; Missero et al., 1996; Zhang et al., 1999; Cheng et al., 2000; for reviews, see Sherr and

Myc represses p21CIP1 expression via Miz-1 S Wu et al

352

Roberts, 1999; Steinman, 2002), we hypothesized that interference with induced p21 expression may be one mechanism by which v-Myc blocks cellular differentiation. p21 belongs to the CIP/KIP family of CDK inhibitors that regulates several types of cyclin/CDK complexes and plays an important role in cell cycle arrest, differentiation, DNA repair, cell senescence and apoptosis (for a review, see Sherr and Roberts, 1999). Induction of the p21 gene expression during differentiation- or growth inhibition is regulated by several transcription factors of importance for these processes, such as p53, VDR, RAR, C/EBP, STATs, Smads, Sp1, Hox10 among others (for a review, see Gartel and Tyner, 1999). Here we show that Myc represses differentiation-induced p21 expression via Miz-1-dependent interaction with the p21 core promoter. Results Differentiation-induced p21 expression is inhibited in vMyc-transformed U-937 human monoblasts U-937 monoblasts were induced to undergo terminal monocytic differentiation by the addition of phorbol ester (TPA), as exemplified by increased expression of the monocytic differentiation marker CD11c and the

reduced incorporation of 3H-labelled thymidine (Figure 1a). This process was completely blocked in U-937-myc-6 cells constitutively expressing v-myc, confirming previous results (Larsson et al., 1988). As an approach to elucidate the mechanism behind this block, we investigated the expression of the CDK inhibitor p21, known to play a decisive role during differentiation (Jiang et al., 1994; Steinman et al., 1994; Liu et al., 1996; Missero et al., 1996; Zhang et al., 1999; Cheng et al., 2000; for reviews, see Sherr and Roberts, 1999; Steinman, 2002). p21 mRNA was induced within 2 h of TPA treatment in U-937-1 cells, whereas only traces of p21 transcripts were observed in U-937-myc-6 cells (Figure 1b). p21 protein synthesis increased gradually in U-937-1 cells, whereas only a faint p21 band appeared after 4 h and then faded in TPAstimulated U-937-myc-6 cells (Figure 1c). Exogenous v-Myc expression remained unaltered in U-937-myc-6 cells, as previously reported (Larsson et al., 1988; Bahram et al., 1999). c-Myc represses basal and TPA-induced transcription from the human p21 core promoter These results suggested that v-Myc directly or indirectly repressed TPA-induced expression of p21. Transient

Figure 1 Myc represses basal and differentiation-induced expression of p21 in U-937 monoblasts. (a) Differentiation (CD11c expression) and growth (3H-TdR incorporation) of U-937-1 and v-Myc-expressing U-937-myc-6 cells in response to TPA. (b) Northern blot analysis of TPA-induced p21 mRNA expression. gapdh was used as a reference gene. (c) Immunoprecipitation of 35S in vivo-labeled p21, c- and v-Myc proteins in response to TPA. (d and e) Analysis of basal and TPA-induced p21 promoter activity in U-937-1 cells by transient cotransfection assays using the p21 promoter/luciferase reporter 0-Luc and the CMV-Myc expression vector. (d) Titration of CMV-Myc concentrations. (e) Cotransfection of c-Myc with the indicated promoter/luciferase constructs. The data presented in (d) and (e) are based on at least three separate experiments Oncogene


353

transfection experiments using a p21 promoter/luciferase reporter gene construct in U-937 cells showed that expression of c-Myc repressed both basal and TPAinduced p21 promoter activity approximately two fold, but did not affect the activity of two control promoter constructs, CMV-Luc and pUHC13.3 (Figure 1d and e), suggesting that c-Myc affects p21 expression at least in part at the level of transcription. To map the Myc-responsive region of the p21 promoter, a series of p21 promoter deletion mutants (depicted in Figure 2a) were utilized. Deletions from nucleotide positions 2326 bp to 94 relative to the transcriptional start site did not abolish the relative repression by c-Myc or activation by TPA (Figure 2b), suggesting that the c-Myc response region localized between positions 94 to +16. To further map the cMyc-responsive region, we generated two exchange mutants, which replace either nucleotides 94/50 of the p21 promoter (generating CMV/p21-Luc) or nucleotides 49/+16 (generating p21/CMV-Luc) with the corresponding regions of the c-Myc-nonresponsive CMV IE promoter (Figure 2a). The upper region contains four Sp1/3 binding sites, some of which are required for p21 induction by multiple signals (Gartel and Tyner, 1999). Figure 2c shows that c-Myc repressed the activity of the CMV/p21-Luc construct, but not the p21/CMV-Luc construct (Figure 2c). These results indicated that the c-Myc responsive region is situated between -49 and +16 of the p21 core promoter. The c-Myc HLHZip domain and Myc Box 2 are required for p21 repression To map domains of c-Myc required for repression, a panel of c-Myc deletion mutants was used (Figure 2d). Figure 2e shows that deletions of the conserved HLH, Zip or MB2 domains eliminated the transcriptional repression of the 10-Luc reporter, while deletion of MB1 had a partial effect. In contrast, deletion of the BR did not affect transcriptional repression, indicating that direct binding of c-Myc to DNA is not required. The initiator-binding transcription factor Miz-1 regulates the p21 core promoter The HLH domain of c-Myc interacts with the Inrbinding transcription factor Miz-1 (Peukert et al., 1997), recently shown to be an activator of the p15INK4b promoter and a target for c-Myc-induced repression (Peukert et al., 1997; Seoane et al., 2001; Staller et al., 2001). To determine if Miz-1 is able to activate the p21 promoter, a Miz-1 vector was cotransfected with p21 reporters into U-937 cells. Miz-1 activated 10-Luc and CMV/p21 approximately five- and eight-fold, in untreated and TPA-treated cells, respectively, but had only little effect on p21/CMV-Luc (Figure 3a), suggesting that Miz-1 activated p21 through the c-Myc-responsive core promoter region. Three potential Miz-1 binding sequences with similarities to Miz-1 binding sites in other promoters (Peukert et al., 1997; Seoane et al., 2001; Staller et al., 2001) were identified within this

region (Figure 2a). Substitution of two nucleotides within the potential Miz-1 binding sequence at these three locations, creating CMV/p21mut-Luc (Figure 2a), abolished most of the Miz-1 response (Figure 3a). Figure 3b shows that c-Myc was able to repress Miz-1induced transactivation of the 10-Luc and CMV/p21Luc reporter constructs in a dose-dependent manner in untreated and TPA-treated cells. These results suggest that Miz-1 and c-Myc regulate the p21 promoter in opposite ways through the same core promoter region. Miz-1 expression increases during myeloid differentiation To address whether Miz-1 might be involved in differentiation processes, Miz-1 expression was investigated during myeloid differentiation. Miz-1 mRNA expression was upregulated transiently during TPAinduced monocytic/megakaryocytic differentiation of K562 (Figure 3c), after TPA-induced monocytic differentiation HL-60 and U-937 or RA-induced granulocytic differentiation of HL-60 cells, while c-Myc was downregulated (Figure 3d). Expression of multiple forms of Miz-1 proteins increased gradually during TPA-induced differentiation of HL-60 cells, with maximum expression at late time points (Figure 3e). Similar results were obtained during induced megakaryocytic and erythrocytic differentiation of K562 and monocytic differentiation of THP-1 cells (data not shown). c-Myc binds the p21 core promoter in vitro through interaction with Miz-1 To investigate whether Miz-1 and c-Myc are able to bind the p21 core promoter, cell extracts from transfected Cos-7 cells was used in a DNA pulldown assay with a double-stranded oligonucleotide representing nt 49 to +16 of the p21 promoter. Figure 4a (left panel) shows that Miz-1 bound the p21 promoter sequence, while c-Myc alone did not. However, c-Myc bound DNA when cotransfected with Miz-1, suggesting that cMyc can bind the p21 promoter through interaction with Miz-1. Coimmunoprecipitations using either c-Myc or Miz-1 antisera confirmed that c-Myc and Miz-1 formed a complex in solution (Figure 4a, right panel) as previously reported (Peukert et al., 1997). The apparent less efficient coimmunoprecipitation of c-Myc with Miz1 antibodies than the reverse is likely due to differences in antibody affinities. Interestingly, Miz-1 DNA binding was enhanced in the presence of c-Myc, suggesting that c-Myc may stabilize the Miz-1 interaction with DNA. The binding of Miz-1/Myc to the p21 sequence was specific, since it did not bind the inverse sequence or a p21 sequence with mutations in the three potential Miz1 binding sites (Figure 4b). A c-Myc HLH point mutant with impaired binding to Miz-1 but normal binding to Max was recently identified (Herold et al., 2002). To confirm that c-Myc DNA binding involves HLH interaction with Miz-1, we utilized the mutant MycV394D in the DNA pulldown assay. Figure 4c (left panel) shows that the DNA-binding activity of the V394D mutant was reduced to approximately 25–30% Oncogene


354

Figure 2 c-Myc repression maps to the p21 core promoter and requires the Myc HLH, Zip and MB2 regions, but not the DNAbinding domain. (a) Schematic representation of p21 promoter deletion (upper part) and p21/CMV IE promoter (lower part) exchange mutants. Binding sites for transcription factors regulating the p21 promoter are indicated. Lower part: Enlargement of the p21 10-Luc construct (in white), part of the CMV IE promoter (in gray) and exchange mutants CMV/p21-Luc and p21/CMV-Luc based on these two sequences. Binding sites for transcription factors are underlined. (b and c) Cotransfection of c-Myc with indicated p21 promoter/ reporter deletion mutants (b) and p21/CMV IE promoter exchange mutants (c) into U-937-1 cells. (d) Schematic representation of cMyc deletion mutants used. MB1: Myc box 1; MB2: Myc box 2; BR: basic region; HLH: helix–loop–helix; LZ: leucine zipper. (e) Cotransfection of 10-luc with indicated c-Myc deletion mutants into U-937-1 cells. The data presented in (b, c and e) are based on at least three separate experiments

of that of wt c-Myc, as determined by densitometrical scanning. The enhanced binding of Miz-1 to DNA by cMyc was also impaired. Figure 4c (middle panel) Oncogene

confirmed that the V394D mutant bound inefficiently to Miz-1 (approximately 40% of wt Myc in this assay) (Herold et al., 2002). The right panel shows that equal


355

Figure 3 Miz-1 activates the p21 core promoter and is induced during hematopoietic differentiation. (a) Cotransfection of Miz-1 and indicated p21 promoter/reporter constructs into U-937-1 cells. (b) Increasing amounts of CMV-Myc were cotransfected with 5 mg of CMV-Miz-1 and the indicated p21 reporters into U-937-1 cells. The values are normalized to those of untreated or TPA-treated cells transfected with Miz-1 alone. (c and d) Northern blot analysis of miz-1 mRNA expression during TPA-induced differentiation of K562 cells (c), TPA-induced monocytic and RA-induced granulocytic differentiation of HL-60 cells for 3 days, and TPA-induced monocytic differentiation of U-937-1 cells for 24 h. (d). (e) Western blot analysis of Miz-1 protein expression during TPA-induced differentiation of HL-60 cells

amounts of c-Myc and Miz-1 proteins were used for the assays. We conclude that binding of c-Myc to the p21 promoter depends on interaction with Miz-1, and that cMyc stabilizes Miz-1 binding to DNA. c-Myc repression of p21 involves Miz-1-interacting residues within the c-Myc HLH domain To establish whether c-Myc-induced repression of the p21 promoter depends on interaction with Miz-1 in vivo, transient cotransfections were performed as above using the c-MycV394D and Myc(BR)-Mad mutants. In the latter, the HLHZip domain is replaced by the corresponding region in Mad1, enabling the mutant to bind Max and to activate transcription from E-box elements, but unable to bind Miz-1 (Staller et al., 2001). The

repression by the V394D mutant was indeed impaired compared to wt c-Myc, thus correlating with the impaired binding to Miz-1 (Figure 4d). The Myc(BR)Mad mutant was also unable to repress as expected. To demonstrate that repression of the endogenous p21 gene by Myc was Miz-1 dependent, we selected stable transfectants of K562 cells containing a Zn2+inducible V394D mutant as confirmed in Figure 4e (upper panel). p21 expression was induced in parental K562 cells and in K562KMT control cells (K562 containing empty vector) during TPA-stimulated differentiation, while it was reduced approximately two fold in the presence of Zn2+ in the wt c-Myc KmycB clone (Figure 4e, middle panel). In contrast, no repression was observed in the representative KmycVD7 mutant clone. Similar observations were made in other wt and mutant Oncogene


356

Figure 4 c-Myc binds to and represses the p21 core promoter via interaction with Miz-1. (a–c) DNA pulldown assay using extracts from Cos7 cells transfected with indicated vectors and double-stranded oligonucleotides representing the wt or mutated p21 core promoter (left panels). In (a) right panel and (c) middle panel, the same extracts were immunoprecipitated with indicated antisera and analysed by Western blot. (c) Right panel: Western blot analysis of whole cell extracts. (d) Transient cotransfections of K562 cells with the p21DPst-Luc reporter construct and wt Myc, V394D or Myc(BR)-Mad mutants. (e) Northern blot analysis of p21, c-MYC and exogenous c-MYC (exogen) expression in K562 cells containing Zn2+-inducible wt c-Myc (KmycB), MycV394D (KmycVD7) or empty vector (KMT). The cells were induced with Zn2+ for 16 h followed by TPA for 3 h as indicated. All experiments were repeated at least three times

myc clones (data not shown). The findings strongly suggest that Myc-induced repression of the endogenous p21 gene is dependent on interaction with Miz-1. c-Myc and Miz-1 interact with the p21 promoter in vivo We next investigated whether c-Myc and Miz-1 interact with the p21 promoter in vivo. ChIP analysis using HLOncogene

60 cells demonstrated that a PCR product representing the p21 promoter region (194 to +88) was immunoprecipitated with two Myc antisera, two Miz-1 antisera and a Max antiserum, while only faint background bands were visible using preimmune and two other control antisera (Figure 5a). In contrast, no PCR products were visible using primers for downstream (+3455 to +3771) or upstream (3723 to 3423)


357

using chromatin from untreated and TPA-treated HL60 or U-937-myc-6 cells (data not shown). In conclusion, c-Myc, Miz-1 and Max indeed interact with the p21 promoter in vivo in a differentiation-dependent manner, correlating with p21 expression. Discussion

Figure 5 c-Myc and Miz-1 interact with the p21 promoter in vivo. (a) ChIP analysis of HL-60 cells using indicated antisera and PCR primers specific for the p21 promoter (upper panel), far upstream (middle) or far downstream (lower panel) regions of the p21 gene. (b and c) ChIP analysis using p21 promoter-specific primers and chromatin prepared from HL-60 (b) or v-Myc-transformed U-937myc-6 (c) cells stimulated by TPA for 2 days or left untreated

regions of the p21 gene. p21 gene expression is induced in HL-60 cells, like in U-937 (Figure 1) and K-562 (Figure 4) cells, during TPA-induced differentiation (Jiang et al., 1994; Steinman et al., 1994). Figure 5b shows that in vivo binding of c-Myc to the p21 promoter decreased during induced HL-60 differentiation, whereas the binding of Miz-1 and Max was only slightly reduced. In contrast, binding of Myc and Max to the p21 promoter increased after TPA treatment in v-Myctransformed U-937-myc-6 cells (Figure 5c), where induced expression of p21 is blocked (Figure 1). Also binding of Miz-1 to the promoter increased in response to TPA. No PCR products were obtained with primers for the downstream or upstream regions of the p21 gene

Inhibition of cellular differentiation is one of the wellknown biological activities of c-Myc-family proteins. We show here that Myc represses differentiationinduced expression of the CDK inhibitor p21. A large body of evidence suggests that p21 plays an important role in cell fate decisions during growth and differentiation. p21 expression is induced during differentiation, and interference with p21 expression by gene targeting disturbs normal development and differentiation of many tissues (Jiang et al., 1994; Steinman et al., 1994; Liu et al., 1996; Missero et al., 1996; Zhang et al., 1999; Cheng et al., 2000; for reviews, see Sherr and Roberts, 1999; Steinman, 2002). Since cell growth and differentiation are closely linked and mutually exclusive at the terminal stage of differentiation, it is likely that the CDK inhibitory activity of p21 plays an important role during these processes (Sherr and Roberts, 1999), but other activities of p21 possibly involved directly in promoting differentiation have also been suggested (Zezula et al., 2001). Repression of differentiationinduced p21 expression may therefore be an important component of the mechanism by which Myc blocks differentiation. This view is also supported by the observation that forced expression of p21 induces differentiation of several cell types including the U-937 monoblasts (Liu et al., 1996) used in the present study. Our study suggests that c-Myc represses both differentiation-induced and basal p21 expression at least in part at the level of transcription. This is consistent with recent reports that c-Myc inhibits TGF-b-, TPAand p53-induced as well as basal p21 expression in other cell systems (Mitchell and El-Deiry, 1999; Ceballos et al., 2000; Claassen and Hann, 2000; Coller et al., 2000; Gartel et al., 2001). Our present study provides the rationale for these observations. Taken together, our results from promoter/reporter-, DNA pulldown- and ChIP-assays suggest that the c-Myc-responsive region is situated around the transcriptional start site and that cMyc binds to this region through interaction with Miz1, which associates directly with the promoter. This is reminiscent of the situation at the p15INK4B promoter, where c-Myc also utilizes Miz-1 for repression (Seoane et al., 2001; Staller et al., 2001). Using mutants of c-Myc with impaired binding to Miz-1, our results further show that repression of the endogenous p21 gene depends on residues specifically interacting with Miz-1. Miz-1 seems to play a dual role at the p21 promoter. It acts as an activator of the promoter (Figure 3a, b), and its increased expression during hematopoietic differentiation may indicate a positive regulatory role in this process (Figure 3c, d). However, Myc and Miz-1 also seem to cooperate. Myc utilizes Miz-1 for represOncogene


358

sion of p21, and enhances Miz-1 DNA-binding activity in vitro (Figure 4) and possibly also in vivo, since Miz-1 binding to the p21 promoter seems to correlate with Myc rather than Miz expression (Figure 5). Myc is also reported to facilitate transport of Miz-1 to the nucleus (Peukert et al., 1997). We therefore propose a model where Myc/Miz-1 functions as a growth/differentiation switch resembling the E2F/Rb switch for G1/S transition (Figure 6). According to this model, Miz-1 represses p21 when complexed with Myc, thereby promoting cell growth and inhibiting differentiation. As c-Myc is down-regulated by differentiation signals, Miz-1 acts together with cofactors and other transcription factors to activate transcription of p21, thereby stimulating terminal differentiation. It is likely that other transcription factors participate in the early induction of p21 during differentiation, and a number of factors that mediate differentiation and/or growth inhibitory signals binds to upstream elements in the p21 promoter (Gartel and Tyner, 1999) (Figure 2a). During TGFb-induced activation of the p15 promoter, which is similar in organization to the p21 promoter, Miz-1 interacts directly with Smads, which binds to upstream elements, and p300 (Seoane et al., 2001; Staller et al., 2001). Smads also interacts with Sp1-sites at the promoter. It is therefore possible that Myc and Miz-1 interact with other transcription factors at the p21 promoter (Figure 6). Recent reports suggesting that c-Myc interacts directly with Sp1 and Smads are compatible with this suggestion (Gartel et al., 2001; Feng et al., 2002). Although it is conceivable that Myc may also utilize alternative or cooperative mechanisms for repression, our results show that Myc binding to and repression of the p21 promoter relies on interaction with Miz-1 and is not dependent on upstream regulatory elements. Our hypothesis is therefore that Myc primarily associates with a central component of the transcriptional machinery at the p21 core promoter, Miz-1, thereby blocking multiple incoming upstream signals for activation. Our mutational analysis also suggested that MB2 and the Zip domain were essential, indicating that players other than Miz-1 are involved in Myc-induced repression of p21 and that repression does not simply involve blocking interactions between Miz-1 and its cofactors. Deletion of the Zip domain abolishes the interaction with Max, which apparently is part of the Myc/Miz-1 complex both in vitro and in vivo. The role of Max in this context is, however, still unclear. MB2 interacts with TRRAP, TIP48, TIP49 and BAF53, which are components of different Gcn5- and MYST-family HAT complexes involved in the regulation of chromatin structure (McMahon et al., 1998, 2000; Bouchard et al., 2001; Frank et al., 2001; for a review, see Amati et al., 2001). It is therefore tempting to speculate that Myc may recruit complexes with repressor activity to the p21 promoter through MB2 (Figure 6). It remains to be demonstrated whether any of the HAT complexes above, which are usually associated with transcriptional activation, could also play a role in Myc-induced repression, or whether distinct corepressor complexes Oncogene

Figure 6 A Myc/Miz-1 switch model for regulation of p21 gene expression during differentiation. (a) In undifferentiated cells, Miz1 represses p21 expression by recruiting Myc to the core promoter. The Myc-recruited corepressor (CoR) is hypothesized based on the dependence of the Myc transactivation domain for repression. (b) Differentiation signals results in c-Myc downregulation, increased expression of Miz-1, activation of transcription factors involved in differentiation (DF: differentiation factors), for example, VDR, RAR, C/EBP etc., acting from upstream regulatory elements, recruiting coactivators (CoA). We hypothesize that these factors interact and cooperate with Miz-1 in analogy with the dual input model for TGFb-induced activation of the p15INK4b promoter (Seoane et al., 2001). (c) In Myc-transformed tumor cells, Myc dominantly controls the repressor function of Miz-1 despite activation of DF by differentiation signals, thereby precluding activation of p21. This may involve exclusion of CoA from a Miz-1 activator complex (Staller et al., 2001), and/or binding a CoR complex

are involved. Gcn5 was, however, recently reported to be directly involved in repression of the ARG1 gene in yeast (Ricci et al., 2002).


359

Our data thus suggest that the Myc/Miz-1 switch for repression of target genes such as p21 is utilized for inhibition of differentiation by Myc. It is, however, likely that the activation of target genes through Eboxes also plays a role in maintaining cells in an undifferentiated proliferating state. Differentiation signals could turn off E-box-containing Myc target genes via induced expression of Mad-family proteins, which dimerize with Max to actively repress such genes (Grandori et al., 2000). Therefore, Myc/Miz and Myc/ Max/Mad switches are probably in operation together during terminal differentiation. Further studies are needed to clarify the relative importance of these two pathways. Materials and methods Cell culture and differentiation Human U-937 and K562 myeloid cells and subclones were cultured in RPMI-1640 supplemented with 10% fetal calf serum and antibiotics. U-937-1, the v-Myc-expressing U-937myc-6 clone and assays for monocytic differentiation have been described (Larsson et al., 1988; Bahram et al., 1999). For the analysis of the CD11c monocytic differentiation marker, LeuM5 mAb (Becton and Dickinson, Mountain View, CA, USA) was used. Conditions for TPA-induced differentiation and Zn2+ treatment of selected K562 clones containing Zn2+inducible c-MYC (KmycB) (Delgado et al., 1995), cMYCV394D mutant (KmycVD7) or empty vector (KMT) have been described (Delgado et al., 1995). Northern blot analysis The Northern blot procedure and probes for human c-MYC, p21 and GAPDH were as described (Larsson et al., 1988; Ceballos et al., 2000). The probe for Miz-1 was a 2.4 kb fragment of human cDNA. In sum, 15 mg of total RNA was used per lane. Protein analysis 35 S-labeling, immunoprecipitation and Western blot analysis were performed as described previously (Bahram et al., 1999). An equal number of TCA-precipitable counts for 35S-labeled proteins or equal amounts of unlabeled protein, as determined by Bradford assay of cell extracts and Ponceau staining of Western filters, were used for each sample. IG-9 (Bahram et al., 1999) and C-33 (Santa Cruz Biotechnology) antipanMyc and 10E2 anti-Miz-1 antibodies were employed. p21 antibodies were kindly provided by Dr B Westermark, Uppsala, Sweden.

Transfections, luciferase assays and DNA constructs Transfection by electroporation and luciferase reporter assays were performed as described (Bahram et al., 1999; Delgado et al., 2000). pCMV-LacZ or pRL-TK (Promega) was cotransfected to normalize transfection efficiencies. The human p21 promoter/luciferase constructs 0- to 10-Luc (Zeng et al., 1997), depicted in Figure 2a, were kindly provided by Dr W El-Deiry (Philadelphia, PA, USA). The p21DPst-Luc reporter was described (Delgado et al., 2000). pUHC13.3 contains a minimal CMV promoter with multiple binding sites for the rtTA transactivator in front of the luciferase gene. The structure of the CMV/p21-Luc and p21/CMV-Luc p21

promoter/CMV IE promoter exchange mutants is outlined in Figure 2a. These were created by the annealing of two partially overlapping complementary oligonucleotide pairs designed to contain HindIII and BglII sites, respectively (50 CCCAAGCTTCCCCATTGACGCAAATGGGCGGTAGGC GTGTACGGTGGGAGTTGTATATCAGGGCCGCGCT and 50 -GGAAGATCTCACAAGGAACTGACTTCGGCAG CTGCTCACACCTCAGCTGGCGCAGCTCAGCGCGGCC CTGATA for CMV/p21-Luc and 50 CCCAAGCTTCGAG CGCGGGTCCCGCCTCCTTGAGGCGGGCCCGGGCGGGGCGGGCCTATATAAGCAGAGCT and 50 -GAAGATC TCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGA CGGTTACTAAACGAGCTCTGCTTATATA for p21/CMVLuc), followed by PCR amplification using the underlined primers. The HindIII/BglII-digested products were cloned into plasmid pXP2-Luc. The c-MYC deletion mutants DHLH, DLZ, DBR, DMB1 and DMB2, the Myc(BR)Mad mutant and pcDNA3-Miz-1 have been described previously (Peukert et al., 1997; Staller et al., 2001). The generation of the MycV394D mutant is described in Herold et al. (2002). For stable transfections, K562 cells electroporated at 260 V and 1 mF were selected with 0.5 mg/ml G418. pMT-CB6MycV394D was constructed by ligation of the 1.3 kb KpnI/ XbaI fragment of plasmid pcDNA3-MycV394D into the Zn2+inducible pMT-CB6+ vector (kindly provided by FJ Rausher, Philadelphia, PA, USA).

DNA pulldown and chromatin immunoprecipitation (ChIP) assays For DNA pulldown, cells were lysed by sonication in HKMG buffer as described (Hata et al., 2000). Cell extracts (1– 2 106 cells) were incubated with 1 mg of biotinylated doublestranded oligonucleotide, 0.2 mg ssDNA and 0.5 mg BSA in 1 ml HKMG buffer for 16 h. DNA-bound proteins were collected with streptavidin–agarose beads, washed with HKMG buffer and analysed by Western blotting. The following oligonucleotides pairs were used: p21 wt, biotinTTGTATATCAGGGCCGCGCTGAGCTGCGCCAGCTG AGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGTG and 50 -CACAAGGAACTGACTTCGGCAGCTGCTCACA CCTCAGCTGGCGCAGCTCAGCGCGGCCCTGATATA CAA; mutated p21, biotin-TTGTATATCGCGGCCGCGCT GAGCTGCGCCAGCTGTAGTGTGAGCAGCT-GCCGA AGTCAGTTCGATGTG and 50 -CACATCGAACTGACT TCGGCAGCTGCTCACACTACAGC-TGGCGCAGCTCA GCGCGGCCGCGATATACAA; reversed p21, biotin-GT GTTCCTTGACTGAA-GCCGTCGACGAGTGTGGAGTC GACCGCGTCGAGTCGCGCCGGGACTATATGTT and AACATAT-AGTCCCGGCGCGACTCGACGCGGTCGA CTCCACACTCGTCGACGGCTTCAGTCAAGGAACAC. For ChIP assays, cells were lysed and crosslinked with formaldehyde as described (Eberhardy et al., 2000). Chromatin DNA was sonicated to an average size of 300–500 bp. Immunoprecipitations were carried out in RIPA buffer with the following antibodies: a-c-Myc (N-262), a-Max (C-17), aGal4 (all Santa Cruz), a-Flag M2 (Sigma), polyclonal a-panMyc (IG9) and preimmune serum (IG0), a-Miz-1 10E2 mAb, Miz-1 polyclonal antiserum. The immunoprecipitates were collected with protein G-sepharose beads, washed as described (Bahram et al., 1999), and eluted in TE, 1% SDS. Purified DNA samples were analysed by PCR using primers specific for p21 gene regions. Primers used for PCR reactions were: p21 (194/+88), 50 -ACCGGCTGGCCTGCTGGAACT and 50 -TCTGCCGCCGCTCTCTCACCT; p21 (+3455/+3771), 50 -ATGTTAGGCAAGTTACTTAACTTA and 50 -CTCTTG Oncogene


360 GTAACTTCACACCAAGTT; p21 (3723/3400), 50 -CTC TCTTCAAACATTGTACAAGAC and 50 -AACCTTTTAA CTTCAACTGTCCAA. Note added in proof After acceptance of this manuscript, two papers containing partially overlapping data were published, Seoane et al. (2002). Nature, 419, 727–734, and van de Wetering et al. (2002). Cell, 111, 241–250.

Acknowledgements We thank Drs WS El-Deiry, B Lu¨scher, P Staller, X-F Wang, G Westin, B Westermark and J Ziegelbauer for reagents. We also thank Dr J Botling, A˚sa Bo¨ker and A Castell for experimental support, and Drs D Balciunas, D Grander, B Lu¨scher, A Moustakas, F O¨berg, H Ronne, C Svensson and G Westin for valuable discussions. This work was supported by grants from the Swedish Cancer Society, Deutsche Forschungsmeinschaft, and Grants PM98-109 and FD97-1987 from the Spanish Government.

References Amati B, Frank SR, Donjerkovic D and Taubert S. (2001). Biochim. Biophys. Acta, 1471, M135–M145. Bahram F, Wu S, Oberg F, Luscher B and Larsson L-G. (1999). Blood, 93, 3900–3912. Bouchard C, Dittrich O, Kiermaier A, Dohmann K, Menkel A, Eilers M and Luscher, B. (2001). Genes Dev., 15, 2042– 2047. Ceballos E, Delgado MD, Gutierrez P, Richard C, Muller D, Eilers M, Ehinger M, Gullberg U and Leon J. (2000). Oncogene, 19, 2194–2204. Cheng T, Rodrigues N, Shen H, Yang Y, Dombkowski D, Sykes M and Scadden DT. (2000). Science, 287, 1804–1808. Claassen GF and Hann SR. (2000). Proc. Natl. Acad. Sci. USA, 97, 9498–9503. Coller HA, Grandori C, Tamayo P, Colbert T, Lander ES, Eisenman RN and Golub TR. (2000). Proc. Natl. Acad. Sci. USA, 97, 3260–3265. Delgado MD, Lerga A, Canelles M, Gomez-Casares MT and Leon J. (1995). Oncogene, 10, 1659–1665. Delgado MD, Vaque JP, Arozarena I, Lopez-Ilasaca MA, Martinez C, Crespo P and Leon J. (2000). Oncogene, 19, 783–790. Eberhardy SR, D’Cunha CA and Farnham PJ. (2000). J. Biol. Chem., 275, 33798–33805. Feng XH, Liang YY, Liang M, Zhai W and Lin X. (2002). Mol. Cell, 9, 133–143. Frank SR, Schroeder M, Fernandez P, Taubert S and Amati B. (2001). Genes Dev., 15, 2069–2082. Gartel AL and Tyner AL. (1999). Exp. Cell Res., 246, 280–289. Gartel AL, Ye X, Goufman E, Shianov P, Hay N, Najmabadi F and Tyner AL. (2001). Proc. Natl. Acad. Sci. USA, 98, 4510–4515. Grandori C, Cowley SM, James LP and Eisenman RN. (2000). Annu. Rev. Cell Dev. Biol., 16, 653–699. Hata A, Seoane J, Lagna G, Montalvo E, Hemmati-Brivanlou A and Massague J. (2000). Cell, 100, 229–240. Herold S, Wanzel M, Beuger V, Frohme C, Beul D, Hillukkala T, Syvaoja J, Saluz H-P, Haenel F and Eilers M. (2002). Mol. Cell, 10, 509–521. Jiang H, Lin J, Su ZZ, Collart FR, Huberman E and Fisher PB. (1994). Oncogene, 9, 3397–3406. James L and Eisenman RN. (2002). Proc. Natl. Acad. Sci. USA, 99, 10429–10434. Larsson L-G, Ivhed I, Gidlund M, Pettersson U, Vennstrom B and Nilsson K. (1988). Proc. Natl. Acad. Sci. USA, 85, 2638–2642.

Oncogene

Levens D. (2002). Proc. Natl. Acad. Sci. USA, 99, 5757–5759. Li LH, Nerlov C, Prendergast G, MacGregor D and Ziff EB. (1994). EMBO J., 13, 4070–4079. Liu M, Lee MH, Cohen M, Bommakanti M and Freedman LP. (1996). Genes Dev., 10, 142–153. McMahon SB, Van Buskirk HA, Dugan KA, Copeland TD and Cole MD. (1998). Cell, 94, 363–374. McMahon SB, Wood MA and Cole MD. (2000). Mol. Cell Biol., 20, 556–562. Missero C, Di Cunto F, Kiyokawa H, Koff A and Dotto GP. (1996). Genes Dev., 10, 3065–3075. Mitchell KO and El-Deiry WS. (1999). Cell Growth Differ., 10, 223–230. O’Hagan RC, Schreiber-Agus N, Chen K, David G, Engelman JA, Schwab R, Alland L, Thomson C, Ronning DR, Sacchettini JC, Meltzer P and DePinho RA. (2000). Nat. Genet., 24, 113–119. Peukert K, Staller P, Schneider A, Carmichael G, Hanel F and Eilers M. (1997). EMBO J., 16, 5672–5686. Ricci AR, Genereaux J and Brandl CJ. (2002). Mol. Cell Biol., 22, 4033–4042. Seoane J, Pouponnot C, Staller P, Schader M, Eilers M and Massague J. (2001). Nat. Cell Biol., 3, 400–408. Sherr CJ and Roberts JM. (1999). Genes Dev., 13, 1501–1512. Staller P, Peukert K, Kiermaier A, Seoane J, Lukas J, Karsunky H, Moroy T, Bartek J, Massague J, Hanel F and Eilers M. (2001). Nat. Cell. Biol., 3, 392–399. Steinman RA, Hoffman B, Iro A, Guillouf C, Liebermann DA and el-Houseini ME. (1994). Oncogene 9, 3389–3396. Steinman RA. (2002). Oncogene 21, 3403–3413. Warner BJ, Blain SW, Seoane J and Massague J. (1999). Mol. Cell Biol., 19, 5913–5922. Wu KJ, Polack A and Dalla-Favera R. (1999). Science, 283, 676–679. Yang W, Shen J, Wu M, Arsura M, FitzGerald M, Suldan Z, Kim DW, Hofmann CS, Pianetti S, Romieu-Mourez R, Freedman LP and Sonenshein GE. (2001). Oncogene, 20, 1688–1702. Zeng YX, Somasundaram K and el-Deiry WS. (1997). Nat. Genet., 15, 78–82. Zezula J, Casaccia-Bonnefil P, Ezhevsky SA, Osterhout DJ, Levine JM, Dowdy SF, Chao MV and Koff A. (2001). EMBO Rep., 2, 27–34. Zhang P, Wong C, Liu D, Finegold M, Harper JW and Elledge SJ. (1999). Genes Dev., 13, 213–224.