noncoding Region in Bos taurus and Bos indicus Cattle

C 2005) Biochemical Genetics, Vol. 43, Nos. 7/8, August 2005 (! DOI: 10.1007/s10528-005-6783-1

Note

Nucleotide Sequence Variation in the Transcription Factor STAT5A gene 5" -noncoding Region in Bos taurus and Bos indicus Cattle K. Flisikowski,1 S. Hiendleder,2 and L. Zwierzchowski1,3 Received 20 July 2004—Final 14 October 2004

INTRODUCTION Signal transducers and activators of transcription (STATs) are latent transcription factors present in the cytoplasm of the majority of animal cells. They are activated by phosphorylation and translocated to the nucleus where they induce transcription of target genes (Wheeler et al., 2001). The STAT5 factors mediate actions of a variety of cytokines and peptide hormones, including prolactin and growth hormone (Darnell, 1997). STAT5A, previously known as mammary gland factor (MGF), is the most important transcription factor mediating prolactin action on the expression of milk protein genes (Wakao et al., 1994). STAT5 is also a major mediator of growth hormone (GH) action on target genes (Argetsinger and CarterSu, 1996). The relative importance of GH and prolactin in mammary gland function varies between species with prolactin playing a major role in rodents and GH taking the lead role in ruminants (Flint and Knight, 1997). The phosphorylation of STAT5 factors and their DNA-binding capacity were shown to increase during lactation in the mammary glands of rodents (Liu et al., 1996) and in the rabbit (Malewski et al., 2002). As suggested by Wheeler et al. (1997), significant differences might exist in the biological role of STAT5 transcription factor in controlling lactation between ruminants and rodents. In the bovine mammary gland, levels of STAT5A and STAT5B proteins, their mRNAs, and DNA-binding activity were unaltered during pregnancy and lactation. Data on nucleotide sequence polymorphism in the bovine STAT5A gene are limited and additional polymorphisms are needed to investigate the effect of 1 2

Institute of Genetics and Animal Breeding, Jastrzebiec, 05-552 W´olka Kosowska, Poland. Institute of Molecular Animal Breeding and Biotechnology, Gene Center of the Ludwig-Maximilian University, D-81377 Munich, Germany. 3 To whom correspondence should be addressed; e-mail: [email protected]. 459 C 2005 Springer Science+Business Media, Inc. 0006-2928/05/0800-0459/0 !

460

Flisikowski, Hiendleder, and Zwierzchowski

STAT5A variation on milk production traits in bovine. We have therefore searched for genetic variation in the 5" region of the STAT5A gene in Bos taurus and Bos indicus cattle.

MATERIALS AND METHODS Animals and DNA Isolation Blood samples were collected from unrelated animals representing six B. taurus breeds: Friesian (n = 30), Charolais (n = 18), Limousine (n = 16), Aberdeen Angus (n = 10), Hereford (n = 16), and Simmental (n = 11). A B. indicus breed, the Dwarf Zebu (n = 20), was also represented; that breed was founded with animals from Sri Lanka and the Caucasus region. Analysis of mitochondrial DNA haplotypes (Hiendleder et al., 2003) showed that approximately 60% of the animals carry B. indicus mtDNA. Genomic DNA was isolated from blood leukocytes as described by Kanai et al., 1994. Polymerase Chain Reaction Heteroduplex Analyses The following primers were used to amplify a 361-bp fragment, nt-407 to nt-46, of the STAT5A gene (GenBank acc. no. AY280369): STPR-F, 5" TCCTCCTCCCTTTTGACAGA 3" , STPR2-R, 5" CAGCGATTTCCTCCTCAAAG 3" . Heteroduplex analysis was carried out in 8% polyacrylamide gels with 10% glycerol maintained at a constant temperature of 20◦ C. Ten microliters of PCR product was mixed with 10 µL of denaturation buffer (20% ethylene glycol, 30% formamide, 0.5% dextran blue), denatured for 5 min at 94◦ C, incubated for 60 min at 65◦ C, rapidly chilled on ice, and loaded onto the gels. Electrophoresis was performed at 120 V, 60 mA, 8 W, for 20 h, and the gels were silver stained. DNA Sequencing Primers STPR-F and STPR2-R were used for sequencing. The PCR reaction (12.5 µL) consisted of 50–100 ng genomic DNA, 1.5 mM MgCl2 in PCR buffer, 1.25 µL 1 × Q-Solution, 10 pmol of each primer, 0.25 mM of dNTPs, and 0.25 U of HotStart Taq DNA polymerase (Qiagen, Germany). Cycle conditions for all primer pairs were 15 min at 94◦ C (30 s at 94◦ C, 30 s at 60◦ C, 60 s at 72◦ C) × 30 cycles, and a final extension for 10 min at 72◦ C. The PCR products were purified with QIAquick PCR purification kit (Qiagen), and DNA samples of different PCR-HD patterns were sequenced with ABI Prism BigDye Terminator cycle sequencing kit, using an ABI377 sequencer (Applied Biosystems) and Sequence Analyser 2.01 program.

Nucleotide Sequence Variation in the Transcription Factor STAT5A gene

461

Restriction Fragment Length Polymorphism Analysis The 361 bp PCR products were digested at 37◦ C for 3 h in 10 µL with 10 U of SgrAI, or for 4 h at 25◦ C with 10 U of SmaI restriction nucleases (New England BioLabs). The resulting fragments were analyzed in 2% agarose gels by standard procedures. Computer Analyses A search for polymorphic restriction sites in the 361-bp fragments of the bovine STAT5A gene was performed using the NEBcutter V2.0 software (http://tools.neb.com/NEBcutter2/index.php). The sequenced 5" -noncoding region of the bovine STAT5A gene was analyzed by the TESS program for presence of putative transcription factor (TF) binding sites. Sequences with 100% similarity to TF-binding sites were searched in the TransFac database. Searching for sequences not included in TransFac was performed by the Hibio DNAsis program (Hitachi) as previously described (Malewski, 1998). RESULTS AND DISCUSSION Data on nucleotide sequence polymorphism in the bovine STAT5A gene are limited. McCracken et al. (1997) found a polymorphic TG repeat in intron 12. Antoniou et al. (1999) detected two SSCP variants of the gene fragment that encodes the SH2 domain in bovine STAT5A protein. In previous studies we reported SNPs in exon 7 (nt 6853 GenBank no. AJ237937: C/T), in exon 16 (nt 12743 GenBank no. AJ237937: C/T), a CCT deletion in intron 15 (Flisikowski et al., 2003a, b; Flisikowski and Zwierzchowski, 2003). Additionally, we measured the DNA-binding capacity of different STAT5A variants in exon 16. In all cases nuclear protein derived from CC genotype animals showed lower DNA-binding capacity than those of the other genotypes (Flisikowski et al., 2003a). Recently, we found a polymorphism in the STAT5A promoter region. Using reverse transcription PCR, Real-Time PCR, and Western blotting, we found that the STAT5A expression level in the liver is higher in bulls with the AA genotype than in GG (Flisikowski et al., 2004). Our search for nucleotide polymorphism in the promoter region of the STAT5A gene by heteroduplex (HD) analysis on 121 DNA samples from individuals of six B. taurus and one B. indicus breed identified three different HD patterns (not shown). Sequence analysis of PCR products that yielded different HD patterns revealed two nucleotide substitutions at position −247 (A/G) and at position −226 (G/A). Both SNPs were amenable to PCR-RFLP analysis with the restriction enzymes SgrAI or SmaI. The restriction fragments resulting from digestion of the 361-bp PCR product with SmaI were 302 and 59 bp for genotype

462


Fig. 1. PCR-RFLP detection of nucleotide substitutions in the bovine STAT5A gene. A. RFLP SgrAI. B. RFLP SmaI.

GG; 192, 110, and 59 bp for genotype AA; and 302, 192, 110, and 59 bp for heterozygotes. Digestion with SgrAI resulted in fragments of 361 bp for genotype AA; 217 and 144 bp for genotype GG; and 361, 217, and 144 bp for the heterozygotes (Fig. 1). The sequence of the bovine STAT5A gene 5" region containing the SgrAI and SmaI polymorphisms was deposited in GenBank acc. no. AY280369. In order to establish the STAT5A genotype and allele frequencies for different breeds, we typed 101 B. taurus individuals and 20 B. indicus animals for the new SgrAI and SmaI polymorphisms (Table I). In all B. taurus cattle breeds tested, the GG genotype at the SgrAI site and the AA genotype at the SmaI site were predominant. The SgrAI AA genotype was found in two breeds only, Limousine and Friesian. No SmaI GG genotype was found. The data show a substantial difference in frequency for SgrAI alleles between B. taurus and the analyzed B. indicus breed. The estimated frequency of allele G was 0.88 in European cattle and 0.10 in Zebu cattle. Differences in allele frequency between B. taurus and B. indicus cattle have previously been found in STAT5A. McCracken et al. (1997) identified four alleles of polymorphic TG repeat in intron 12 of STAT5A gene, with allele D found exclusively in B. indicus and allele C much more frequent in Zebu than in European cattle (78% versus 5–8%). The 5" noncoding region of the bovine STAT5A gene was analyzed for sequence homologies with consensus sequences for known transcription factor binding sites. The TESS analysis of the 361-bp fragment, nt-407 to nt-46 of the bovine STAT5A gene, showed that the nucleotide substitutions A → G at position −247 and G → A at −226 (in the GC box) can create new binding sites for E2F-1 and E2F TFs, respectively. Therefore, the polymorphisms detected here could influence transcription factor binding and expression of the STAT5 gene in cattle.

SgrAI Number of animals GG GA AA Allele frequency G A SmaI Number of animals AA AG GG Allele frequency A G

Genotypes or alleles

—

— 0.93 0.07

0.88 0.12

14 2

0.90 0.10

12 3 1

Limousine

—

14 4

0.88 0.12

14 4

Charolaise

—

— 0.85 0.15

7 3

0.95 0.05

9 1

Aberdeen Angus

Breed

— —

— 0.96 0.04

15 1

1.0 —

16

Hereford

— —

— 0.95 0.05

10 1

1.0 —

11

Simmental

— 0.96 0.04

46 4

0.84 0.16

30 16 4

Friesian

—

— — 1.0 —

20

0.1 0.9

4 16

Dwarf Zebu

Table I. Distribution of Genotypes and Alleles of Nucleotide Sequence Polymorphism at SgrAI and SmaI Sites Within the 5" Region on the Bovine STAT5A Gene

Nucleotide Sequence Variation in the Transcription Factor STAT5A gene 463

464


The results of this study can be useful in future studies to assess the effect of STAT5 alleles on production traits in cattle. ACKNOWLEDGMENTS .

We thank Ms. Beata Zelazowska for technical assistance. This study was funded by the Polish Ministry of Scientific Research and Information Technology grants P06D 029 24 and PBZ-KBN-036/P06/12. REFERENCES Antoniou, E., Hirts, B. J., Grosz, M., and Skidmore, C. J. (1999). A single strand conformation polymorphism in the bovine gene STAT5A. Anim. Genet. 30:225–244. Argetsinger, L. S., and Carter-Su, C. (1996). Growth hormone signalling mechanisms: Involvement of the tyrosine kinase JAK2. Horm. Res. 45:22–24. Darnell, J. E. Jr. (1997). STATS and gene regulation. Science 277:1630–1635. Flint, D. J., and Knight, C. H. (1997). Interactions of prolactin and growth hormone (GH) in the regulation of mammary gland function and epithelial cell survival. J. Mammary Gland Biol. Neoplasia 2:41–48. Flisikowski, K., and Zwierzchowski, L. (2003). Polymerase chain reaction-heteroduplex (PCR-HD) polymorphism within bovine STAT5A gene. J. Appl. Genet. 44:185–189. Flisikowski, K., Oprzadek, J., Dymnicki, E., Oprzadek, A., and Zwierzchowski, L. (2003a). New polymorphism in the bovine STAT5A gene and its association with meat production traits in beef cattle. Anim. Sci. Pap. Rep. 21:147–157. Flisikowski, K., Szymanowska, M., and Zwierzchowski, L. (2003b). The DNA-binding capacity of genetics variants bovine STAT5A transcription factor. Cell. Mol. Biol. Lett. 8:831–840. Flisikowski, K., Starzy´nski, R., and Zwierzchowski, L. (2004). Promoter variant-dependent expression of the STAT5A gene in bovine liver. BBA Gene Struct. Expr. 1679:195–199. Hiendleder, S., Zakhartchenko, V., Wenigerkind, H., Reichenbach, H. D., Bruggerhoff, K., Prelle, K., Brem, G., Stojkovic, M., and Wolf, E. (2003). Heteroplasmy in bovine fetuses produced by intra- and inter-subspecific somatic cell nuclear transfer: Neutral segregation of nuclear donor mitochondrial DNA in various tissues and evidence for recipient cow mitochondria in fetal blood. Biol. Reprod. 68(1):159–66. Kanai, N., Fujii, T., Saito, K., and Yokoyama, T. (1994). Rapid and simple method for preparation of genomic DNA from easily obtainable clotted. J. Clin. Pathol. 47:1043–1044. Liu, X., Robinson, G. W., and Hennighausen, L. (1996). Activation of Stat5a and Stat5b by tyrosine phosphorylation is tightly linked to mammary gland differentiation. Mol. Endocr. 10:1496–1506. Malewski, T. (1998). Computer analysis of distribution of putative cis- and trans-regulatory elements in milk protein gene promoters. Biosystems 45:29–44. _ Malewski, T., Gajewska, M., Zebrowska, T., and Zwierzchowski, L. (2002). Differential induction of transcription factors and expression of milk protein genes by prolactin and growth hormone in the mammary gland of rabbits. Growth Horm. IGF Res. 12:41–53. McCracken, J. Y., Molenaar, A. J., Snell, R. J., Davey, H. W., and Wilkins, R. J. (1997). A polymorphic TG repeat present within the bovine STAT5A gene. Anim. Genet. 28:453–461. Wakao, H., Gouilleux, F., and Groner, B. (1994). Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J. 13:2182–2191. Wheeler, T. T., Kuys, Y. M., Broadhurst, M. M., and Molenaar, A. J. (1997). Mammary Stat5 abundance and activity are not altered with lactation state in cows. Mol. Cell Endocr. 133:141–149. Wheeler, T. T., Broadhurst, M. K., Sadowski, H. B., Farr, C. V., and Prosser, G. C. (2001). Stat5 phosphorylation status and DNA-binding activity in the bovine and murine mammary glands. Mol. Cell Endocr. 176:39–48