Noggin Enhances Dopamine Neuron ... - Wiley Online Library

EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS Noggin Enhances Dopamine Neuron Production from Human Embryonic Stem Cells and Improves Behavioral Outcome After Transplantation into Parkinsonian Rats SHUNMEI CHIBA,a,b,c YOUNG MOOK LEE,a,b,c WENBO ZHOU,a,b,c CURT R. FREEDa,b,c a

Division of Clinical Pharmacology, bDepartment of Medicine, and cNeuroscience Program, University of Colorado Health Sciences Center, Denver, Colorado, USA

Key Words. Parkinson’s disease • Fetal cell transplantation • Mesencephalon • 6-Hydroxydopamine • Amphetamine • Apomorphine • Circling behavior

ABSTRACT Symptoms of Parkinson’s disease have been improved by transplantation of fetal dopamine neurons recovered from aborted fetal tissue, but tissue recovery is difficult. Human embryonic stem cells may provide unlimited cells for transplantation if they can be converted to dopamine neurons and survive transplantation into brain. We have found that the bone morphogenic protein antagonist Noggin increased the number of dopamine neurons generated in vitro from human and mouse embryonic stem cells differentiated on mouse PA6 stromal cells. Noggin effects were seen with

either early (for mouse, days 0 –7, and for human, days 0 –9) or continuous treatment. After transplant into cyclosporinimmunosuppressed rats, human dopamine neurons improved apomorphine circling in direct relation to the number of surviving dopamine neurons, which was fivefold greater after Noggin treatment than with control human embryonic stem cell transplants differentiated only on PA6 cells. We conclude that Noggin promotes dopamine neuron differentiation and survival from human and mouse embryonic stem cells. STEM CELLS 2008;26:2810 –2820

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION Parkinson’s disease (PD) is a common neurodegenerative disease affecting more than 1% of the population over age 65 [1]. Fetal dopamine (DA) neuron transplantation is a promising therapy for PD. A double-blind, controlled clinical trial by our group has demonstrated beneficial effects of bilateral putamenal implantation of fetal grafts, including improvement in Unified Parkinson’s Disease Rating Scale motor ‘‘off’’ scores and increased [18F]DOPA uptake [2]. The difficulty in acquiring and standardizing fetal tissue has made large-scale clinical trials impossible. Embryonic stem (ES) cells may provide an unlimited source for cell transplantation if cells can be selectively differentiated to DA neurons. Two methods have been used. Coculture with the mouse PA6 stromal cell line has been shown by Kawasaki et al. to induce neural differentiation of mouse and monkey ES cells [3, 4]. We and others have found that PA6 cells can induce tyrosine hydroxylase (TH)-positive neurons from human ES cells [5–7]. Our laboratory noted that striatal astrocytes had neural-inducing activity [5] similar to that of mouse stromal cell lines [8] and human amniotic tissue [9]. Neural induction can also take place by exposure of ES cells to vitamin B12 and heparin [10].

A second method allows spontaneous differentiation of ES cells by withdrawing mouse fibroblast feeder cells and leukemia inhibitory factor (LIF). In floating cultures, ES cells spontaneously aggregate to form embryoid bodies that contain ectoderm, endoderm, and mesoderm [11, 12]. Selective expansion and differentiation can bias the cells toward a dopaminergic phenotype [11]. DA neurons derived from human and nonhuman ES cells have been shown to functionally integrate into host tissue and produce some behavioral recovery in rat and monkey models of PD [13–20]. Although the methods described above can generate relatively high percentages of TH-positive neurons from human embryonic stem (hES) cells in vitro, those cells fail to survive in host brain efficiently [16 –19]. As a result, improvement in motor deficits of PD has been limited. The fact that survival of ES cell-derived dopamine neurons appears to be worse than that of fetal mesencephalic cells suggests that the TH-positive phenotype may be unstable after transplant [16]. Roy et al. have described differentiation of hES cells to dopamine neurons on immortalized midbrain astrocytes with transplantation into Parkinsonian rats, leading to improvement in circling behavior [20]. Growth of neural tumor masses from transplanted cells led to questions about whether the surviving dopamine neurons or the growing tumor mass produced the behavioral effects [21]. Clearly, future strategies must effec-

Author contributions: S.C.: conception and design, financial support, collection of data, data analysis, manuscript writing, final approval of manuscript; Y.M.L. and W.Z.: collection of data, data analysis, final approval of manuscript; C.R.F.: conception and design, financial support, administrative support, provision of study material, data analysis, manuscript writing, final approval of manuscript. Correspondence: Curt R. Freed, M.D., University of Colorado Health Sciences Center, Box C237, 4200 East Ninth Avenue, Denver, Colorado 80262, USA. Telephone: 303-315-8455; Fax: 303-315-3272; e-mail: [email protected] Received February 12, 2008; accepted for publication August 16, 2008; first published online in STEM CELLS EXPRESS September 4, 2008. ©AlphaMed Press 1066-5099/2008/ $30.00/0 doi: 10.1634/stemcells.2008-0085

STEM CELLS 2008;26:2810 –2820 www.StemCells.com

Chiba, Lee, Zhou et al.

2811

tively induce dopamine neurons and then purify those cells to eliminate tumor formation. In an effort to improve the conversion of ES cells to phenotypically stable dopamine neurons, we have studied the effects of the bone morphogenic protein (BMP) antagonist Noggin, which was discovered in the Spemann organizer [22]. Noggin is known to promote neural differentiation from ectoderm (reviewed in [23]) and to serve as a rostral induction factor for the developing brain [24]. If Noggin effects are blocked by early treatment with BMP-4, there is a dramatic decrease in the number of neuroprogenitors generated from ES cells. BMPs are expressed in the dorsal aspect of the neural tube [25]. Sonic hedgehog (Shh), a ventralizing signal, is necessary to promote ventral cell fates throughout the length of the neural tube, from spinal motor neurons to hindbrain serotonergic neurons and to midbrain dopamine neurons [26, 27]. In the absence of Noggin, there is a progressive loss of early, Shh-dependent ventral cells despite the normal expression of Shh in the notochord [24]. Noggin may have a specific role in establishing and maintaining midbrain dopamine cells, since Noggin mRNA is expressed at a 10-fold higher level in the substantia nigra of the adult brain compared with other forebrain regions [28]. We have chosen to use the BG01V hES cell line, which is a triple trisomy with the karyotype 49, XXY, ⫹12, ⫹17 and which has a faster growth rate than euploid hES cells, with a doubling time of approximately 24 hours. Zeng et al. have shown that these cells can differentiate to DA neurons on PA6 cells [7]. We have transplanted differentiated cell clusters into the unilateral 6-hydroxydopamine (6-OHDA)-lesioned rat model of Parkinson’s disease with methods similar to those used previously in our laboratory [29 –31]. In parallel with the hES experiments, we have used mouse embryonic stem (mES) cells with green fluorescent protein (GFP) knocked in to the sox-1 neuroprogenitor locus [32].

MATERIALS

AND

METHODS

Embryonic Stem Cell Culture The CJ7 mouse ES cell line and the NIH-registered BG01V human ES cell line were used. mES cells were cultured on murine embryonic fibroblast feeders with the following mouse maintenance medium: Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 15% ES cell qualified fetal bovine serum; nonessential amino acids (NEAA); pyruvate, penicillin/streptomycin/L-glutamine (PSL; Invitrogen, Grand Island, NY, http://www.invitrogen. com); and 0.1 mM ␤-mercaptoethanol with 104 units/ml mouse LIF. hES cells were cultured by the methods of American Type Culture Collection (Manassas, VA, http://www.atcc.org), with minor modifications. DMEM/Ham’s F-12 medium was supplemented with 20% knockout serum replacement, NEAA, pyruvate, PSL, and 0.1 mM ␤-mercaptoethanol with 4 ng/ml basic fibroblast growth factor. We used 0.5 ␮g/ml collagenase type 2 to passage hES cells. Experiments with hES cells in rats were conducted within the guidelines of the National Academy of Sciences and approved by the Institutional Animal Care and Use Committee of the University of Colorado Denver.

Induction of DA Neurons Single ES cells were plated onto PA6 cells and were cultured for up to 14 days for mES cells and 21 days for hES cells [3–5]. Noggin was added to media on several time schedules. Because earlier work had shown that Noggin had optimal dose-related effects on rostral neuron induction at a concentration of 500 ng/ml, that concentration was used in all experiments [33]. In preliminary experiments, we tested BMP-4 for antagonism of Noggin effects. BMP-4 (10 ng/ml) disrupted PA6 cell adhesion and caused cultures to fail. In cultures that survived, BMP-4 eliminated the typical neural rosette appear-

www.StemCells.com

ance. These overriding effects prevented a more subtle, systematic study of the interactions between Noggin and BMP-4 in our experiments.

Immunocytochemistry Cell cultures were fixed with 4% paraformaldehyde for 30 minutes and then stained for ␤III tubulin (1:200; Promega, Madison, WI, http://www.promega.com), engrailed-1 (1:250; Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com), pitx3 (1:250; Zymed, South San Francisco, http://www.zymed.com), and TH (1:500; Pel-Freez, Rogers, AR, http://www.pelfreez-bio.com). Primary antibody localization was performed by using goat anti-rabbit and anti-mouse IgG conjugated to fluorescein isothiocyanate (FITC; 1:300; Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com) or Alexa 488 (1:300; Chemicon, Temecula, CA, http://www.chemicon.com) and goat anti-mouse IgG conjugated to Texas Red (1:300; Jackson Immunoresearch Laboratories) or Alexa 594 (1:300; Chemicon). Control protocols for primary and secondary antibodies revealed neither nonspecific staining nor antibody cross-reactivity.

Semiquantitative Polymerase Chain Reaction Total RNA was extracted from cell samples using Trizol (Invitrogen). RNA samples (2 ␮g) were reverse transcribed with the use of random primers (SuperScript III First-Stand kit; Invitrogen). The resultant cDNA was amplified by polymerase chain reaction (PCR; GeneAmp PCR System 9600; PerkinElmer Life and Analytical Sciences, Norwalk, CT, http://www.perkinelmer.com). For amplification of cDNA encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), engrailed-1 (en1), lmx1a, nurr1, and pitx3, the following forward (F) and reverse (R) primer sequences were generated to unique sequences of the target mRNA using the Primer3 program (http://frodo.wi.mit.edu/ cgi-bin/primer3/primer3_www.cgi).

Mouse Primers Mouse primers were as follows: GAPDH: F, ACCACAGTCCATGCCATCAC; R, TCCACCACCCTGTTGCTGTA; engrailed-1: F, TCAAGACTGACTCACAGCAACCCC; R, CTTTGTCCTGAACCGTGGTGGTAG; Nurr1: F, TGAAGAGAGCGGACAAGGAGATC; R, TCTGGAGTTAAGAAATCGGAGCTG; Pitx3: F, AGGACGGCTCTCTGAAGAA; R, TTGACCGAGTTGAAGGCGAA.

Human Primers Human primers were as follows: GAPDH: F, ACAGTCAGCCGCATCTTCTT; R, TTGATTTTGGAGGGATCTCG; engrailed-1: F, CCCTGGTTTCTCTGGGACTT; R, GCAGTCTGTGGGGTCGTATT; Nurr1: F, ATGCCTTGTGTTCAGGCGCAG; R, AGCCTTTGCAGCCCTCACAGGTG; Pitx3: F, GTGGGTGGAGAGGAGAACAA; R, TTCCTCCCTCAGGAACAATG.

Mouse and Human The mouse and human primer was as follows: Lmx1a: F, GAGACCACCTGCTTCTACCG; R, ATAGTCCCCTTTGCAGAGCA. Optimal amplification reaction mixes for all primer pairs consisted of 50 mM MgCl2, 10 mM dNTP, 25 ␮M each primer, 0.75 U of Biolase Taq polymerase (Bioline, Randolph, MA, http://www. bioline.com), and 1.0 ␮l of template DNA in a 25-␮l final reaction volume. Samples were amplified using the following profile: initial 5 minutes of denaturation at 95°C; followed by 35 cycles of denaturation (95°C, 30 seconds), annealing (58°C, 30 seconds), and extension (72°C, 60 seconds); and a final extension time of 3 minutes at 72°C. The results of electrophoresis with ethidium bromide were analyzed by the Gel Logic 200 Imaging system (Kodak, Rochester, NY, http://www.kodak.com) for calculations of the intensity of each band.

Western Blots Whole cells in 24-well plates were collected by scraping and centrifugation. The pellets were lysed with 50 mM Tris-HCl, 10 mM NaCl, 1% Triton X, proteinase inhibitor cocktail (⫻100), and 100 mM phenylmethylsulfonyl fluoride. Five-microgram samples were

2812

boiled with sample buffer and loaded into wells of polyacrylamide gels. Gels were run at 140 V for 60 minutes, and proteins were then transferred to nitrocellulose membrane using 100 V for 2 hours. The membrane was incubated in 15% skim milk in phosphate buffered Saline-Tween 20 for 1 hour. Protein was visualized with primary antibodies to ␤III tubulin (1:1,000), TH (1:1,000), and ␤-actin (1:4,000; Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com). Incubations were for 2 hours at room temperature. Secondary antibodies consisted of peroxidase-conjugated goat anti-mouse IgG and donkey anti-rabbit IgG (1:5,000; Jackson Immunoresearch Laboratories) with 1 hour of incubation at room temperature. An enhanced chemiluminescence kit (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com) was used to visualize the bands with x-ray film. The same membrane was used for all analyses, with stripping between analyses.

Fluorescence-Activated Cell Sorting Sox1-GFP knock-in mES cells (a gift from Austin Smith) were used for detection of neuroprogenitors [32]. Differentiated colonies containing sox1-GFP-positive neuroprogenitor cells were separated from the PA6 layer as intact colonies using 0.05% trypsin for 3 minutes, dissociated to single cells, and passed through a 40-␮m cell strainer (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com) to remove cell aggregates. GFP-positive cells and GFP-negative cells were counted by fluorescence-activated cell sorting (FACS; FACScan; Becton Dickinson).

Transplantation into Lesioned Rats To confirm that TH⫹ dopamine neurons derived from hES cells were functional, cells were transplanted into unilateral 6-OHDAlesioned male Fisher 344 rats using a lesioning and transplantation protocol that our laboratory has published previously [29 –31]. 6-OHDA (5 mg/ml; Sigma-Aldrich) was injected in two sites in 4 ␮l into the left side of the medial forebrain bundle (coordinates from bregma: anterior-posterior (AP), 2.1 and 4.3; lateral (L), 2.0 and 1.8; vertical (V), ⫺7.8 and ⫺8) of anesthetized male Fisher 344 rats (220 –240 g). Sixteen days after injection, rats were selected by methamphetamine-induced circling (5 mg/kg i.p.; Sigma-Aldrich) contralateral to the side of the lesion. Only rats that circled ⬎2.5 rpm in a flat-bottomed cylinder were chosen for transplant or sham surgery. This circling rate is associated with ⬎90% depletion of striatal DA [29]. To select differentiated hES cells for transplant, we took advantage of the fact that, in vitro, colonies that developed more than 31 TH⫹ DA cells were morphologically distinct from non-TH⫹ cell colonies. Therefore, the colonies without TH⫹ cells could be manually selected and removed on days 8 –10 using confocal microscopy. On culture day 16, colonies were transplanted after preincubation with the neurotrophic factors insulin-like growth factor-1 (1,500 ng/ml), basic fibroblast growth factor (100 ng/ml), and glial-derived neurotrophic factor (50 ng/ml) for 2 hours to increase survival of DA neurons. Our prior work with fetal mesencephalic tissue has shown that this treatment doubles the survival of transplanted cells [30, 31]. PA6 layers with hES colonies were then peeled from dishes, and hES colonies were separated with multiple pipetting. Because hES colonies sank rapidly by gravity, they were separated from floating PA6 cells by 3g separations and supernatant washes. For transplantation, 600 colonies containing approximately 106 cells were placed in 6 ␮l of liquid Matrigel at 4°C (BD Biosciences, San Diego, http://www.bdbiosciences.com) for 2 minutes and were transplanted into left striatum (coordinates of injection from bregma: AP, 0; L, 3; V, ⫺7.5). Injection was done as the needle was slowly withdrawn from V ⫺7.5 to V ⫺3.5. Shamoperated rats were injected with the same volume of Matrigel. All rats received daily cyclosporin (20 mg/kg i.p. for first 2 weeks and 10 mg/kg thereafter) (Sandiummune; Novartis, Hanover, NJ, http:// www.novartis.com).

Behavioral Testing Before transplantation and 2 and 4 weeks after transplantation, circling behavior was tested by injection of 3 mg/kg i.p. apomor-

Noggin Enhances Dopamine Neuron Production phine. Circling to 5 mg/kg i.p. methamphetamine was tested before transplantation and at 4 weeks after transplantation. Both directions of rotation were counted by a computerized rotometer system for 90 minutes after injection. Only data for the last 60 minutes were used for statistical analysis.

Immunohistochemistry Rats were sacrificed 4 weeks after transplantation with an overdose of isoflurane followed by cardiac perfusion with cold heparinized saline and 4% paraformaldehyde in buffer. Brains were removed and placed in 4% paraformaldehyde for additional fixation. Tissue was cryoprotected in 30% sucrose, and brain sections were cut at 40-␮m intervals on a cryostat and processed for TH immunoreactivity with primary rabbit anti-TH antibody (Pel-Freez) using previous published methods [29 –31]. Diaminobenzadine (DAB) reaction product with nickel enhancement identified the TH-positive cells and their processes. All TH-positive cells in transplant tracks were counted and counts corrected according to the Abercrombie method [34]. To confirm that the cells in the transplant tracks were human in origin and to look for the presence of undifferentiated hES cells, additional microscopy was done with dual immunofluorescent staining using mouse anti-human nuclear protein (hNu; 1:200; Chemicon), rabbit anti-TH (1:300), and goat anti-oct4 (1:100; Santa Cruz Biotechnology). Secondary antibodies included goat antimouse IgG conjugated to Alexa 594, goat anti-rabbit IgG conjugated to Alexa 488, and donkey anti-goat IgG conjugated to Alexa 488 (1:300; Chemicon). Photomicrographs were taken using a Nikon E600 fluorescent microscope (Nikon, Kanagawa, Japan, http:// www.nikon.com) and a confocal microscope (Carl Zeiss, Feldbach, Switzerland, http://www.zeiss.com) to ensure that nuclear and cytoplasmic markers were colocalized.

Statistical Analysis Apomorphine circling rates prior to transplant were compared with rates measured 2 and 4 weeks after transplant for all three surgical groups using repeated measurement analysis of variance (ANOVA) and Tukey-Kramer post hoc testing. Comparison of dopamine cell survival in the PA6 alone versus PA6 plus Noggin groups was by Student’s t test.

RESULTS Noggin Treatment of Mouse Embryonic Stem Cells mES cells were transferred to dishes preplated with PA6 cells with or without Noggin treatment and cultured for 14 days prior to immunostaining. In either the presence or absence of Noggin, mES cells generated ␤III tubulin-TH double-positive cells (Fig. 1A–1C). More specific markers of dopamine neurons, engrailed 1 and pitx3, showed that Noggin significantly changed the fate of mES cells compared with culture on PA6 cells alone. Figure 1D–1F shows TH and en1 dual-labeled cells, and Figure 1G–1I shows TH and pitx3 double-labeled cells. Colonies containing these double-labeled cells were counted, and the results of the TH-pitx3 analysis are shown in Figure 1K. Noggin treatment for either days 2–7 or days 2–14 produced three times as many colonies with TH-pitx3 double-positive cells compared with cultures on PA6 alone (p ⬍ .05). Dual labeling of TH-en1 cells produced similar results (data not shown). To see whether Noggin changed the number of neuroprogenitor cells, mES cells with GFP knocked in to the sox1 gene were differentiated, FACS-sorted, and counted. Results show that Noggin treatment for either days 0 –7 or days 0 –14 did not change the fraction of cells that were sox1⫺GFP⫹. As shown in Figure 1J, the fraction of total cells that were GFP⫹ declined from day 6 to day 14 even as the absolute number of GFP⫹ cells increased. This result demonstrates that the neuroprogenitor population continued to expand even as differentiated cells increased at a faster rate.


2813

Figure 1. Differentiation of Noggin-treated mouse embryonic stem (mES) cells on PA6 cells. mES cells were cultured on a substrate of PA6 cells alone or with added 500 ng/ml Noggin. (A–I): Noggin-treated colonies. (A–C): Coexpression of the neuronal marker ␤III tubulin and the dopamine marker TH. (D–F): Dual labeling of dopamine neurons with antibodies to TH and En1. (G–I): Dopamine neurons dual-labeled with TH and pitx3. Scale bars ⫽ 80 ␮m (A–C) and 30 ␮m (D–I). (K): Noggin treatment either early, D2–D7, or throughout differentiation, D2–D14, substantially increased the number of colonies with pitx3 and TH double-positive cells. PA6 refers to culture with PA6 alone. N 2–7: Noggin treatment from D2 to D7 on PA6. N 2–14: Noggin treatment from D2 to D14 on PA6 substrate. ⴱ, p ⬍ .05. Error bars represent SEM. To assess the effect of Noggin on neural stem cell induction, Sox1-green fluorescent protein (GFP) knock-in mES cells were differentiated in the same protocols used above. Cells were sorted by fluorescence-activated cell sorting, and the fraction of sox1-GFP⫹ cells was analyzed as shown in (J): E, PA6 (PA6 alone); ‚, N 0 –7 (Noggin treatment from D0 to D7 on PA6); ⫻, N 0 –14 (Noggin treatment from D0 to D14 with PA6). Results show that Noggin did not affect differentiation of mES cells to neuroprogenitors. Abbreviations: D, day; En1, engrailed-1; N, Noggin treatment; TH, tyrosine hydroxylase.

Single mES cells differentiated on PA6 cells led to colonies with distinctive morphology that contained various numbers of TH-positive cells, from zero to many. To provide a semiquantitative assessment of the number of TH⫹ cells, the colonies were classified into one of four categories: category 1, 0 TH⫹ cells; category 2, 1–10 cells; category 3, 11–30 cells; and category 4, ⱖ31 TH⫹ cells per colony. This method yielded more information than the simple ‘‘positive’’ or ‘‘negative’’ classification used by other groups. Assignment to each category could be made with precise counting. Because nearly every colony had at least one TH⫹ neuron, whether treated with Noggin or not, the discriminating part of the scale was in the higher counts. This method can be applied to other differentiation conditions, including embryoid body formation, as shown in supplemental online Figure 3B. www.StemCells.com

Using this classification, Figure 2 presents the time course of Noggin effects. Noggin led to a significant increase in the number of TH⫹ cells per colony in treatment intervals at days 2– 4, 4 – 6, and 0 –14. The largest effect was seen with treatment for days 4 – 6, which tripled the number of category 4 colonies, with more than 30 TH⫹ cells per colony, and reduced by half the category 1 colonies, with zero TH⫹ cells. Continuous treatment for days 0 –14 was not significantly better.

Noggin Treatment of Human Embryonic Stem Cells The triple trisomy human cell line BG01V was used. hES cells cultured either on PA6 cells alone or PA6 cells with added Noggin produced TH⫹ colonies that coexpressed ␤III tubulin (Fig. 3A–3F). As with mES cells, colony morphology under

2814

Noggin Enhances Dopamine Neuron Production

Figure 2. Time course of Noggin induction of dopamine neurons from mouse embryonic stem cells. N 0 –2 means Noggin was in the media for days 0 –2 after plating on PA6 cells. N 0 –14 means Noggin was applied throughout the 14-day culture. Colonies were graded for the number of TH⫹ cells. Category 1: dotted columns, no TH⫹ neurons in the colony; category 2: light gray columns, 1–10 TH⫹ neurons in the colony; category 3: dark gray columns, 11–30 TH⫹ neurons in the colony; category 4: black columns, ⱖ31 TH⫹ neurons in the colony. Data are represented as normalized values compared with results on PA6 alone. Results show that Noggin added for days 4 – 6 produces the largest effect on dopamine neuron differentiation. Mean and SEM are presented from three independent experiments. Statistical significance: ⴱ, p ⬍ .01; ⴱⴱ, p ⬍ .05. Abbreviations: N, Noggin treatment; TH, tyrosine hydroxylase.

phase contrast microscopy was variable, as was the number of TH⫹ cells per colony. Certain morphologic features predicted more abundant TH⫹ cells. Colonies that were smaller, more circular, and with a flattened appearance were more likely than others to be category 4, with more than 30 TH⫹ cells per colony. Rosette patterns were sometimes but not invariably seen. Supplemental online Figure 1 provides photomicrographs demonstrating this morphology. Similar to the findings in mouse ES cells, Noggin increased differentiation of human ES cells to the TH-positive phenotype. Because preliminary experiments showed that BG01V cells had maximum differentiation to TH-positive neurons by 21 days in culture compared with 14 days for mouse ES cells, Noggin treatment windows were expanded to 4 days’ duration. Using the same grading scale used for mouse ES cells, Noggin treatment for days 4 – 8 nearly tripled the number of TH⫹ cellenriched colonies and reduced the number of colonies with zero TH⫹ cells (p ⬍ .05, both comparisons vs. control PA6 alone; Fig. 3G). Continuous treatment with Noggin for days 0 –21 produced results similar to days 4 – 8, as shown in Figure 3G. To provide additional evidence of the magnitude of the Noggin effect on TH⫹ induction, another experiment was performed with Noggin treatment for days 0 – 8. All TH⫹ colonies on plates were photographed and analyzed for TH-FITC fluorescence intensity using Adobe Photoshop (Adobe Systems Inc., San Jose, CA, http://www.adobe.com). Details of this method are presented in supplemental online Figure 4. Results show that Noggin treatment doubled the fluorescence intensity of TH⫹ colonies (Noggin, 6,892 ⫾ 67 units; PA6 alone, 3,334 ⫾ 114 units; p ⬍ .01) without increasing the average size of each colony (Noggin, 36.8 ⫾ 4.2; PA6, 34.9 ⫾ 2.6 pixel units) compared with PA6 alone. Noggin did increase the fraction of the total colonies that had at least some TH⫹ cells (Noggin, 91.3% ⫾ 2.1%; PA6, 80.2% ⫾ 2.6%; p ⬍ .03).

blotting, and results are shown in Figure 4. Identical volumes of cell lysate were loaded into gels, and the levels of TH and ␤III tubulin proteins were analyzed with the appropriate antibodies and normalized to actin levels (gels are shown in Fig. 4A). Although there were differences in the magnitude of Noggin effects on mouse compared with human ES cells, Noggin significantly increased the amount of ␤III tubulin protein in human ES cells and showed a similar trend in mouse ES cells (Fig. 4B, 4C). More striking was the increase in TH protein relative to actin (Fig. 4D, 4E) and relative to ␤III tubulin, indicating that greater proportions of both mouse and human neurons were TH-positive (Fig. 4F, 4G).

Noggin Treatment Increases Total Neurons and TH-Positive Neurons by Western Blot

Behavioral Effects After Transplanting Dopamine Neurons Derived from Human ES Cells

For additional quantitative evaluation, Noggin effects on mouse and human ES cell differentiation were analyzed by Western

As shown in Figure 6A, by 4 weeks after transplantation, animals that received differentiated hES cells treated with Nog-

Noggin Treatment Increases Engrailed-1 in Mouse and Human ES Cells by PCR Assay To look for evidence of Noggin induction of midbrain-specific dopamine neurons, we compared the mRNA expression pattern of midbrain markers en1 [35], lmx1a [36], nurr1 [37], and pitx3 [37, 38] after Noggin treatment or on PA6 cells alone using semiquantitative PCR. ES cells were plated on PA6 cells and treated with Noggin for days 0 –7 for mES cells and days 0 –9 for hES cells. PCR was performed on days 7 and 14 for mouse and days 9 and 21 for human cells. Sample PCR gels are shown in Figure 5A. Measurements of multiple PCR gels showed that Noggin significantly increased en1 gene expression during the time of Noggin treatment (on day 7 for mES and day 9 for hES; p ⬍ .01). Other DA neuron markers, such as lmx1a, nurr1, and pitx3, were unaffected by Noggin treatment, as were the positional markers otx2, pax2, pax6, and hoxd4 (data not shown). Although quantitative real-time PCR could offer more precise measurement of the upregulation of en1 and other genes, that equipment was not available to us. An earlier report showing Noggin-induced increases in en1 in mES cells by semiquantitative PCR gives us additional confidence that observations we have made in human and mouse ES cells are correct [33].


2815

Figure 3. Time course of Noggin induction of dopamine neurons from human embryonic stem cells. (A–F): Photomicrographs of human embryonic stem cell colonies differentiating on PA6 cells in the presence of 500 ng/ml Noggin. Cultures were fixed and immunostained for TH and ␤III tubulin after 21 days in culture. (A–C): Phase contrast and TH-fluorescein isothiocyanate immunostaining of the same colonies. Colonies highly enriched in TH⫹ cells had strong green fluorescence. Those with few TH⫹ cells (white arrows) had a different appearance by phase contrast and could be manually removed during the culture process. The neuronal identity of the TH⫹ neurons is shown by dual labeling with ␤III tubulin (D–F). Scale bars ⫽ 350 ␮m (A, B), 80 ␮m (C), and 40 ␮m (D–F). (G): The time interval at which Noggin had the greatest effect on dopamine phenotype. N 0 – 4 means Noggin added from day 0 to day 4, and N 0 –21 means Noggin was present throughout the differentiation process. Data are represented as normalized values compared with PA6 alone and are the means and SEM of three independent experiments. Statistical significance: ⴱ, p ⬍ .01; ⴱⴱ, p ⬍ .05. Abbreviations: N, Noggin treatment; TH, tyrosine hydroxylase.

gin had a significant reduction in apomorphine circling compared with sham surgery controls and compared with animals transplanted with cells differentiated on PA6 alone. Animals with sham surgery had no change in circling behavior, and animals with cells differentiated on PA6 cells alone had partial recovery (ANOVA: Noggin vs. sham, p ⬍ .01; Noggin vs. PA6 alone, p ⬍ .05; Tukey-Kramer: Noggin vs. sham, p ⬍ .05; Noggin and PA6, n ⫽ 8; PA6 alone, n ⫽ 7; sham control, n ⫽ 8).

Histological Analysis of Transplanted Animals Animals were sacrificed 4 weeks after transplantation. After fixation, brains were sectioned and processed for TH immunoreactivity. Results are shown in Figure 6B. Animals receiving hES cells treated with Noggin had five times more TH⫹ cells in the transplant tracks than did animals with cells differentiated on PA6 alone. The increased number of surviving dopamine neurons had behavioral consequences, as shown in Figure 6C. Plotting the number of surviving TH⫹ cells against the improvement in apomorphine circling shows a significant correlation between the number of TH⫹ cells and the reduction in www.StemCells.com

apomorphine circling (r ⫽ 0.496; r2 ⫽ 0.246; p ⬍ .02). For transplants treated with Noggin, cell survival correlated with reduction in apomorphine circling, whereas cells differentiated on PA6 alone had so few TH⫹ cells surviving that there was no correlation with behavior (Noggin, r ⫽ 0.608, r2 ⫽ 0.37, p ⫽ .012; PA6, r ⫽ 0.095, r2 ⫽ 0.009, p ⫽ .74). Animals with more than 500 TH⫹ cells showed nearly complete reversal of apomorphine circling. Testing with methamphetamine was also performed at 4 weeks after transplant. There were no changes in methamphetamine circling at this time. Because we terminated our behavioral experiments 4 weeks after transplant, there may not have been sufficient time for slowly developing human dopamine neurons to induce changes in amphetamine-induced circling as seen in earlier experiments using fetal human mesencephalic tissue [31, 39, 40]. Because all grafts produced large tumor masses, as noted below, apomorphine circling changed in direct proportion to the surviving TH⫹ neurons and not to tissue mass. This result indicates that there was sufficient dopamine released from the transplanted nerve terminals to relieve the postsynaptic dopamine receptor supersensitivity in the denervated rat striatum.

2816


Figure 4. Noggin treatment increases both total neurons and TH⫹ neurons as measured by Western blotting. Quantitative protein analysis of neuronal ␤III tubulin and the dopamine neuron protein TH were measured for mES and hES cells differentiated on PA6 alone or PA6 with Noggin 500 ng/ml. A typical gel is shown in (A). mES cells were differentiated for 14 days, with Noggin applied for days 4 –7 or days 0 –14. hES cells were differentiated for 21 days, with Noggin applied for days 5–9 or days 0 –21. ␤III tubulin data were normalized to ␤-actin levels (B, C). TH protein values are expressed relative to ␤-actin (D, E) and relative to ␤III tubulin (F, G). Results showed that Noggin increased TH protein relative to total protein (D, E) and relative to neuronal protein (F, G) for both mouse and human cells. Mean and SEM of five samples for each treatment are shown. Statistical significance: ⴱ, p ⬍ .01; ⴱⴱ, p ⬍ .05. Abbreviations: hES, human embryonic stem; mES, mouse embryonic stem; TH, tyrosine hydroxylase.

To confirm that the 6-OHDA lesions were complete in all animal groups, TH⫹ neurons in the substantia nigra were counted for every animal, and the number of neurons on the lesioned side was expressed as a percentage of the number on the intact side. Only neurons in the A9 region were counted, not the A10 ventral tegmental area neurons. In all groups, the lesioned side showed a depletion of approximately 90% in DA neurons (Noggin, 87.9% ⫾ 2.5%; PA6, 90.8% ⫾ 2.1%; sham, 87.4% ⫾ 4.6%). There were no group differences. Lesioned striatum of all groups showed substantially reduced TH immunoreactivity compared with the intact side, despite the surviving TH⫹ neurons in the transplanted striatum (Fig. 7A, 7B). All transplants derived from hES cells produced cell overgrowth in the lesioned rat striatum (Fig. 7A–7D). The large grafts had homogeneous morphology (Fig. 7K–7M) and were oct4-negative, indicating that the grafts did not contain undifferentiated hES cells (data not shown). The cell masses had features of neural lineage, with the majority expressing ␤III

tubulin (Fig. 7K, 7M) and not glial fibrillary acidic protein (Fig. 7L, 7M), indicating that the cells were neurons rather than astrocytes. Nearly all of the TH⫹ cells were found at the boundary between the grafts and the striatum (Fig. 7A, 7E–7J). All TH⫹ cells were human in origin, as shown by coexpression of human nuclear antigen (hNu⫹; Fig. 7N–7R). These TH and hNu dual-positive cells had long neurites projecting into host striatum (Fig. 7Q, 7R). In hES cells differentiated on PA6 cells without Noggin treatment, the TH⫹ cells seen in the transplant were also hNu-positive. The overall mass of BIII tubulin-hNupositive cells was similar in animals receiving cells with and without Noggin treatment, indicating that tissue mass alone did not correlate with behavioral improvement. Efforts to perform immunofluorescence for TH with GIRK2 and/or en1 were unsuccessful because of high background fluorescence in the tissue mass of the transplanted striatum. Dual staining of TH and en1 after Noggin treatment was successful after in vitro differentiation, as shown in supplemental online Figure 2. TH⫹ cell


2817

Figure 5. Noggin increases En1 in mouse embryonic stem (mES) and human embryonic stem (hES) cells as measured by semiquantitative polymerase chain reaction (PCR). mES and hES cells were cultured on PA6 cells with and without Noggin for 14 D for mouse and 21 D for human. Noggin was added for D0 –D7 for mouse and D0 –D9 for human. Semiquantitative PCR was performed at D7 and D14 for mouse and D9 and D21 for human. Representative gels are shown in (A) for dopamine (DA)-related genes En1, lmx1a, nurr1, and pitx3 and the housekeeping gene GAPDH for mES and hES cells. Results show that Noggin appeared to increase En1 at mD7 and hD9. In (B) and (C), results of multiple PCRs are shown. For mES cells, En1 was significantly increased after 7 days of incubation with Noggin (D7 N) but not at 14 days (D14 N). Similar results were seen for hES cells after 9 days of Noggin treatment (D9 N) but not at the end of the experiment (D21 N). None of the other DA markers was changed by Noggin. Open columns, PA6 alone on day 7 for mES cells and day 9 for hES cells; gray columns, Noggin treatment with PA6 on day 7 for mES and day 9 for hES; dotted columns, PA6 alone on day 14 for mES and day 21 for hES; black columns, Noggin treatment with PA6 on day 14 for mES and day 21 for hES. Data are mean and SEM of three samples per treatment. Statistical significance: ⴱ, p ⬍ .01. Abbreviations: D, day; En1, engrailed 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hD, day for human; mD, day for mouse; N, Noggin treatment.

Figure 6. Behavioral improvement is related to dopamine neuron survival in animals receiving transplants of differentiated human embryonic stem (hES) cells. Immunosuppressed male Fisher 344 rats each received transplants of 600 colonies of hES cells differentiated for 16 days on PA6 cells alone or PA6 cells with 500 ng/ml Noggin for days 2–9 in culture. Transplants were placed in a single site in striatum of unilaterally dopamine-denervated animals. Sham surgery animals had only vehicle injected into brain. Apomorphine circling contralateral to the lesioned and transplanted side was evaluated prior to surgery as well as 2 and 4 weeks after transplant and is expressed as percentage of baseline circling for each animal. (A): Animals that were transplanted with Noggin-treated cells had an 80% reduction (improvement) in apomorphine circling by 4 weeks after transplant. Animals receiving cells differentiated on PA6 alone had a 40% reduction in circling, whereas sham-surgery animals had no change in circling. 〫, sham control (n ⫽ 8); 䡺, PA6 alone (n ⫽ 7); ‚, Noggin treatment from day 2 to day 9 with PA6 (n ⫽ 8). Mean and SEM are shown. Statistical significance (analysis of variance): ⴱ, p ⬍ .01; ⴱⴱ, p ⬍ .01. (B): Effect of Noggin on dopamine cell survival. After sacrifice, immunohistochemical analysis of TH⫹ dopamine neurons in striatal transplant tracks showed significantly more TH⫹ dopamine neurons in animals receiving cells treated with Noggin. Statistical significance (t test): ⴱⴱⴱ, p ⬍ .001. Mean and SEM are shown. (C): Correlation of the reduction in apomorphine circling with the number of TH⫹ neurons surviving. There was a highly significant correlation between the reduction in circling and greater numbers of dopamine neurons in the transplants. Statistics were as follows: r ⫽ 0.496; r2 ⫽ 0.246; p ⬍ .02 for combined cell counts of animals receiving transplants from hES cells differentiated on PA6 alone or PA6 with Noggin. Abbreviations: Pre, pretreatment; TH, tyrosine hydroxylase.

counts in the transplants were not affected by this artifact since they were done after immunoperoxidase-DAB reaction and white light microscopy.

DISCUSSION We have found that the BMP inhibitor Noggin increases production of dopamine neurons from human embryonic stem cells www.StemCells.com

differentiated on PA6 stromal cells. These dopamine neurons survived transplantation and led to behavioral improvement in parkinsonism rats. Our results also indicate that the tripletrisomy hES cell line BG01V can be used for experimental therapy of Parkinson’s disease in vivo. The mechanism of Noggin appears to be to increase differentiation of mouse and human ES cells to TH-positive dopamine neurons by an action early in cell specification at the neuroprogenitor stage, even without increasing the total number of neuroprogenitors. Noggin

2818


Figure 7. Histological analysis of differentiated human embryonic stem (hES) cell TSs. Representative sections of ST of unilateral 6-hydroxydopamine-lesioned animals transplanted with hES cells differentiated on PA6 cells with or without Noggin. (A): Noggin-treated TS in lesioned (left) and intact (right) sides of ST with sections processed for TH-immunoreactivity and peroxidase-DAB secondary reaction. (B): ST after sham surgery. No TH⫹ cells were seen. (C, D): Human nuclear antigen immunostaining to demonstrate the large tumor-like grafts that were seen in all TS tracks of all animals receiving grafts differentiated on PA6-Noggin (C) or PA6 alone (D). (E–J): Higher-magnification views of the Noggin-treated graft shown in (A). TH⫹ neurons were found around the periphery of the TS mass. Additional immunostaining showed that neurons were more prominent than glia in the Noggin-treated TSs ([K–M]: ␤III tubulin and GFAP; dashed line shows the boundary between TS and host ST). To show that TH⫹ cells in Noggin-treated grafts were of human origin, colabeling of TH⫹ neurons with hNu was done and examined by confocal microscopy (N–R). (Q, R): Representative higher magnification confocal images of TH-hNu double-positive grafted DA neurons that have extended processes into host ST. The dashed line is the boundary between the TS and ST. Scale bars ⫽ 350 ␮m (A–D), 40 ␮m (E–J), 100 ␮m (K–M), 30 ␮m (N–P, R), and 20 ␮m (Q). Abbreviations: GFAP, glial fibrillary acidic protein; hNu, human nuclear protein; Lat., lateral; Med., medial; N, Noggin treatment; ST, striatum; TH, tyrosine hydroxylase; TS, transplant.

effects were seen with a window of treatment as short as days 4 – 6 for mouse ES cells and days 4 – 8 for human BG01V ES cells. Extending Noggin treatment throughout the differentiation schedule neither increased nor reduced the fraction of cells that became TH-positive, indicating that Noggin acted only in the early stages of differentiation. Chiba et al. reported that early Noggin treatment is important for promoting forebrain fates from mES cells, not for generating neuroprogenitors [33]. Production of authentic midbrain dopamine neurons from ES cells requires early specification of midbrain markers such as en1 and lmx1a. Although attempts at late induction of the midbrain phenotype using Shh and fibroblast growth factor 8 can lead to cells that express TH, these cells do not coexpress many crucial markers for midbrain DA neurons [12, 35–38, 41]. Our results have shown that early Noggin treatment leads to greater expression of en1 by PCR and greater production of pitx3-TH as well as en1-TH double-positive cells, indicating that Noggin may facilitate the midbrain fate. Further evidence for fate specification by Noggin came from our observation that pitx3-TH double-positive cells typically were present only in colonies with gross morphology characteristic of colonies with abundant TH⫹ cells. Early Noggin treatment tripled the number of colonies from both mouse and human ES cells that had morphology typical of TH⫹ cell enrichment. Most remarkably,

Noggin led to a fivefold increase in TH⫹ cells counted in rat striatum after transplantation. Because our colony transplant method does not provide a precise estimate of the number of TH⫹ cells put into brain, we cannot say whether Noggin increased survival after transplant in addition to increasing the number of TH⫹ cells generated from hES cells. The 500% increase in TH⫹ cells counted in rat striatum indicates that Noggin has a potent effect on overall outcome. Noggin has been tested by others for its effect on hES cells and has led to conflicting results. In a report by Ben-Hur et al., Noggin was used in the first stage of differentiation of hES cells to neurospheres [18]. Twelve weeks after transplantation of undifferentiated neurospheres into striatum of 6-OHDA-lesioned rats, the authors found reductions in apomorphine- and amphetamine-induced circling that correlated with the number of dopamine neurons that had spontaneously differentiated from the neurospheres, a number ranging approximately from 100 to 600 TH⫹ cells [18]. A second report by Sonntag et al. used the H7 and H9 human ES cell lines differentiated on mouse MS5wnt1 stromal cells with or without Noggin for 1 or 3 weeks [19]. They found that Noggin increased the number of colonies with neuroprogenitor rosette morphology. Without Noggin, there were few TH⫹ cells. Despite this in vitro success, few TH⫹ cells survived transplantation. One animal with more than 500 TH⫹ cells had nearly complete reversal of circling after am-

Chiba, Lee, Zhou et al. phetamine. They concluded that Noggin effects may be ES cell type-specific. In our hands, Noggin did not increase the number of sox1positive neuroprogenitors but did change the fate of those neuroprogenitors toward midbrain DA neurons. Because PA6 stromal cells push ES cells toward a neuroprogenitor fate, with more than 80% becoming sox1-positive after 6 days’ incubation (Fig. 1J), it is likely that the neural inductive action of Noggin was overshadowed by the PA6 effect in our experiments. We hypothesize that the Noggin-induced increase in midbrain dopamine neurons may be caused by the anti-BMP effects in cells that have been preconditioned with a midbrain identity. Others have found that a pulse of BMP-4 added to hES cells from day 5 to day 9 led to cell fates typical of neural crest derived from dorsal neural tube at neurulation [6]. By blocking BMP effects, Noggin can ventralize this critical stage of neural differentiation [22]. Noggin may have a specific role in determining midbrain dopamine cell fate since Noggin mRNA is expressed at significantly higher levels in the substantia nigra than in other brain regions [28]. Those authors found that mRNAs for Noggin, BMPs, and BMP receptors were decreased after a 6-OHDA lesion of the substantia nigra. It is reasonable to conclude that blockade of BMP signaling by Noggin is important for specification of midbrain DA neurons and may be necessary for their long-term survival. Although many groups have found that PA6 cells provide a useful substrate for neural induction, our laboratory has noted that striatal astrocytes have similar inducing effects [5]. Recently, immortalized mesencephalic astrocytes have been shown to induce a dopamine phenotype from hES cells that survive transplantation but produce neural stem cell tumors [20]. Methods for separating dopamine neurons from residual stem cells must be developed before these cells can be used to treat Parkinson patients.

2819

proliferation, and the fact that they differentiate to midbrain dopamine neurons. Even though they are triple trisomy as a consequence of prolonged in vitro passaging, they appear to produce stable, phenotypically mature dopamine neurons that survive transplantation into a rat model of Parkinson’s disease. Cells with aneuploidy have been used in human therapy without tumor formation [42]. Neurons derived from triple-trisomy hES cells may or may not be suitable for eventual transplantation into patients with Parkinson’s disease. We have found them useful for demonstrating that Noggin has a critical role for determining midbrain dopamine phenotype at an early stage in embryonic stem cell differentiation. An unresolved problem is the purification of dopamine neurons from residual stem cells. To prevent inadvertent transmission of animal proteins or viruses to people, human therapy will require human embryonic stem cells that have never been in contact with animal cells or proteins. None of the cell lines currently approved for NIH funding meet those criteria.

ACKNOWLEDGMENTS This work was supported by grants from the American Parkinson Disease Association and gifts from Charles and Joanne Ackerman and the estate of Raymond Thomason. Preparation of the manuscript was facilitated by a scholarly residency at the Rockefeller Foundation Bellagio Center (C.R.F.). We are grateful to Austin Smith, University of Edinburgh, for the gift of sox1-GFP mES cells and to Bresagen Corporation for giving us BG01V human embryonic stem cells for research use. S.C. is currently affiliated with the Department of Regenerative Medicine, Institute of Advanced Medical Science, St. Marianna University Graduate School of Medicine, Kawasaki, Kanagawa, Japan.

DISCLOSURE

SUMMARY We chose to test Noggin in BG01V triple-trisomy hES cells for their ease in passaging in tissue culture, their relatively rapid

9

2 3 4

5

6 7

8

Ehringer H, Hornykiewicz O. Distribution of noradrenaline and dopamine (3-hydroxytyramine) in the human brain and their behavior in diseases of the extrapyramidal system. Klin Wochenschr 1960;38: 1236 –1239. Freed CR, Greene PE, Breeze RE et al. Transplantation of embryonic dopamine neurons for severe Parkinson’s disease. N Engl J Med 2001; 344:710 –719. Kawasaki H, Mizuseki K, Nishikawa S et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 2000;28:31– 40. Kawasaki H, Suemori H, Mizuseki K et al. Generation of dopaminergic neurons and pigmented epithelia from primate ES cells by stromal cell-derived inducing activity. Proc Natl Acad Sci U S A 2002;99:1580 –1585. Buytaert-Hoefen K, Alvarez E, Freed CR. Generation of tyrosine hydroxylase positive neurons from human embryonic stem cells after coculture with cellular substrates and exposure to GDNF. STEM CELLS 2004;22:669 – 674. Schulz TC, Noggle SA, Palmarini GM et al. Differentiation of human embryonic stem cells to dopaminergic neurons in serum-free suspension culture. STEM CELLS 2004;22:1218 –1238. Zeng X, Chen J, Liu Y et al. BG01V: A variant human embryonic stem cell line which exhibits rapid growth after passaging and reliable dopaminergic differentiation. Restor Neurol Neurosci 2004;22:421– 428. Perrier AL, Tabar V, Barberi T et al. Derivation of midbrain dopamine

www.StemCells.com

CONFLICTS

The authors indicate no potential conflicts of interest.

REFERENCES 1

OF POTENTIAL OF INTEREST

10 11 12 13 14 15 16 17

neurons from human embryonic stem cells. Proc Natl Acad Sci U S A 2004;101:12543–12548. Ueno M, Matsumura M, Watanabe Ket al. Neural conversion of ES cells by an inductive activity on human amniotic membrane matrix. Proc Natl Acad Sci USA 2006;103:9554 –9559. Yamazoe H, Kobori M, Murakami Y et al. One-step induction of neurons from mouse embryonic stem cells in serum-free media containing vitamin B12 and heparin. Cell Transplant 2006;15:135–145. Lee SH, Lumelsky N, Studer L et al. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol 2000;18:675– 679. Yan Y, Yang D, Zarnowska ED et al. Directed differentiation of dopaminergic neuronal subtypes from human embryonic stem cells. STEM CELLS 2005;23:781–790. Kim JH, Auerbach JM, Rodriguez-Gomez JA et al. Dopamine neurons derived from embryonic stem cells function in an animal model of Parkinson’s disease. Nature 2002;418:50 –56. Bjorklund LM, Sanchez-Pernaute R, Chung S et al. Embryonic stem cells develop into functional dopaminergic neurons after transplantation in a Parkinson rat model. Proc Natl Acad Sci U S A 2002;99:2344 –2349. Takagi Y, Takahashi J, Saiki H et al. Dopaminergic neurons generated from monkey embryonic stem cells function in a Parkinson primate model. J Clin Invest 2005;115:102–109. Park CH, Minn YK, Lee JY et al. In vitro and in vivo analyses of human embryonic stem cell-derived dopamine neurons. J Neurochem 2005;92: 1265–1276. Brederlau A, Correia AS, Anisimov SV et al. Transplantation of human embryonic stem cell-derived cells to a rat model of Parkinson’s disease: Effect of in vitro differentiation on graft survival and teratoma formation. STEM CELLS 2006;24:1433–1440.


2820

18 Ben-Hur T, Idelson M, Khaner H et al. Transplantation of human embryonic stem cell-derived neural progenitors improves behavioral deficit in Parkinsonian rats. STEM CELLS 2004;22:1246 –1255. 19 Sonntag KC, Pruszak J, Yoshizaki T et al. Enhanced yield of neuroepithelial precursors and midbrain-like dopaminergic neurons from human embryonic stem cells using the bone morphogenic protein antagonist noggin. STEM CELLS 2007;25:411– 418. 20 Roy NS, Cleren C, Singh SK et al. Functional engraftment of human ES cell-derived dopaminergic neurons enriched by coculture with telomerase-immortalized midbrain astrocytes. Nat Med 2006;12:1259 –1268. 21 Christophersen NS, Brundin P. Large stem cell grafts could lead to erroneous interpretations of behavioral results? [Letter] Nat Med 2007; 13:118. 22 Smith WC, Harland RM. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 1992;70:829 – 840. 23 Sasai Y, De Robertis EM. Ectodermal patterning in vertebrate embryos. Dev Biol 1997;182:5–20. 24 McMahon JA, Takada S, Zimmerman LB et al. Noggin-mediated antagonism of BMP signaling is required for growth and patterning of the neural tube and somites. Genes Dev 1998;12:1438 –1452. 25 Liem KF, Tremmel G, Roelink H et al. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 1995;82:969 –979. 26 Echelard Y, Epstein DJ, St-Jacques B et al. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 1993;75:1417–1430. 27 Ye W, Shimamura K, Rubenstein JL et al. FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 1998;93:755–766. 28 Chen HL, Lein PJ, Wang JY et al. Expression of bone morphogenetic proteins in the brain during normal aging and in 6-hydroxydopaminelesioned animals. Brain Res 2003;994:81–90. 29 Richards JB, Sabol KE, Freed CR. Unilateral dopamine depletion causes bilateral deficits in conditioned rotation in rats. Pharmacol Biochem Behav 1990;36:217–223. 30 Zawada WM, Zastrow DJ, Clarkson ED et al. Growth factors improve immediate survival of embryonic dopamine neurons after transplantation into rats. Brain Res 1998;786:96 –103.

31 Clarkson ED, Zawada WM, Bell KP et al. IGF-I and bFGF improve dopamine neuron survival and behavorial outcome in parkinsonian rats receiving cultured human fetal tissue strands. Exp Neurol. 2001;168: 183–191. 32 Aubert J, Stavridis MP, Tweedie S et al. Screening for mammalian neural genes via fluorescence-activated cell sorter purification of neural precursors from Sox1-GFP knock-in mice. Proc Natl Acad Sci U S A 2003; 100:11836 –11841. 33 Chiba S, Kurokawa MS, Yoshikawa H et al. Noggin and basic FGF were implicated in forebrain fate and caudal fate, respectively, of the neural tube-like structures emerging in mouse ES cell culture. Exp Brain Res 2005;163:86 –99. 34 Abercrombie M. Estimation of nuclear population from microtome sections. Anat Rec 1946;94:239 –247. 35 Simon HH, Saueressig H, Wurst W et al. Fate of midbrain dopaminergic neurons controlled by the engrailed genes. J Neurosci 2001; 21:3126 –3134. 36 Andersson E, Tryggvason U, Deng Q et al. Identification of intrinsic determinants of midbrain dopamine neurons. Cell 2006;124:393– 405. 37 Martinat C, Bacci JJ, Leete T et al. Cooperative transcription activation by Nurr1 and Pitx3 induces embryonic stem cell maturation to the midbrain dopamine neuron phenotype. Proc Natl Acad Sci U S A 2006;103:2874 –2879. 38 Nunes I, Tovmasian LT, Silva RM et al. Pitx3 is required for development of substantia nigra dopaminergic neurons. Proc Natl Acad Sci U S A 2003;100:4245– 4250. 39 Brundin P, Nilsson OG, Strecker RE et al. Behavioural effects of human fetal dopamine neurons grafted in a rat model of Parkinson’s disease. Exp Brain Res 1986;65:235–240. 40 Stro¨mberg I, Bygdeman M, Goldstein M et al. Human fetal substantia nigra grafted to the dopamine-denervated striatum of immunosuppressed rats: Evidence for functional reinnervation. Neurosci Lett 1986;71:271–276. 41 Smidt MP, Burbach JP. How to make a mesodiencephalic dopaminergic neuron. Nat Rev Neurosci 2007;8:21–32. 42 Nelson PT, Kondziolka D, Wechsler L et al. Clonal human (hNT) neuron grafts for stroke therapy: Neuropathology in a patient 27 months after implantation. Am J Pathol 2002;160:1201–1206.

See www.StemCells.com for supplemental material available online.