Myricetin suppresses lipoteichoic acidinduced ... - Wiley Online Library

Microbiol Immunol 2013; 57: 849–856 doi: 10.1111/1348-0421.12103

O R I GIN A L A R T I C L E

Myricetin suppresses lipoteichoic acid‐induced interleukin‐1b and cyclooxygenase‐2 expression in human gingival fibroblasts Gloria Gutiérrez‐Venegas, Oscar Alonso Luna, Jairo Agustín Ventura‐Arroyo and Cristina Hernández‐Bermúdez Faculty of Dentistry, Division of Graduate Studies and Research, Laboratory of Biochemistry, National Autonomous University of Mexico, Federal District, Mexico D. F. 04510, Mexico

ABSTRACT Periodontitis is an inflammatory disease affecting the connective tissue and supporting bone surrounding the teeth. In periodontitis, human gingival fibroblasts (HGFs) synthesize IL‐1b, causing a progressive inflammatory response. Flavones demonstrate a variety of biological activity: among others, they possess anti‐inflammatory properties. Myricetin is a flavone with a strong anti‐ inflammatory activity. The objective of this study was to evaluate the effect of the flavonoid myricetin on HGFs under inflammatory conditions induced by lipoteichoic acid (LTA). the effect of myricetin on HGFs was assessed by measuring cell viability, signaling pathways and IL‐1b expression and synthesis. It was found that, over time, myricetin did not affect cell viability. However, it inhibited activation of p38 and extracellular‐signal‐regulated kinase‐1/2 in LTA‐treated HGFs and also blocked IkB degradation and cyclooxygenase‐2 and prostaglandin E2 synthesis and expression. These findings suggest that myricetin has therapeutic effects in the form of controlling LTA‐induced inflammatory responses. Key words

interleukin‐1, cyclooxygenase‐2, lipoteichoic acid, protein kinase.

Periodontitis, the commonest inflammatory disease, is caused by microorganisms present in dental bacterial plaque; it affects tooth‐supporting tissue and is characterized by gum inflammation, periodontal ligament rupture and alveolar bone resorption. These pathological processes induce inflammatory responses leading to loss of connective tissue adhesion (1, 2). Human gingival fibroblasts recognize pathogens and synthesize and express inflammatory mediators such as IL‐1b (3), IL‐6 (4), IL‐8 (5) and PGE2 (6). Lipoteichoic

acid is a component of gram‐positive bacterial membranes and acts as a counterpart to LPS in gram‐negative bacteria. LTA is a key factor in the pathogenesis of sepsis (7–10). Human gingival fibroblasts express pathogen‐ recognizing receptors, such as TLRs, which recognize pathogen‐associated molecular patterns. TLR2 interacts with a peptidoglycan (LTA) and lipoproteins expressed in the various microorganisms that make up dental bacterial plaque (10, 11). LTA is associated with heterodimer TLR2/TLR6 receptors expressed in HGFs (12).

Correspondence Gloria Gutiérrez‐Venegas, Faculty of Dentistry, Division of Graduate Studies and Research, Laboratory of Biochemistry, National Autonomous University of Mexico, Distrito Federal, Mexico. Tel/fax: þ52 56225554; email: [email protected] Received 27 June 2013; revised 13 September 2013; accepted 20 September 2013. List of Abbreviations: COX‐2, cyclooxygenase‐2; DMEM, Dulbecco’s modified Eagles’s medium; DMSO, dimethylsulfoxide; ERK, extracellular‐ signal‐regulated kinase; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; HGF, human gingival fibroblasts; JNK, c‐Jun N‐terminal kinase; LTA, lipoteichoic acid; MAPK, mitogen activated protein kinase; MTT, 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐dipenyl tetrazolium bromide; NFkB, nuclear factor kappa B; PGE2, prostaglandin E2.

© 2013 The Societies and Wiley Publishing Asia Pty Ltd

849

G. Gutiérrez‐Venegas et al.

Additionally, LTA induces nitric oxide (13), IL‐1 (14), IL‐2 (15) and IL‐8 (16) in HGFs. Furthermore, it activates MAPK serine/threonine kinases, in particular ERK‐1/2 and p38 (17–19). LTA also activates protein kinase B and promotes NFkB translocation from the cytoplasm to the cell nucleus, activation of b‐catenin, and subsequent expression of cytokines that mediate inflammatory responses (10). The MAPK pathway is involved in cell proliferation, apoptosis, cytokine expression and matrix metalloproteinase expression. The MAPK family comprises p38, JNK and ERK‐1/2. When these proteins are expressed, their active forms remain phosphorylated; they can be detected in osteoblasts (20), osteoclasts (21) and gingival fibroblasts (10). Flavonoids are polyphenol compounds with a wide range of functions in medicine and nutrition. They are an important target in prevention and treatment of chronic diseases associated with inflammatory response (22–25). Cranberries have been used for a long time to prevent and treat periodontal disease (26). Natural medicine utilizes compounds such as those found in green tea and polyphenols obtained from cranberries to prevent and treat inflammatory diseases such as periodontal disease (26). Myricetin (3,30 ,40 ,5,50 ,7‐hexahydroxyflavone) is a flavonoid found in onions, berries and red wine. It is a potent agent with ion‐binding (27), antioxidant (28), antidiabetic (29), antithrombotic (30), anticarcinogenic (31) and cardioprotective effects (32). Other studies have shown that flavonoids affect IL‐1b expression in RAW 264.7 microphages treated with LPS (32, 33). Thus, we designed our study to investigate the effect of myricetin on IL‐1b gene expression in HGFs treated with LTA.

MATERIALS AND METHODS Drugs and solutions Myricetin, purity >96% and LTA obtained from Streptococcus sanguinis was purchased from Sigma–Aldrich (St. Louis, MO, USA). Antibodies against phospho‐ ERK1/2 (Phospho‐Thr202), phospho‐p38 MAPK (Phospho‐Tyr182), p38 MAPK (Ab‐Tyr182), ERK 1/2, p38, COX‐2, and IkB were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Cell culture The HGFs used in this study had been cultured from normal subjects and were grown in DMEM containing 100 U/mL penicillin, 100 mg/mL streptomycin and 10% FBS in a humidified atmosphere of 5% CO2 at 37°C (22). 850

Cell viability assay Cell viability was evaluated by a conventional MTT reduction assay (22). Briefly, HGFs were plated at a density of 106 cells/mL in 96‐well plates for 24 hr, and then exposed to various concentrations of myricetin or/ and LTA, which had been dissolved in serum‐free DMEM medium. After incubation for predetermined times of up to 72 hr, the cells were incubated in MTT solution (0.5 mg/mL) for an additional 4 hr at 37°C. After washing each well with PBS three times, the colored formazan was dissolved in 100 mL of DMSO. Absorption values were read at 570 nm in a microplate reader (Biotek, Winooski, VT, USA), and the cell viability of the DMSO vehicle control group was set at 100%. Each assay was performed sixfold. Nuclear factor kappa B luciferase reporter assay To measure NFkB transcriptional activity, luciferase reporter assay was performed with a luciferase reporter construct pNifty (Invivogen, San Diego, CA, USA). For the assay, cells (1 104) were plated in 24‐well plates and allowed to attach by overnight incubation at 37°C. Transient transfection of the cells were performed using Turbo‐Fect from Fermentas (Glen Burnie, MD, USA) according to the manufacturer’s instructions. After treatment with myricetin or LTA, cells were lysed using a passive lysis buffer (Promega, Madison, WI, USA). Luciferase assays were performed using a dual‐luciferase assay kit according to the manufacturer’s instructions (Promega). Finally, luciferase activities were determined using a luminometer (GloMax 20/20; Promega). The reactive luciferase activity was determined by measuring firefly luciferase activity and normalizing it to protein quantification. Measurements presented are the averages of triplicate samples of two independent experiments. Polymerase chain reaction with reverse transcription Total cellular RNA was isolated from HGFs by the method described by Chomczynski and Sacchi (35). Total cell RNA (1 mg) was reverse‐transcribed using a One‐Step RT‐PCR kit (Invitrogen, Carlsbad, CA, USA). PCR was performed using oligonucleotides 50 ‐GGC TGC AGT TCA GTG ATC GTA CAG‐30 (coding sense) and 50 ‐AGA TCT AGA GTA CCT GAG CTC GCC AGT GAA‐30 (anticoding sense) derived from IL‐1b, 50 ‐TTCAAATGAGATTGTGGGAAAATT GCT‐30 (coding strand) and 50 ‐AGATCATCTCTGCCTGAGTATCTT‐30 (anticoding strand) derived from COX‐2 gene and 50 ‐AGATCCACAACGGATACATT‐30 (anticoding sense) derived from © 2013 The Societies and Wiley Publishing Asia Pty Ltd

Myricetin inhibits LTA actions

the GAPDH gene. Conditions for PCR amplification included denaturing at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1.5 min; PCR was carried out for 35 cycles. RT‐PCR gave rise to a single AGATCT AGA GTA CCT GAG CTC GCC AGT GAA IL‐1 band and a single 309 bp GAPDH band. Fragment identity was characterized by apparent fragment size on ethidium bromide‐stained agarose gels. Three independent experiments were performed for each treatment. Data were analyzed with LabsWorks 4.0 commercial software. Each densitometric value was expressed as mean SD. Western blotting analysis Protein (50 mg) in cell lysate was separated by SDS–PAGE electrophoresis, and then transferred onto a polyvinylidene difluoride membrane. After blocking in 5% fat free milk for 1 hr, the membrane was incubated with antibodies (diluted 1:1000) against p‐p38 MAPK, p38 MAPK, P‐ERK1/2, ERK1/2, IkB and g‐tubulin on an oscillator at 37°C for 2 hr. After washing three times with PBS, the membrane was treated with HRP‐anti‐mouse or HRP‐anti‐rabbit monoclonal antibody (diluted 1:1000) on an oscillator at 37°C for 1 hr. After removing the secondary antibody, the membrane was washed at least five times with PBS, and then developed in ECL (Carlsbad, CA, USA) western blot detection reagents. Assay of interleukin‐1b production Human gingival fibroblasts (1 104 cells) were grown in 6‐well plates for 24 hr before treatment. After washing with PBS (pH 7.4), the cells were pretreated with different doses of myricetin or LTA (15 mg/ ml) at 37°C for 24 hr in DMEM containing 10% (v/v) FBS in an atmosphere of 5% CO2. The culture supernatant was collected and the amount of IL‐1b in the medium determined by ELISA (R & D Systems, Minneapolis, MN USA) in accordance with the manufacturer’s instructions. Statistical analysis Data for MTT, ELISA, and RT‐PCR are expressed as mean SEM, whereas data for western blotting are expressed as mean SD. The significance of differences between LTA and myricetin plus LTA was assessed by Student’s t‐test, whereas differences between LTA induction alone and the drugs experimental groups were performed by ANOVA followed by Tukey’s multiple comparison test using the SPSS16.0 statistical package. For all experiments, P values of less than 0.05 were regarded as statistically significant. © 2013 The Societies and Wiley Publishing Asia Pty Ltd

RESULTS Effect of myricetin on cell viability To determine whether myricetin causes cytotoxicity, HGFs were incubated with serial concentrations of myricetin (1 106 to 1 104 M) for 24, 48 and 72 hr and cell viability determined by MTT assay. No significant change in cell viability was detected in the presence of LTA (Fig. 1a). The cytotoxic effect of myricetin on LTA‐treated HGFs was further investigated. Treatment of HGFs with LTA or myricetin had no influence on the viability of LTA‐treated HGFs (Fig. 1b,c). Effects of myricetin on mitogen activated protein kinase activation in human gingival fibroblasts treated with lipoteichoic acid Each of the three MAPK pathways, ERK, p38 MAPK and JNK, has been demonstrated to participate in LTA‐ induced periodontal disease. To examine the effect on MAPK phosphorylation in LTA‐induced periodontal disease, HGFs were stimulated with LTA and MAPK phosphorylation analyzed by western blotting. Notably, LTA stimulation significantly increased ERK 1/2 and p38 phosphorylation. Myricetin suppressed LTA‐induced phosphorylation of MAPK pathways in a concentration‐dependent manner (Fig. 2). These results demonstrate that myricetin can potentially relieve LTA‐induced periodontal disease by inhibiting the activity of MAPK pathways. Effects of myricetin on IkB degradation and nuclear factor kappa B promoter activation in human gingival fibroblasts treated with lipoteichoic acid Diverse studies have shown that LTA‐induced NFkB activation via IkB degradation in various cells is associated with inflammatory responses. After LTA administration, it was found that IkB degradation was significantly suppressed by myricetin pretreatment in a concentration‐dependent manner. Corresponding to IkB degradation, LTA promoted NFkB activation, and this activation was attenuated significantly by myricetin (Fig. 3). Effects of myricetin on cyclooxygenase‐2 production in human gingival fibroblasts treated with lipoteichoic acid Proinflammatory chemokines and cytokines, including TNF, IL‐1b and the enzyme COX‐2, are the major mediators involved in LTA‐induced periodontal disease. Treatment with LTA increased the amount of COX‐2 851


Fig. 1. Effect of LTA or myricetin on viability of HGF cells. (a) Cells were treated with LTA (15 mg/mL) for 24, 48 and 72 hr. (b) Cells were treated with myricetin (1 106 to 1 104 M) for 24, 48 and 72 hr. (c) Cells were treated with myricetin (1 106 to 1 104 M) followed by incubation with LTA (15 mg/mL) for 24, 48 and 72 hr. Cell viability was determined by MTT assay as described in Material and Methods. Data are presented as percentage of basal SD of three independent experiments by sixfold.

(Fig. 4) in HGFs. This response was attenuated by myricetin in a concentration‐dependent manner (Fig. 4). Given that myricetin reduced COX‐2 expression in HGFs treated with LTA, the effect of myricetin on IL‐1b expression was evaluated. It was found that LTA administration induced IL‐1b expression and myricetin significantly decreased the amount of IL‐1b in a concentration‐dependent manner (Fig. 5). Our experimental data indicate that myricetin pretreatment reduces LTA‐induced inhibition of expression of COX‐2 and IL‐1 by inhibiting MAPK and NFkB activation in HGFs treated with LTA.

DISCUSSION Human gingival fibroblasts are widely distributed throughout the gums and participate in the gum’s 852

immunological response. Activation of HGFs with LPS affects expression of a number of inflammatory products such as TNF‐a, IL‐1b, IL‐6 and nitric oxide (36). In previous studies, we have shown that LTA present in gram‐positive bacteria induces IL‐1b and COX enzyme expression. Our studies also have shown that some flavone‐derived products inhibit COX‐2 expression in addition to inhibiting PGE2 and IL‐1b expression. Similarly, Chang et al. have pointed out that nitric oxide synthase (iNOS) production is mediated by protein kinase A and MAPK p38 in RAW 264.7 cells (34). In addition, Wu et al. have reported that LTA induces COX‐2 synthesis and PGE2 expression via PKC and ERK activation in rat cortical neuron cells (37). Furthermore, Han et al. have demonstrated that iNOS expression is induced in LTA‐treated cells via platelet‐activating factor receptor and Janus kinase 2 (38). © 2013 The Societies and Wiley Publishing Asia Pty Ltd


Fig. 2. Effect of myricetin pretreatment on p38, MAPK and ERK activation in LTA‐treated HGF. Cells were incubated with myricetin (1–15 mM) for 15 min and then treated with LTA (15 mg/mL) for 15 min. Cell lysates were separated in SDS–PAGE gels, transferred to Hybond‐P membranes, and incubated with (a) anti‐phosphorylated ERK1/2 and (b) anti‐phosphorylated‐p38. The results are representative of three separate experiments. SEMs were obtained by densitometry. p < 0.05 versus basal.

Fig. 3. Myricetin inhibits activation of NFkB in LTA stimulated HGF cells. (a) Cells were exposed to myricetin (1–15 mM) for 30 min and then treated with LTA (15 mg/mL) for 60 min. The cell lysates were separated by electrophoresis in SDS–PAGE gels, transferred to Hybond‐P membranes, and immunoblotted with anti‐IkB antibodies. The membranes were stripped and incubated with g‐tubulin. Data are presented as percentage of basal SD of three separate experiments. SEMs were obtained by densitometry. (b) Cells were transfected with 5 mg of luciferase reporter construct pNF‐kB Luc reported plasmid. After 24 hr of transfection, the cells were subcultured in 24‐well plates at a density of 10,000 cells/well and treated with different concentrations of myricetin (1 108 to 1 105) and 15 mg/mL of LTA. The presented data are means SE of three experiments in which each treatment was performed in 24‐well plates. p < 0.05 versus basal.


853


Fig. 4. Flavonoids inhibit LTA effects on transcription and translation of COX‐2 in HGFs. (a) Cells were treated with different doses of myricetin for 30 min and subsequently treated with LTA (15 mg/mL) for 4 hr. Total RNA was extracted and COX‐2 mRNA induction determined by RT‐PCR. GAPDH was used as a control. Densitometric analyses represent the means and SEMs of five separate experiments. (b) Cells were pretreated with different doses of myricetin for 30 min before being treated with LTA (1 mg/mL) for 4 hr. Cellular lysates were processed by SDS–PAGE and membranes blocked and incubated with antibodies that recognized COX‐2. The presented data are means SE of three separate experiments. SEMs were obtained by densitometry. p < 0.05 versus basal.

Our study was designed to determine whether myricetin suppresses IL‐1b expression in HGFs. We found that myricetin inhibits LTA‐induced IL‐1b expression and synthesis in HGFs. These results are

contrary to those reported by Blonska et al. and co‐ workers, who have reported that myricetin inhibits IL‐1b gene expression in macrophage‐derived RAW 264.7 cell lines and, unexpectedly, have also shown that myricetin

Fig. 5. Effect of myricetin on LTA‐induced IL‐1 b expression. (a) HGF cells were cultured in the presence of LTA without or with different concentrations of myricetin for 4 hr. Total RNA was extracted and IL‐1 mRNA induction determined by RT‐PCR. (b) HGFs were placed in 6‐well plates overnight. The cells were treated with different doses of myricetin and LTA (15 mg/mL). IL‐1b was recovered from the culture medium as described in Materials and Method and processed for analysis by ELISA. p < 0.05 versus basal.

854



does not reduce the concentration of this cytokine in the supernatant and cell lysates (33). These authors have also determined that the most active flavonoid is chrysin, which has hydroxyl groups in the A ring. Furthermore, they have demonstrated that adding hydroxyl groups to the C ring (e.g., galangin) and the B ring (e.g., kaempferol, quercetin and myricetin) suppresses cytokine expression. In contrast, we found that treatment with myricetin regulates ERK and p38 activities in HGFs treated with LTA, which concurs with the results of other researchers. Myricetin inhibited IkB in HGFs treated with LTA: these results are similar to those reported by Wu et al. in ECV304 cells. The discrepancy with Blonska et al.’s results may be associated with cell type, they used mouse macrophages and stimulated with LPS and interferon‐gamma, whereas we used GFs from humans. Thus, myricetin may have some therapeutic effect on periodontitis. In this study, we found that myricetin synergically inhibits activation of ERK 1/2 and p38, which are implicated in COX2 and IL‐1b expression. However, we found LTA treatment did not activate JNK. Similar results were obtained by the Aarstad group, which reported that LTA did not induce JNK phosphorylation in human monocytes (22). In addition, myricetin was shown to own anti‐inflammatory activity. Several studies have demonstrated that myricetin inhibits synthesis of the cytokines and kinases involved in the signals associated with apoptosis and death (33, 40). In this study, we found that myricetin inhibits IL1b synthesis and expression. In conclusion, myricetin both inhibits IL‐1b transcription and expression and modulates the effect of LTA in HGFs, thus helping to control the inflammatory response. However, more research is needed to clarify the molecular mechanisms involved in this response.

ACKNOWLEDGMENT This work was supported by Grants from Dirección General de Asuntos del Personal Académico [DGAPA] PAPITT IN209412‐3.

DISCLOSURE The authors do not have any conflict of interest to disclose.

REFERENCES 1. Rajapakse P.S., O’Brien‐Simpson N.M., Slakeski N., Hoffmann B., Reynolds E.C. (2002) Immunization with the RgpA‐Kgp proteinase‐adhesin complexes of Porphyromonas gingivalis protects against periodontal bone loss in the rat periodontitis model. Infect Immun 70(5): 2480–6.


2. Vitkov L., Hannig M., Krautgartner W.D., Fuchs K. (2002) Bacterial adhesion to sulcular epithelium in periodontitis. FEMS Microbiol Lett 211(2): 239–46. 3. Okamura H., Yamaguchi M., Abiko Y. (1999) Enhancement of lipopolysaccharide‐stimulated PGE2 and IL‐1beta production in gingival fibroblast cells from old rats. Exp Gerontol 34(3): 379–92. 4. Into T., Inomata M., Shibata K., Murakami Y. (2010) Effect of the antimicrobial peptide LL‐37 on Toll‐like receptors 2‐, 3‐ and 4‐triggered expression of IL‐6, IL‐8 and CXCL10 in human gingival fibroblasts. Cell Immunol 264(1): 104–9. 5. Tamura M., Tokuda M., Nagaoka S., Takada H. (1992) Lipopolysaccharides of Bacteroides intermedius (Prevotella intermedia) and Bacteroides (Porphyromonas) gingivalis induce interleukin‐8 gene expression in human gingival fibroblast cultures. Infect Immun 60(11): 4932–7. 6. Gutiérrez‐Venegas G., Maldonado‐Frías S., Ontiveros‐Granados A., Kawasaki‐Cárdenas P. (2005) Role of p38 in nitric oxide synthase and cyclooxygenase expression, and nitric oxide and PGE2 synthesis in human gingival fibroblasts stimulated with lipopolysaccharides. Life Sci 77(1): 60–73. 7. De Kimpe S.J., Kengatharan M., Thiemermann C., Vane J.R. (1995) The cell wall components peptidoglycan and LTA from Staphylococcus aureus act in synergy to cause shock and multiple organ failure. Proc Natl Acad Sci USA 92(22): 10359–63. 8. Hauf N., Goebel W., Fiedler F., Sokolovic Z., Kuhn M. (1997) Listeria monocytogenes infection of P388D1 macrophages results in a biphasic NF‐kappaB (RelA/p50) activation induced by lipoteichoic acid and bacterial phospholipases and mediated by IkappaBalpha and IkappaBbeta degradation. Proc Natl Acad Sci USA 94(17): 9394–9. 9. Wang J.E., Jørgensen P.F., Almlöf M., Thiemermann C., Foster S.J., Aasen A.O., Solberg R. (2000) Peptidoglycan and lipoteichoic acid from Staphylococcus aureus induce tumor necrosis factor alpha, interleukin 6 (IL‐6), and IL‐10 production in both T cells and monocytes in a human whole blood model. Infect Immun 68(7): 3965–70. 10. Gutiérrez‐Venegas G., Cardoso‐Jiménez P. (2011) Lipoteichoic acid promotes nuclear accumulation of b‐catenin via AKT in human gingival fibroblasts. Int Immunopharmacol 11(9): 1278–84. 11. Damen J.J., Exterkate R.A., ten Cate J.M. (1995) Lipoteichoic acid inhibits remineralization of artificial subsurface lesions and surface‐softened enamel. J Dent Res 74(10): 1689–94. 12. Henneke P., Morath S., Uematsu S., Weichert S., Pfitzenmaier M., Takeuchi O., Müller A., Poyart C., Akira S., Berner R., Teti G., Geyer A., Hartung T., Trieu‐Cuot P., Kasper D.L., Golenbock D.T. (2005) Role of lipoteichoic acid in the phagocyte response to group B streptococcus. J Immunol 174(10): 6449–55. 13. Jungi T.W., Valentin‐Weigand P., Brcic M. (1999) Differential induction of NO synthesis by gram‐positive and gram‐negative bacteria and their components in bovine monocyte‐derived macrophages. Microb Pathog 27(1): 43–53. 14. Bornstein S.R., Zacharowski P., Schumann R.R., Barthel A., Tran N., Papewalis C., Rettori V., McCann S.M., Schulze‐Osthoff K., Scherbaum W.A., Tarnow J., Zacharowski K. (2004) Impaired adrenal stress response in Toll‐like receptor 2‐deficient mice. Proc Natl Acad Sci USA 101(47): 16,695–700. 15. Granucci F., Feau S., Angeli V., Trottein F., Ricciardi‐Castagnoli P. (2003) Early IL‐2 production by mouse dendritic cells is the result of microbial‐induced priming. J Immunol 170(10): 5075–81. 16. Bucki R., Byfield F.J., Kulakowska A., McCormick M.E., Drozdowski W., Namiot Z., Hartung T., Janmey P.A. (2008) Extracellular gelsolin binds lipoteichoic acid and modulates

855


17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

856

cellular response to proinflammatory bacterial wall components. J Immunol 181(7): 4936–44. Schröder N.W., Pfeil D., Opitz B., Michelsen K.S., Amberger J., Zähringer U., Göbel U.B., Schumann R.R. (2001) Activation of mitogen‐activated protein kinases p42/44, p38, and stress‐ activated protein kinases in myelo‐monocytic cells by Treponema lipoteichoic acid. J Biol Chem 276(13): 9713–9. Gutiérrez‐Venegas G., Bando‐Campos C.G. (2010) The flavonoids luteolin and quercetagetin inhibit lipoteichoic acid actions on H9c2 cardiomyocytes. Int Immunopharmacol 10(9): 1003–9. Lin C.H., Kuan I.H., Wang C.H., Lee H.M., Lee W.S., Sheu J.R., Hsiao G., Wu C.H., Kuo H.P. (2002) Lipoteichoic acid‐induced cyclooxygenase‐2 expression requires activations of p44/42 and p38 mitogen‐activated protein kinase signal pathways. Eur J Pharmacol 450(1): 1–9. Ryu B., Qian Z.J., Kim S.K. (2010) Purification of a peptide from seahorse, that inhibits TPA‐induced MMP, iNOS and COX‐2 expression through MAPK and NF‐kappaB activation, and induces human osteoblastic and chondrocytic differentiation. Chem Biol Interact 184(3): 413–22. Yang J., Ryu Y.H., Yun C.H., Han S.H. (2009) Impaired osteoclastogenesis by staphylococcal lipoteichoic acid through Toll‐like receptor 2 with partial involvement of MyD88. J Leukoc Biol 86(4): 823–31. Gutiérrez‐Venegas G., Contreras‐Sánchez A. (2013) Luteolin and fisetin inhibit the effects of lipopolysaccharide obtained from Porphyromonas gingivalis in human gingival fibroblasts. Mol Biol Rep 40(1): 477–85. Gutiérrez‐Venegas G., Jiménez‐Estrada M., Maldonado S. (2007) The effect of flavonoids on transduction mechanisms in lipopolysaccharide‐treated human gingival fibroblasts. Int Immunopharmacol 7(9): 1199–210. Gutiérrez‐Venegas G., Kawasaki‐Cárdenas P., Arroyo‐Cruz S.R., Maldonado‐Frías S. (2006) Luteolin inhibits lipopolysaccharide actions on human gingival fibroblasts. Eur J Pharmacol 541(1–2): 95–105. Kim Y.P., Yamada M., Lim S.S., Lee S.H., Ryu N., Shin K.H., Ohuchi K. (1999) Inhibition by tectorigenin and tectoridin of prostaglandin E2 production and cyclooxygenase‐2 induction in rat peritoneal macrophages. Biochim Biophys Acta 1438(3): 399–407. Bodet C., Piché M., Chandad F., Grenier D. (2006) Inhibition of periodontopathogen‐derived proteolytic enzymes by a high‐ molecular‐weight fraction isolated from cranberry. J Antimicrob Chemother 57(4): 685–90. Mladěnka P., Macáková K., Filipský T., Zatloukalová L., Jahodář L., Bovicelli P., Silvestri I.P., Hrdina R., Saso L. (2011) In vitro analysis of iron chelating activity of flavonoids. J Inorg Biochem 105(5): 693–701. Hagenacker T., Hillebrand I., Büsselberg D., Schäfers M. (2010) Myricetin reduces voltage activated potassium channel currents

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

in DRG neurons by a p38 dependent mechanism. Brain Res Bull 83(5): 292–6. Ong K.C., Khoo H.E. (2000) Effects of myricetin on glycemia and glycogen metabolism in diabetic rats. Life Sci 67(14): 1695– 705. Fusi F., Sgaragli G., Saponara S. (2005) Mechanism of myricetin stimulation of vascular L‐type Ca2þ current. J Pharmacol Exp Ther 313(2): 790–7. Kim W., Yang H.J., Youn H., Yun Y.J., Seong K.M., Youn B. (2010) Myricetin inhibits Akt survival signaling and induces Bad‐ mediated apoptosis in a low dose ultraviolet (UV)‐B‐irradiated HaCaT human immortalized keratinocytes. J Radiat Res 51(3): 285–96. Zern T.L., Wood R.J., Greene C., West K.L., Liu Y., Aggarwal D., Shachter N.S., Fernandez M.L. (2005) Grape polyphenols exert a cardioprotective effect in pre‐ and postmenopausal women by lowering plasma lipids and reducing oxidative stress. J Nutr 135(8): 1911–7. Blonska M., Czuba Z.P., Krol W. (2003) Effect of flavone derivatives on interleukin‐1beta (IL‐1beta) mRNA expression and IL‐1beta protein synthesis in stimulated RAW 264.7 macrophages. Scand J Immunol 57(2): 162–6. Chang Y.C., Li P.C., Chen B.C., Chang M.S., Wang J.L., Chiu W.T., Lin C.H. (2006) Lipoteichoic acid‐induced nitric oxide synthase expression in RAW264.7 macrophages is mediated by cyclooxygenase‐2, prostaglandin E2, protein kinase A, p38 MAPK, and nuclear factor‐kappaB pathways. Cell Signal 18(8): 1235–43. Chomczynski P., Sacchi N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate‐phenol‐chloroform extraction. Anal Biochem 162(1): 156–9. Kent L.W., Rahemtulla F., Hockett R.D., Jr, Gilleland R.C., Michalek S.M. (1998) Effect of lipopolysaccharide and inflammatory cytokines on interleukin‐6 production by healthy human gingival fibroblasts. Infect Immun 66(2): 608–14. Wu H.H., Hsieh W.S., Yang Y.Y., Tsai M.C. (2006) Lipoteichoic acid induces prostaglandin E(2) release and cyclooxygenase‐2 synthesis in rat cortical neuronal cells: involvement of PKCepsilon and ERK activation. Life Sci 79(3): 272–80. Han S.H., Kim J.H., Seo H.S., Martin M.H., Chung G.H., Michalek S.M., Nahm M.H. (2006) Lipoteichoic acid‐induced nitric oxide production depends on the activation of platelet‐ activating factor receptor and Jak2. J Immunol 176(1): 573–9. Olsnes C., Olofsson J., Aarstad H.J. (2011) MAPKs ERK and p38, but not JNK phosphorylation, modulate IL‐6 and TNF‐a secretion following OK‐432 in vitro stimulation of purified human monocytes. Scand J Immunol 74(2): 114–25. Lee Y.S., Choi E.M. (2010) Myricetin inhibits IL‐1beta‐induced inflammatory mediators in SW982 human synovial sarcoma cells. Int Immunopharmacol 10: 812–4.
