Mycologia, 95(2), 2003, pp. 368–373. q 2003 by The Mycological Society of America, Lawrence, KS 66044-8897
Amplified Fragment Length Microsatellites (AFLM) might be used to develop microsatellite markers in organisms with limited amounts of DNA applied to Arbuscular Mycorrhizal (AM) fungi Greg W. Douhan1 David M. Rizzo
highly variable and most are thought to be selectively neutral, making them amendable to population genetic theory. Microsatellite variation can be used to study hybridization, population differentiation (Burg and Croxall 2001), and to indirectly assess levels of gene flow among and within populations (Scribner et al 2001). In addition, some microsatellite loci have been shown to be under selective pressures; examples include triplet repeat loci in humans that cause genetic diseases (Sutherland and Richards 1995) and highly mutable microsatellite tracts that control pathogenicity in bacteria (Moxon et al 1994). Microsatellites also can be used for intraspecific phylogenetic studies (Vander Zwan et al 2000). AM fungi form symbiotic associations with at least 80% of terrestrial plant species (Smith and Read 1997) and are thought to have been important organisms in facilitating the evolution of plants from an aquatic environment to a terrestrial one (Pirozynski and Mallock 1975, Wilkinson 2001). AM fungi promote plant growth by increasing phosphorus uptake, protecting their host plants against soilborne pathogens, and improving soil structure (Smith and Read 1997). Despite their ecological importance, very little is known about the genetic organization or population genetic structure of AM fungi under natural conditions because they are not easily manipulated under laboratory conditions due to their obligate association with the host plant. To study AM fungi under field conditions, individuals are isolated with trap plants or soil is sieved to collect individual spores. The large spores of AM fungi possess hundreds to thousands of individual nuclei, with enough DNA within a single spore to apply PCR-based techniques such as randomly amplified polymorphic DNA (RAPD) (Wyss and Bonfante 1993), amplified fragment length polymorphisms (AFLP) (Rosendahl and Taylor 1997), randomly amplified microsatellite (RAM) (Longato and Bonfante 1997), and M13 minisatellite-primed PCR (Zeze et al 1997). However, these techniques suffer from the effects of contaminating microorganisms on or within the spores, which makes collecting data on multiple loci problematic. Therefore, sequence specific markers, such as microsatellites, are desirable. Microsatellite markers have not been developed for any AM fungus, to our knowledge. The objective
Department of Plant Pathology, University of California at Davis, Davis, California 95616
Abstract: Developing microsatellite markers for organisms with limited amounts of DNA can be difficult because sequence information is needed. To overcome this problem in the arbuscular mycorrhizal (AM) fungi Glomus etunicatum and Gigaspora gigantea, global amplification of the genomes of each species was performed with linker-adaptor-PCR from single spores. Amplified fragments were enriched for microsatellite motifs with 59-biotinylated oligonucleotides and recovered by magnetic streptavidin beads. The recovered fragments were reamplified and separated on denaturing polyacrylamide gels, and 16 selected bands were excised, cloned and sequenced. Seven microsatellite motifs were detected from six clones (efficiency rate of 43.8%). Primers were designed for all putative microsatellite loci and most were successfully amplified from three single-spore preparations and from pools of five, 10 and 20 spores after global amplification. This approach, termed amplified fragment-length micosatellites (AFLM), might aid investigations of organisms that cannot or are not readily cultured in vitro and where DNA is a limiting factor for genetic studies. However, the technique also can be used to isolate microsatellite loci in any organism. Key words: arbuscular mycorrhizal fungi, enrichment techniques, Gigaspora gigantea, Glomus etunicatum, microsatellites, population genetics
INTRODUCTION
Microsatellites quickly are becoming the marker of choice to study gene and genome evolution from the individual to populations or higher-level taxa. Microsatellites are tandemly repeated simple DNA sequences, which are widely dispersed throughout the genomes of eukar yotic and prokar yotic organisms (Tautz et al 1986, Tautz 1993). Microsatellites are Accepted for publication August 31, 2002. 1 Corresponding author, e-mail:
[email protected]
368
DOUHAN
AND
RIZZO: DEVELOPING
of this work was to develop a technique to isolate and detect microsatellite loci in AM fungi from single spores, not to develop a set of specific markers for the AM taxa in this study. To develop this approach, we obtained spores from fresh pot cultures of two AM taxa as model species, one species with small spores (Glomus etunicatum) and another with large spores (Gigaspora gigantea). In our opinion, however, spores derived from monoxenic cultures (Moss and Hepper 1975, Miller-Wideman and Watrud 1985) of isolates collected from an area of interest would be needed to conduct a proper study at the population level. The technique is a modification of the approach used by Hakki and Akkaya (2000), using linker-adaptor-PCR followed by an enrichment step with 59biotinylated oligonucleotide probes and magnetic bead sequence capture. MATERIALS AND METHODS
Genomic amplification. Spores of Glomus etunicatum (UK210A) and Gigaspora gigantea (MN922A) were obtained from INVAM (West Virginia University, Morgantown, WV). The spores were isolated and washed according to INVAMs standard procedures and suspended in sterile H2O. A modification of Rosendahl’s and Taylor’s (1997) AFLP protocol for Glomus spp. was applied to both species to globally amplify the genomes via linker-adapter-PCR. A single spore of each species in three replicates and a pool of five, 10 and 20 spores were placed in a chilled (4 C) microtiter plate containing 5 mL of sterile water. The spores were crushed with fine forceps, followed by the addition of 7.5 mL of sterile water. The solution was transferred to a sterile centrifuge tube and incubated at 100 C for 5 min to inhibit endogenous nuclease activity. DNA was digested with 1.25 U of Eco RI and Tru 91 (Roche, Indianapolis, IN) in the presence of BSA (4.0 mg) and incubated for 1.5 h at 37 C and 1.5 h at 65 C (total volume of 15 mL). Specific adapters were made as described by Vos et al (1995) and ligated onto the ends of the restriction fragments by adding 2.5 mL of ligation mix (5 mM of Eco RI adapter, 50 mM of Tru 9I adapter, 0.25 U of ligase (Invitrogen, Carlsbad, CA), followed by incubation at 37 C for 3 h. The restriction-ligation mixture was diluted (1:1) with TE (10 mM Tris/HCl, pH 8.0, 0.1 mM EDTA) and 10 mL was used as template in a single 1 1 selective amplification reaction using specific Eco RI and Tru 9I primers with the addition of an A and G, respectively, at the 39 end (Vos et al 1995). Each 20 mL reaction contained 1X PCR buffer, 2.5 mM MgCl2, 2.5 mM each dNTP, 0.5 U of Taq polymerase (Invitrogen, Carlsbad, CA) and 3.75 mM of each primer. Thermocycling conditions consisted of an initial hold at 72 C and 94 C for 1 and 4 min, respectively, followed by 35 cycles of 94 C (30 s), 65 C (30 s), and 72 C (1 min) with a final hold of 72 C for 8 min. The amplification products were separated in 1.5% agarose gels and stained with ethidium bromide. All amplifications were performed in a Robocyler Gradient 96 (Strategene, La Jolla, CA). Upon suc-
MICROSATELLITE MARKERS
369
cessful amplification, one single-spore sample from each species was diluted 1:50 in TE and used in subsequent reactions, thus allowing a single spore to be the source of all enrichment procedures as described below. The remaining samples were diluted 1:50 in TE and used in subsequent reactions to detect microsatellite regions from the pool of amplified products. Microsatellite enrichment. The 59-Biotinylated tri-nucleotides (AAT)8, (AAC)8, (CAT)8, (AGC)8, and (CCG)8 (Operon, Alameda, CA) were used in separate reactions to enrich for putative microsatellite-containing regions by adding 5 mL of 11 selective amplification products with 5 mL of each oligonucleotide (25 pmol) in 40 mL of sterile water. The solutions were mixed and heated to 95 C for 8 min, removed from the heating block and allowed to cool to room temperature. Magnetic streptavidin beads (Dynabeads M-280, Dynal Inc., Lake Success, NY) were washed in bulk three times with TE containing 2.0 M NaCl using a Dynal magnetic particle concentrator (Dynal MPC, Dynal Inc., Lake Success, NY) before being resuspended in the same buffer. Fifty mL of the bead solution (100 mg) were added to each enrichment reaction and incubated 20 min at room temperature (total volume 100 mL, final NaCl concentration of 1.0 M). Centrifuge tubes then were placed in the magnetic concentrator and the unbound solution removed with a pipette and washed three times with 100 mL of TE containing 1.0 M NaCl. Sterile H2O (50 mL) was added to each tube, mixed and heated 8–10 min at 100 C to dissociate the streptavidin from the biotin. Each tube was placed back into the magnetic concentrator, and the unbound portion was removed and cleaned with a QIAquick PCR clean-up kit (Qiagen, Valencia, CA). The cleaned and enriched products were eluted with 50 mL of TE, and 10 mL of the solution was used as template in subsequent PCR reactions as described above. Polyacrylamide electrophoresis and selection of putative microsatellites. After amplification, 5 mL of formamide dye (98% formamide, 10 mM EDTA pH 8.0, 0.25% bromphenol blue, 0.25% xylene cyanole) was added to each reaction and the reaction mix was denatured for 5 min at 94 C and cooled on ice. Each sample (3–4 mL) was loaded into every other well and separated on 4% acrylamide gels buffered in TBE (1.35 M Tris/HCl pH 8.0, 0.45 M boric acid, 25 mM EDTA) for about 3 h at 100W in a Bio-Rad Sequi-Gen GT Sequencing Cell (Bio-Rad Laboratories Inc., Hercules, CA). The gels then were silver-stained by the method of Bassam et al (1991) and dried overnight. Selected bands were cut out of the gel, placed in 50 mL of sterile water and incubated at 65 C for approximately an hour or frozen overnight at 220 C before being heated. A subsequent amplification reaction was executed as above with 0.5, 2.5 and 5.0 mL of eluted DNA as template. The amplification products were separated in 1.5% agarose gels, stained with ethidium bromide, and successful PCR amplification products were cleaned with a QIAquick PCR cleanup kit and cloned with a TOPO TA cloning system (Invitrogen, Carlsbad, CA). Positive clones were sequenced at the Division of Biological Sciences sequencing facility (University of California at Davis) using primer T7.
370
MYCOLOGIA were found, primers were designed, flanking the repetitive regions, using the Web-based program Primer3 (http:// www-genome.wi.mit.edu/cgi-bin/primer/primer3pwww.cgi). The adapter sequence with up to nine additional nucleotides at the 39 ends were used as priming sites, along with a primer flanking the microsatellite on three putative loci, because the available sequence was insufficient to make two unique primers. When the adapter sequence was used as part of the primer, a control PCR amplification was done using only that primer.
RESULTS
FIG. 1. Polyacrylamide gel electrophoresis of G. etunicatum amplified fragments after enrichment with the oligonucleotide probes (CCG)8, (CAT)8, (AAC)8, (AGC)8, (AAT)8, in lanes 1–5, respectively. Letters represent fragments that were excised and sequenced. L 5 50 bp ladder (Invitrogen, Carlsbad, CA). Putative AM fungal sequences were identified first by finding the sequences of the flanking adapters. The sequences were edited and perfect microsatellite repeats were identified with the Web-based program Simple Sequence Repeat Identification Tool (SSRT) (http://ars-genome. cornell.edu/cgi-bin/rice/ssrtool.pl); compound and imperfect repeats were sought manually. Once microsatellites
Positive 11 selective amplification resulted in a similar smear of products on agarose in all three singlespore preparations and from the pools of 5, 10 and 20 spores for G. etunicatum and G. gigantea. After the enrichment and reamplification step, the differences among the enrichment probes were clear once they were separated in denaturing polyacrylamide gels, and the bands were easily located and excised for G. etunicatum (FIG. 1) and G. gigantea (data not shown). Many bands appeared to be unique for the individual probes used, and others appeared to be homologous between probes. Both classes of bands were excised from the gel, but bands of similar mobility were not cut out in parallel to check for sequence homology. A total of 16 bands (14 for G. etunicatum and 2 for G. gigantea) were excised from the gel and successfully reamplified. All PCR products were cloned and successfully sequenced, with the exception of Clone H. This band was cloned but the sequence data were ambiguous. Seven microsatellite motifs were detected from six of the 16 cloned fragments (TABLE I), equaling an efficiency rate of 43.8%. The most common motifs were varying trinucleotide repeats. Perfect, imperfect and compound microsatellite motifs were detected with varying repeat lengths and variability after amplification from three single-spore preparations and from pools of five, 10 and 20 spores after global amplification (TABLE I). An example of the polymorphic microsatellite found from clone GleA is shown in FIG. 2. Microsatellites contained in GleA, GleC. GleD-1, GleD-2 and GleL were successfully amplified from all spore preparations, whereas the microsatellite within GigQ was reamplified in only two of the single-spore preparations and from the pool of 10 spores. The microsatellite within GleE did not amplify under the PCR conditions used, and no attempts were made to optimize PCR or design additional primers. In addition, no attempts were made to sequence alleles to confirm allelic identity because this was beyond the scope of our objectives.
DOUHAN TABLE I. Clone
AND
RIZZO: DEVELOPING
371
MICROSATELLITE MARKERS
Summary of microsatellite loci isolated from G. etunicatum (Gle) and G. gigantea (Gig) clones Size (bp)a
Microsatellite motif
GleA
287
(ATA)5…(TAG)3
GleC
501
(ATA)5
GleD-1
463
(TGG)5
GleD-2
463
(TAA)6…(AAC)6(AAT)3
GleE
634
(TTTG)5
GleL
438
(TAT)4…(TGT)3…(TTA)5
GigQ
305
(TTATTATT)11
Primer sequences (59–39)b
Tm (C8)
Product Polymorsizec phicd
GCACAAATGATGCAGAGGTG ATGCATCTGGATGTGGTTTGT CATCTCCTGATGCTGAATCC GGTGATTGGCTTCTTTCTTCC GATGAGTCCTGAGTAAGAATGGTG GCGCCATATTTTCGTCTCAT CAAAACATTGCACCACAACC ATTATACCAAAATTTATTGACCA AGAAAGAAGGGGCTCTCAGG CCCACTGAGCTAGGGTGAAA GATGAGTCCTGAGTAAGCAAAAA TCAAAACATTGCACCACAACCA TGAGTCCTGAGTAAGGAGACAGAA TGGGATATTGGCTGGGTTTA
60
202
yes
60
221
no
60
170
no
52
156
yes
—
—
—
58
312
no
60
245
yes
a
Size of clone containing microsatellite repeat motif. Underlined sequences are from part or all of the adaptor sequences. c Size of PCR product expected from cloned sequence. d Estimated from three single spore preparations and from pools of 5, 10, and 20 spores after linker-adapter PCR amplification. b
DISCUSSION
A simple and efficient technique for detecting microsatellite motifs in single spores of AM fungi was developed. We term the technique amplified fragmentlength microsatellites (AFLM) and propose that this might be a viable approach to study microsatellite variability in organisms in which DNA quantity has
FIG. 2. Polyacrylamide gel electrophoresis of a polymorphic microsatellite locus from clone GleA, amplified from three single-spore preparations and from pools of five, 10 and 20 spores after global amplification, in lanes 1–6, respectively. L 5 10 bp ladder (Invitrogen, Carlsbad, CA).
been a limiting factor for genetic studies. Within the fungi, for example, this technique could be applied to obligate symbionts, such as members of Laboulbeniales or Ustilaginales. This would be a viable approach for fungi, such as some lichen-forming fungi, that grow slowly in culture and do not produce appreciable amounts of biomass. In addition, the enrichment and isolation steps could be used to develop traditional microsatellite markers for any organism, as originally described for wheat by Hakki & Akkaya (2000), and a similar protocol to isolate microsatellites by standard AFLP protocols recently has been described (Zane et al 2002). The efficiency of our approach for detecting microsatellites was 43.8%, which is better than more laborious techniques using biotin-labeled oligonucleotides and magnetic separation. For example, Gardner et al (1999) and Kijas et al (1994) reported efficiency rates of approximately 17% and 20%, respectively, but Gardner et al (1999) had to screen 303 positive clones and Kijas et al (1994) had to develop a genomic library before probing for microsatellite motifs. In this study, only 16 clones were sequenced and no library was constructed. However, the hybridization methods of Gardner et al (1999) and Kijas et al (1994) were such that longer repeats were sought than those in this study, which might explain the lower efficiency rate. The efficiency rate for Hakki and Akkaya (2000) was 13.3%. Another advantage to our approach is the flexibility inherent in the technique. For example, the
372
MYCOLOGIA
amount of amplified products used to investigate might be reduced by increasing the selective nucleotides on the 39 ends of the initial amplification reactions. This might be more effective because fewer fragments would be within the hybridization solution and therefore offer fewer opportunities for nonspecific binding. The size of the product analyzed is also at the discrimination of the investigator because bands are excised directly from the acrylamide gel, which also could be gel purified after reamplification and directly sequenced. It also is possible to use one or both adapter sequences, depending on the size of the fragment recovered, as part of the priming sites because all amplifications are from the pool of fragments. Moreover, traditional hybridization procedures, such as those of Gardner et al (1999) and Kijas et al (1994), also could be employed to increase the specificity of the probe to the target DNA and longer oligonucleotide probes or probes with different repeats lengths also could be used. A potential disadvantage to our approach is the reliance on the global-amplification step because the pool of fragments is used as template in PCR. However, the restriction-ligation step and subsequent PCR amplification by traditional AFLP methods has proven to be robust and therefore should not be a problem. As an alternative, the global-amplification step could be taken by non-linker-adapter PCR techniques once the markers are found with our approach; this might be a viable option for organisms in which insufficient DNA per individual is available for linkeradapter PCR. Genomewide amplification has been demonstrated with as little as 15 pg of human DNA (Cheung and Nelson 1996) and from single sperm cells (Zang et al 1992), using degenerate oligonucleotide primed (DOP) PCR and primer extension preamplification (PEP) PCR, respectively. Another potential drawback is the possibility of null alleles due to the loss of a restriction site or sequence differences within the priming sites. This might explain why only three out of six microsatellites from GigQ were successfully reamplified from single-spore and mixed-spore preparations. However, this is also a potential problem with traditional AFLP, microsatellite and restriction fragment length polymorphism (RFLP) techniques. The most important consideration before AFLMs are developed in AM fungi, or any other organism, is the source of DNA used to develop the markers. This ultimately will depend on the question that is addressed and is especially important for studies of AM fungi because the initial restriction-ligation step does not discriminate between target DNA and DNA from contaminants. Spores of AM fungi collected from the field or from pot cultures will be colonized
inheritantly by other microorganisms (Scannerini and Bonfate 1991, Taber 1982, Bianciotto et al 2000, Redecker et al 1999), for example. The spores for this study came from pot cultures maintained by INVAM and likely were not free of contaminants. Therefore, we are not certain that the microsatellite motifs found were from the target organism. However, the objective of this work was to develop a protocol for the development of microsatellite markers for organisms with limited amounts of DNA, not to develop specific markers in the AM fungi used in this study. Monoxenic cultures would have to be developed for the taxa of interest to minimize the effects of contaminating microbes. Microsatellite markers in AM fungi could prove to be valuable tools in the study of genome organization, such as the genetic heterogeneity in single spores. Heterogeneity within single spores of AM fungi has been tested almost exclusively with rDNA sequences. This involves extensive cloning and sequencing, which is laborious and expensive. With microsatellite variation, it is possible to determine allelic diversity in a single amplification reaction. In addition, no studies have generated unambiguous multilocus genotypic data from any AM fungus. Microsatellites therefore could be important markers to study evolutionary processes of recombination, selection, migration and drift under field conditions. The technique described here, using spores from monoxenic cultures, provides a novel way to detect and study microsatellite variation in AM fungi and should facilitate genetic studies in organisms in which the quantity of DNA is a limiting factor. ACKNOWLEDGMENTS
This project was financed by the NSF Biocomplexity program (DEB 9981711). We thank Dr. Joe Morton from INVAM for providing spores for this study.
LITERATURE CITED
Bassam BJ, Caetano-Anolles G, Gresshoff PM. 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Annals of Biochem 196:80–83. Bianciotto V, Lumini E, Lanfranco L, Minerdi D, Bonfante P, Perotto S. 2000. Detection and identification of bacterial endosymbionts in arbuscular mycorrhizal fungi belonging to the family Gigasporaceae. Appl Environ Microbiol 66:4503–4509. Burg TM, Croxall JP. 2001. Global relationships amongst black-browed and gray-headed albatross: analysis of population structure using mitochondrial DNA and microsatellites. Mol Ecol 10:2647–2660. Cheung VG, Nelson SF. 1996. Whole genome amplification using degenerate oligonucleotide primers allows hun-
DOUHAN
AND
RIZZO: DEVELOPING
dreds of genotypes to be performed on less than one nanogram of genomic DNA. Proc Nat Acad Sci USA 93:14676–14679. Gardner MG, Cooper SJB, Bull CM, Grant WN. 1999. Isolation of microsatellite loci from a social lizard, Egernia tokesii, using a modified enrichment procedure. Heredity 90:301–304. Gianinazzi-Pearson V, van Tuinen D, Dumas-Gaudot E, Dulieu H. 2001. Exploring the genome of glomalean fungi. In: Hock, ed. The Mycota IX, Fungal Associations. Springer-Verlag. p 3–17. Hakki EE, Akkaya MS. 2000. Microsatellite isolation using amplified fragment length polymorphism markers: no cloning, no screening. Mol Ecol 9:2152–2154. Kijas JMH, Fowler JCS, Garbett CA, Thomas MR. 1994. Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. Biotechniques 16:657–662. Kuhn G, Hijri M, Sanders IR. 2001. Evidence for the evolution of multiple genomes in arbuscular mycorrhizal fungi. Nature 414:745–748. Longato S, Bonfante P. 1997. Molecular identification of mycorrhizal fungi by direct amplification of microsatellite regions. Mycol Res 101:425–432. Miller-Wideman MA, Watrud LS. 1984. Sporulation of Gigaspora margarita on root cultures of tomato. Can J Micro 30:642–646. Moss B, Hepper C. 1975. Vesicular-arbuscular mycorrhizal infections in root-organ cultures. Phys Plant Pathol 5: 215–223. Moxon E, Rainy P, Nowak M, Lenski R. 1994. Adaptive evolution of highly mutable loci in pathogenic bacteria. Curr Biol 4:24–33. Pirozynski KA, Malloch DW. 1975. The origin of land plants; a matter of mycotropism. Biosytems 6:153–164. Redecker D, Hijri M, Dulieu H, Sanders IR. 1999. Phylogenetic analysis of a dataset of fungal 5.8s rDNA sequences shows that highly divergent copies of internal transcribed spacers reported from Scutellospora castane are of Ascomycete origin. Fung Gen Biol 28:238–244. Rosendahl S, Taylor JW. 1997. Development of multiple genetic markers for studies of genetic variation in arbuscular mycorrhizal fungi using AFLPy. Mol Ecol 6:821– 829. Sanders IR, Alt M, Groppe K, Boller T, Wiemken A. 1995. Identification of ribosomal DNA polymorphisms among and within spores of the Glomales: application
MICROSATELLITE MARKERS
373
to studies on the genetic diversity of arbuscular mycorrhizal fungal communities. New Phytol 130:419–427. ———, Clapp JP, Wiemken A. 1996. The genetic diversity of arbuscular mycorrhizal fungi in natural ecosystems: a key to understanding the ecology and functioning of the mycorrhizal symbiosis. New Phytol 133:123–134. Scannerini S, Bonfante P. 1991. Bacteria and bacteria-like objects in endomycorrhizal fungi (Glomaceae). In: Margulis L, Fester R, eds. Symbiosis as a source of evolutionary innovation: speciation and morphogenesis. Cambridge, USA: MIT Press. p 273–283. Scribner KT, Petersen MR, Fields RL, Talbot SL, Pearce JM, Chesser RK. 2001. Sex-biased gene flow in spectacled eiders (Anatidae): inferences from molecular markers with contrasting modes of inheritance. Evolution 55: 2105–2115. Smith SE, Read DJ. 1997. Mycorrhizal symbiosis. 2nd ed. San Diego: Academic Press. 605 p. Sutherland G, Richards R. 1995. Simple tandem DNA repeats and human genetic disease. Proc Nat Acad Sci USA 92:3636–3641. Taber RA. 1982. Gigaspora spores and associated hyperparasites in weed seeds in soil. Mycologia 74:1026–1031. Tautz D, Trick M, Dover G. 1986. Cryptic simplicity in DNA is a major source of genetic variation. Nature 322:652– 656. Tautz D. 1993. Notes on the definition and nomenclature of tandemly repetitive DNA sequences. Exs 67:21–28. van der Zwan C, Brodie SA, Campanella JJ. 2000. The intraspecific phylogenetics of Arabidopsis thaliana in worldwide populations. Syst Bot 25:47–59. Vos P, Hogers R, Bleeder M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kulper M, Zabeau M. 1995. AFLP: a new technique for DNA fingerprinting. Nuc Acids Res 23:4407–4444. Wilkinson DM. 2001. Mycorrhizal evolution. Trends Ecol Evo 16:64–65. Wyss P, Bonfante P. 1993. Amplification of genomic DNA of arbuscular-mycorrhizal (AM) fungi by PCR using short arbitrary primers. Mycol Res 97:1351–1357. Zane L, Bargelloni L, Patarnello T. 2002. Strategies for microsatellite isolation: a review. Mol Ecol 11:1–16. Zang L, Cui X, Schmitt K, Hubert R, Navidi W, Arnheim N. 1992. Whole geome amplification from a single cell: implications for genetic analysis. Proc Nat Acad Sci USA 89:5847–5851. Zeze A, Sulistyowati E, Ophel-Keller K, Barker S, Smith S. 1997. Intersporal genetic variation of Gigaspora margarita, a vesicular arbuscular mycorrhizal fungus, revealed by M13 minisatellite-primed PCR. Appl Environ Microbiol 63:676–678.
