Oct 10, 1992 - Germany, and 'Department of Life Science, Tokyo Institute of ..... 1 /tg of cold U 1 snRNA to deplete their pool of free snRNP proteins. Thereafter ...
The EMBO Journal vol.12 no.2 pp.573 - 583, 1993
Nucleo-cytoplasmic transport of U snRNPs: definition of a nuclear location signal in the Sm core domain that binds a transport receptor independently of the m3G cap Utz Fischer, Vicki Sumpter, Mitsuo Sekine1, Takahiko Satoh' and Reinhard Luhrmann Institut fir Molekularbiologie und Tumorforschung, PhilippsUniversitat Marburg, Emil-Mannkopff-Strafe 2, D-3550 Marburg, Germany, and 'Department of Life Science, Tokyo Institute of Technology, Nagatsuta, Midori-Ku, Yokohama 227, Japan Communicated by R.Luhrmann
We have investigated the nuclear transport of Ul and U5 snRNPs by microinjection studies in oocytes from Xenopus laevis using snRNP particles prepared by reconstitution in vitro. Competition studies with snRNPs showed that the Sm core domain of Ul snRNPs contains a nuclear location signal that acts independently of the m3G cap. The transport of Ul snRNP can be blocked by saturation with competitor Ul snRNPs or by U5 snRNPs, which indicates that the signals on the respective Sm core domains interact with the same transport receptors. Further, by using a minimal Ul snRNP particle reconstituted in vitro and containing only the Sm core RNP domain and lacking stem -loops I to m of Ul RNA, we show that this is targeted actively to the nucleus, in spite of the absence of the m3G cap. This indicates that under certain conditions the NLS in the Sm core domain not only is an essential, but may also be a sufficient condition for nuclear targeting. We propose that the RNA structure of a given snRNP particle determines at least in part whether the particle's m3G cap is required for nuclear transport or can be dispensed with. Key words: m3G cap/nuclear location signal/nucleo-cytoplasmic transport/transport receptor/U snRNPs
Introduction Macromolecules such as proteins, RNAs and RNA -protein complexes are transported from the cytoplasm to the nucleus through the nuclear pores in a process that requires ATP (Feldherr et al., 1984; Dworetzky and Feldherr, 1988; Newmeyer and Forbes, 1988; Richardson et al., 1988). The transport of karyophilic proteins into the nucleus requires that they contain suitable nuclear location sequences (NLSs)(Garcia-Bustos et al., 1991; Silver 1991). NLSs are both necessary and sufficient for nuclear targeting. Although there is no strict consensus between NLSs from various karyophilic proteins, they are mostly short, basic sequence motifs. The best known sequence is PKKKRKV, from SV40 T antigen, which when coupled to carriers suffices for nuclear targeting (Lanford et al., 1986; Kalderon et al.,
1984a,b). Recently, more complex NLSs have been characterized on various proteins. Nucleoplasmin, for example, has been shown to contain a bipartite NLS that consists of two discrete clusters of basic amino acids separated by 10 amino acids (Robbins et al., 1991). Oxford University Press
Bipartite NLSs may be of general importance for the nuclear targeting of karyophilic proteins (Robbins et al., 1991; Dingwall and Laskey, 1991). Nuclear location sequences are recognized by NLS binding proteins or transport receptors. It is thought that they direct karyophilic proteins to the nuclear pore complex by interacting, directly or indirectly, with the transport apparatus of nuclear pores (Adam et al., 1989; Adam and Gerace, 1991). It is not yet clear whether the transport receptors shuttle between cytoplasm and nucleus, or remain on the cytoplasmic side of the nuclear envelope. Recently, a 54/56 kDa transport receptor has been purified; it stimulates nuclear protein import in vitro (Adam and Gerace, 1991). It is a characteristic feature of mediated nuclear protein transport that the transport receptors can be saturated with NLS -protein conjugates (Goldfarb et al., 1986). The transport of karyophilic proteins has thus been explored in some depth. Much less is known about the transport of RNA and RNA -protein complexes to the nucleus. An attractive system for studying nuclear transport of RNA -protein complexes involves the nucleoplasmic spliceosomal snRNPs U1, U2, U4/U6 and U5 of vertebrates. The snRNAs Ul, U2, U4 and U5 are transcribed by RNA polymerase II, contain a 2,2,7-trimethylguanosine (m3G) cap and share a structural motif, called the Sm site; this site consists of a single-stranded region rich in uridylic acid and flanked by two hairpin loops (Branlant et al., 1982; Liautard et al., 1982; Reddy and Busch, 1988). U6 RNA is an exception, in that it is transcribed by RNA polymerase HI, contains a -y-methylphosphate cap and lacks the Sm site (Reddy and Busch, 1988; Singh and Reddy, 1989). The proteins of the snRNPs fall into two classes: the common and the particle-specific ones. The Sm sites of the snRNAs U1, U2, U4 and U5 each bind a set of the common proteins B', B, D1, D2, D3, E, F and G [also called Sm proteins, because of their reaction with anti-Sm autoantibodies from patients suffering from systemic lupus erythematosus (Lerner and Steitz, 1979)]. In addition to the common core proteins, at least U 1, U2 and U5 snRNPs bind specific proteins (Luhrmann et al., 1990). Ul snRNP, for example, contains three specific proteins 70k, A and C (Bringmann et al., 1983; Liihrmann et al., 1990). Electron microscopy has revealed that the core RNP structures of snRNPs Ul, U2, U4 and U5 are morphologically very similar and can be described as a round body 8 nm in diameter (Kastner et al., 1990). This core RNP structure of the snRNPs will hereinafter be termed the Sm core domain. The morphogenesis of the snRNPs Ul, U2, U4 and U5 is a multi-step process. Newly transcribed snRNAs migrate to the cytoplasm and bind the Sm proteins. When the Sm domain has been assembled, the m7G cap is hypermethylated, to give the m3G cap structure (Mattaj, 1986). Eventually, the snRNP particles move back into the nucleus (De Robertis et al., 1982; Mattaj and De Robertis, 1985; Mattaj, 1988). The nuclear location signal of the various -
573
U.Fischer et al.
L.
g~ ~ ~ ~ ~ ~
4f ... . ,i (;l
1-10-111-ilm. M,w
-~
4k-
Fig. 1. Nuclear transport of in vitro reconstituted Ul snRNP is m3G cap dependent. (A) 32P-labelled human Ul snRNA, transcribed in vitro and capped with m3GpppG (lanes 1-3), m7GpppG (lanes 4-6) or ApppG (lanes 7-9) were reconstituted in vitro into snRNPs as described in Materials and methods. These particles were injected into the cytoplasm of oocytes (3 ng RNA/oocyte) and the extent of their transport to the nucleus was analysed after 3, 5 and 18 h. RNA isolated from the nuclear (N) amd cytoplasmic (C) fractions was separated by electrophoresis and the Ul snRNA was detected by autoradiography. In lanes 10-12, m3G-capped U1 snRNP reconstituted in vitro was co-injected with isolated m3GpppG resulting in a m3GpppG concentration of 1 mM in the oocyte, and analysed in the same way. Five oocytes were analysed in each experiment. (B) Quantitation of the results shown in (A). Autoradiograms, shown in (A) were scanned and N/C ratios calculated. The curves show transport kinetics for m3GpppG-capped (N/C m3G Ul), m7GpppG-capped (N/C m7G Ul) and ApppG-capped (N/C A Ul) in vitro reconstituted Ul snRNPs. The curve labelled N/C Ulcm3GpppG shows the transport kinetics of in vitro reconstituted m3GpppG-capped Ul snRNPs in the presence of isolated competitor m3GpppG cap.
m3G-capped snRNPs is not yet fully understood. It has recently been shown in Xenopus oocytes that the m3G cap structure of U 1 snRNPs is one component of an apparently bipartite NLS. The importance of the m3G cap was indicated by the findings that ApppG-capped Ul RNA was not transported to the nucleus (Fischer and Liihrmann, 1990; Hanum et al., 1990) and that the transport of m3GpppGcapped Ul RNA was strongly retarded by co-injection of a synthetic m3GpppG cap dinucleotide (Fischer and Liihrmann, 1990). Along the same line it has recently been shown that U2 snRNP transport to the nucleus was also significantly inhibited by m3GpppG cap dinucleotide (Fischer et al., 1991; Michaud and Goldfarb, 1992). However, a mutant Ul RNA with a defective Sm site was not targeted to the nucleus, even though its m3G cap was in place (Hamm et al., 1990; Fischer et al., 1991). It is therefore thought that another essential transport signal of Ul snRNP must reside in the Sm core domain. This is consistent with the previous finding that U 1-specific proteins are not required for nuclear targeting of Ul snRNA (Hamm et al., 1990). Surprisingly, the transport of U4 and U5 snRNAs to the nucleus has a much less stringent requirement for the m3G cap structure than that of Ul and U2 snRNAs (Fischer et al., 1991; Wersig et al., 1992). However, the m3G cap structure did accelerate the nuclear import of U5 snRNPs, showing that here too the m3G cap plays a part in the transport (Fischer et al., 1991). These observations raise interesting questions concerning the nature of the putative NLS on the Sm core domain. Can it interact with a transport receptor independently of the m3G cap? Related to this point, why do Ul and U2 snRNPs differ from U4 and U5 snRNPs in the importance of the m3G cap for their nuclear transport? The answer to the last question may perhaps lie in a difference in efficiency of the Sm core domains among the snRNPs, or it may be a result of differing higher-order structure in the snRNA. In support of the latter contention, influences of RNA sequence determinants other than the m3G cap and the Sm site on U snRNA transport have been described (Neuman de Vegvar et al., 1990; Konings and Mattaj, 1987). 574
In this report, we have addressed these questions by preparing snRNP particles by reconstitution in vitro from purified proteins and snRNA components, and microinjected
these reconstituted snRNPs into oocytes from Xenopus.
Results Nuclear transport of human Ul snRNPs, reconstituted in vitro, in Xenopus laevis oocytes In recent work, we developed a method for the reconstitution in vitro of snRNPs from isolated proteins and U snRNA (Sumpter et al., 1992). In the presence of a 5- to 10-fold molar excess of snRNP proteins Ul RNA can be nearly quantitatively reconstituted into an RNP particle. As investigated by CsCl-gradient centrifugation, radioimmunoprecipitation and Mono Q chromatography all of the core proteins (B, B', D1, D2, D3, E, F and G) were assembled into the Ul snRNP particle, while U1-specific proteins, in particular the 70k protein, were not incorporated stoichiometrically (Sumpter et al., 1992). Thus, by all available criteria the Sm core RNP domains of the Ul snRNPs reconstituted in vitro exhibit the same biochemical and biophysical properties as they do in isolated Ul snRNPs. The under-representation of U1-specific proteins in the reconstituted Ul snRNPs was not considered a major problem in connection with their use in nuclear transport studies; this is because they have been shown not to be essential for nuclear targeting of Ul RNA (Hamm et al., 1990). We therefore tested the human Ul snRNPs reconstituted in vitro, to see whether they were substrates for the nuclear transport apparatus of Xenopus oocytes. Since the reconstitution in vitro of U 1 snRNPs was nearly quantitative, we were able to inject the entire reconstitution mixture directly into oocytes, without a prior purification step to separate free Ul RNA from reconstituted Ul
snRNPs. Initially, we injected reconstituted m3GpppGcapped U 1 snRNPs into the cytoplasm of Xenopus oocytes. After 3, 5 and 18 h incubation, the nucleus was separated from the cytoplasm, the RNA was isolated and the
intracellular distribution of Ul RNA was analysed. As shown
Nucleo-cytoplasmic transport of U snRNPs in vitro
A -*'-K __-_
Ctrl.
o)
c
-
c
o
-
,.ow a
V..)jE.
1
^
3
4
C-
r
2l
Fig. 2. Occlusion of free Sm proteins in the oocyte by injection of increasing amounts of Ul snRNA. (A) Oocytes were injected with 0, 0.01, 0.1 or 1 ug cold Ul snRNA (lanes 3, 4, 5 and 6 respectively) and incubated for 3 h at 18°C. The same oocytes were then injected with [32P]pCp-labelled Ul snRNA (3 ng/oocyte) and incubated for a further 5 h. The oocytes were then homogenized and an immunoprecipitation was carried out, as described in Materials and methods, with the anti-Sm antibody Y12 (Lemer et al., 1981). The upper and lower panels show autoradiograms of gel-fractionated [32P]U1 snRNA extracted from the immunoprecipitates and supernatants, respectively. Lanes 1 and 2 show controls where Ul snRNPs reconstituted in vitro (lane 1) and free Ul RNA (lane 2) were immunoprecipitated with Y12. (B) Inmmunoprecipitation by the antibody Y12 of [32P]pCp-labelled Ul snRNP, reconstituted in vitro, from cells depleted of free snRNP proteins. Oocytes were injected either with water (lane 1) or 1 yg/oocyte cold Ul snRNA (lane 2), followed 3 h later by an injection of the in vitro reconstituted 32plabelled Ul snRNPs (3 ng/oocyte). After an additional incubation for 5 h, the oocytes were homogenized and Ul snRNPs were immunoprecipitated. The upper and lower panels show autoradiograms of gel-fractionated [32P]Ul snRNA extracted from immunoprecipitates and supernatants, respectively.
in Figure 1, the reconstituted U 1 snRNP was transported efficiently to the nucleus. Efficient nuclear transport was also found when reconstituted m7G-capped U 1 snRNPs were injected into the ooplasm (Figure 1). This was due to the fact that the reconstituted U1 snRNPs are good substrates for the methyl transferase in the oocyte that hypermethylates the snRNA m7G cap to give the m3G cap structure (as demonstrated by radioimmunoprecipitation analysis of nuclear Ul snRNPs with m3G-specific antibodies, data not shown). The m3G cap is essential for the nuclear import of reconstituted U 1 snRNPs. This is indicated by our findings (i) that Ul snRNP reconstituted in vitro with an ApppGcapped Ul RNA remained entirely in the cytoplasm, and (ii) that the transport of reconstituted m3G-capped Ul snRNP is inhibited by co-injection of isolated m3GpppG cap (Figure 1). All in all, our data indicate that human Ul snRNPs reconstituted in vitro are efficient substrates for the Xenopus transport apparatus and are transported to the nucleus with the same fidelity as the Ul snRNPs that are assembled in the cell. A large pool of free Sm proteins is present in the ooplasm of X. laevis oocytes. Therefore, one might argue that the nuclear transport we observe upon injection of reconstituted U I snRNPs could be due to dissociation of the reconstituted
U1 snRNP particle, followed by the association of the liberated U 1 RNA with endogenous Sm proteins. The following observations make this alternative explanation unlikely. Initially, we investigated the possibility of transassembly processes in the oocyte. In a first injection step, increasing amounts of cold m3GpppG-capped Ul RNA were injected. Oocytes were kept at 18°C for 3 h, during which time the injected Ul RNA should associate with the cell's proteins to give Ul snRNPs. Above a certain concentration of added U 1 RNA, the endogenous cytoplasmic pool of free Sm proteins should become exhausted; to observe this, the same oocytes were then injected again, this time with a constant amount of 32plabelled Ul RNA. After a further 5 h incubation at 18°C, the oocytes were homogenized and assayed by immunoprecipitation with anti-Sm antibodies. As shown in Figure 2A, 0.1 tg of cold Ul RNA (- 1.6 pmol) was sufficient to exhaust the pool of free Sm proteins in the oocytes. In the presence of 1 4g pre-injected Ul RNA (- 16 pmol), none of the Sm-precipitable U1 RNA was found to contain 32p label. The same results were observed when the second incubation period of the oocyte lasted for 18 h instead of 5 (not shown). This result shows that there is no significant exchange of Sm proteins between assembled Ul snRNPs and naked U 1 RNA molecules in the ooplasm under the conditions of our experiments. In a second series of experiments, we injected oocytes with 1 /tg of cold U 1 snRNA to deplete their pool of free snRNP proteins. Thereafter, the oocytes received an injection of 32P-labelled in vitro reconstituted Ul snRNPs. Five hours after the second injection, the Ul snRNPs were immunoprecipitated with anti-Sm antibodies. As shown in Figure 2B, the amount of 32P-labelled Ul RNPs precipitated was unaffected by the presence of pre-injected cold U 1 RNA. This demonstrated that the reconstituted Ul snRNPs remained stable in the oocyte even when the concentration of free Xenopus Sm proteins around them was close to zero. All in all, our data support strongly the idea that the human Ul snRNP particles reconstituted in vitro remain intact in the oocyte and are transported efficiently to the nucleus without undergoing a disassembly/reassembly process. (This idea receives further support in the experiments described below.) Saturation of U1 snRNP transport Our finding that U 1 snRNPs reconstituted in vitro were transported efficiently to the nucleus allowed us to study the requirements of snRNP transport independently of the assembly process in the cell. We first investigated whether the transport receptors that interact with U1 snRNPs, and mediate their nuclear transport, can be saturated by competing Ul snRNP particles. It was not possible to set up direct competition between the transport of reconstituted, radioactively labelled Ul snRNPs and increasing amounts of co-injected cold Ul snRNPs, as this would require concentrations of reconstituted snRNPs that cannot be attained in practice. We circumvented this problem by the two-step injection procedure already used in Figure 2. Increasing amounts of cold m3G-capped U1 snRNA were injected into the oocytes and the RNA was allowed to assemble in situ into U 1 snRNPs by incubation for 3 h at 18°C. Subsequently, a constant amount of 32P-labelled, m3GpppG-capped U1 snRNPs reconstituted in vitro was
575
U.Fischer et al.
RNA (1
,.tg pre-injected Ul RNA per oocyte), transport of subsequently injected 32P-labelled Ul snRNPs is almost completely abolished (Figure 3). Our data thus indicate that the transport of Ul snRNP is a saturable process, and that it requires transport factors that are distinct from the Sm proteins and are present in the ooplasm in limiting amounts. The interaction of a transport receptor with the U1 snRNP Sm core domain and its independence of the m3GpppG cap In the competition experiments described above, U1 snRNPs assembled in situ were used to saturate the transport of Ul snRNPs that contained both parts of the bipartite nuclear location signal, namely, the m3GpppG cap and the Sm core domain. The results of these experiments raise the question of whether the Sm core domain contains a signal that may act independently of the m3GpppG cap structure. If this hypothesis is true, then excess ApppG-capped Ul RNP in the oocyte should in principle be able to titrate out the transport receptor that recognizes the Sm core domain with an efficiency similar to that of m3GpppG-capped Ul RNP, and this should give rise to inhibition of the transport of 32P-labelled Ul snRNPs injected afterwards. This is exactly what we observed (Figure 4). As a control, we injected ApppG-capped TaqI Ul RNA (lacking an Sm region); this produced only marginal or no inhibition of the transport of reconstituted Ul snRNPs (Figure 4). These data indicate that the Sm core domain of Ul snRNP binds an essential snRNP transport receptor in a manner independent of the m3G cap.
Ul snRNPs do not inhibit the nuclear transport of a
Fig.
3.
Transport of Ul snRNP is a saturable process. (A) In vitro [32p]pCp-labelled M3GpppG-capped Ul snRNPs were
reconstituted
injected
into the
cytoplasm of oocytes (3 ng/oocyte) that 3 h previously pre-injected either with water (lanes 1-3) or with 0.01 (lanes 4-6), 0.1 (lanes 7-9) or (lanes 10-12) Atg/oocyte of cold m3GpppGUl snRNA. Transport of the radioactive Ul snRNP was analysed after incubation for the indicated periods by extraction of the had been
cytoplasmiic (C) fractions, gel
RNA from nuclear
(N) and
electrophoresis
autoradiography.
and
experimnent.
each
Autoadiograms, calculated. The
Five oocytes
(B) Quantitation of
were
analysed
shown in curves
(A), were scanned and N/C ratios N/Cl, 2, 3 and 4 show transport kinetics of
32P-labelled Ul snRNPs in oocytes preinjected with either
0.01, 0.1
injected
Atg/oocyte
or
into
experiment
be
can
free
the
was as
injected
pool
of
Ul RNA,
oocytes.
same
assembled into snRNP
water or
respectively.
The
rationale
of
this
follows. As Figure 2A shows, Ul RNA
in concentrations sufficient to titrate out the
endogenous proteins. proteins allow, this Sm
concentrations of these
UlI
in
Ul snRNP nuclear accumulation.
m3GpppG-capped
particles should
Ul
also occupy
As
far
the
as
RNA becomes
significant
of radioactive reconstituted Ul snRNPs.
shows the result of such 0. 16
pmol
of cold
UlI
an
fraction
Figure
experiment. In the presence (0. 01 /tg/oocyte), the rate
snRNA
3 of
of
transport of in vitro reconstituted Ul snRNPs is reduced, but the final extent of transport is not very much affected (see Figure 3B), indicating that the cold and the radioactive snRNPs compete for the
same
presence of a- 350-fold molar
576
receptor recognizing the NLS of U I snRNP on the Sm core RNP domain is distinct from the transport receptors that interact with this karyophilic protein.
snRNPs, and these a
of the snRNP receptors that mediate their nuclear transport. Blockage of these receptors could thus be revealed by a later
injection
karyophilic protein It was important to know whether the inhibition of nuclear transport by excess U 1 snRNPs in the ooplasm was specific for snRNPs or whether the transport of karyophilic proteins such as the SV40 T antigen was also affected. Oocytes were injected with 1 Ag of m3GpppG-capped Ul snRNA; this quantity suffices to inhibit completely the transport of Ul snRNPs (see Figure 3). After an initial 3 h incubation at 18°C, to ensure snRNP assembly, 35S-labelled T antigen translated in vitro was injected and its transport analysed after 2, 4 and 6 h. As shown in Figure 5, the transport of T antigen was not inhibited by the presence of excess m3GpppG- or ApppG-capped Ul snRNP or by TaqI Ul RNA. Two important conclusions can be drawn from these results. First, excess of U1 snRNPs in the ooplasm does not block nuclear transport in a non-specific way, for example, by occlusion of the nuclear pores. Secondly, the transport
transport factors. In the excess
of
competitor
U
Competition between the nuclear location signals on the Sm core domains of U? and U5 snRNPs for a common transport receptor An important question is whether spliceosomal Sm snRNPs possess a common NLS structure on their respective Sm core domains or whether each snRNP contains a specific Sm core signal, especially in view of the differential m3G cap requirement observed for nuclear transport of Ul and U2 snRNPs on the one hand and U4 and U5 snRNPs on the other (see Introduction). Nuclear targeting of the two types of snRNPs by distinct Sm core binding receptors could
Nucleo-cytoplasmic transport of U snRNPs in vitro
A 3
5
m3S
A
_
5 3
3
5
a-
S
1a 3
4....j
.
;NA p-e
B
5 .
NIC U'
----
N- /C U%cTail -{ }i---
1
23
-4
5
NIC U a cAU t
A-
,J
N/C UIcm3GU1
d_
Fig. 4. Ul snRNP transport is inhibited by an excess of pre-assembled ApppG-capped Ul snRNP. (A) Oocytes were pre-injected with water (lanes 1-3), or with 0.5 yg/oocyte of ApppGUl- (lanes 4-6), m3GpppGUI- (lanes 7-9) RNA or a Ul RNA deletion mutant lacking the domain A (UlTaqI, lanes 10-12). After a 3 h incubation of the oocytes at 18°C, the cells were injected a second time with [32P]pCp-labelled m3GpppGcapped Ul snRNP reconstituted in vitro (3 ng/oocyte). Transport of the radioactive Ul snRNP was analysed 3, 5 and 18 h later by manual dissection of five oocytes into nuclear (N) and cytoplasmic (C) fractions. The figure shows autoradiograms from gel-fractionated 32P-labelled Ul RNA extracted from nuclear (upper panel) and cytoplasmic (lower panel) fractions. (B) Quantitation of the transport inhibition shown in (A). Bands from the autoradiography were scanned and N/C ratios were calculated. The N/C ratios for Ul snRNP transport in oocytes preinjected either with water (N/C Ul) or with competitor ApppGUI RNA (N/C Ul cAUI), competitor m3GpppG Ul RNA (N/C Ulcm3GU1) or competitor Ul TaqI RNA (N/C UlcTaql) were plotted against incubation times.
provide a basis for the explanation of this difference. We tested this idea by analysing the competition for transport receptors between Ul and U5 snRNPs. The strategy described above was used. As a prerequisite for this study, we showed that U5 snRNPs reconstituted in vitro are transported to the nucleus with an efficiency similar to that of the transport of U1 snRNPs (Figure 6, panel A). When 0.5 ,ug of cold m3GpppG-capped Ul RNA was pre-injected into oocytes, the nuclear transport not only of Ul RNPs but also of co-injected U5 snRNPs, both reconstituted in vitro, was strongly inhibited (Figure 6, panel B). The same effect was caused by pre-injection of ApppGcapped Ul RNA (panel C). Similarly, pre-injected U5 RNA inhibited the nuclear transport of subsequently injected U5 as well as of Ul snRNPs (panel D). As a negative control, UlTaqI RNA, which lacks the Sm binding site, did not inhibit significantly (panel E). These data suggested that the NLS structure on the Sm core domains of U1 and U5 snRNPs must be very similar, since both snRNPs appear to compete for the same transport receptors. This makes it unlikely that the core RNP domains are responsible for the differences in the dependence of nuclear import of the two snRNPs on the m3G cap. A minimal Ul snRNP particle, consisting of the Sm core RNP domain, is transported to the nucleus by a route independent of the m3G cap The above results suggest the possibility that the size or structure of Ul RNA determines, at least in part, to what extent nuclear U1 RNA targeting requires the m3G cap. This we approached by investigating in what way deletions from Ul RNA upstream of the Ul Sm site affect the strict m3G cap requirement. Another interesting question is whether the transport signal on the Sm core domain can suffice to target a minimal snRNP particle to the nucleus. For this purpose, we constructed an RNA molecule that contained the 3'-terminal 42 nucleotides from U1 RNA (encompassing the single-stranded Sm site and the 3'-terminal stem-loop E of Ul RNA) and an artificially designed 5'-terminal stem -loop structure 22 nucleotides in
A A
r
;J
Taq
U
rI
RNA pre/nj.
L
hrs N
-
2
3
4
C
e
e
9
'O
c
1 12
B
_--
7//X
Fig. 5. Saturation of the transport of U1 snRNP does not interfere with transport of the karyophilic protein SV40 T antigen. (A) 35Slabelled T antigen from SV40, translated in vitro, was injected into oocytes that 3 h before had been injected with water (lanes 1-3) or 1 Ag/oocyte of m3GpppGUl (lanes 4-6), ApppGUI (lanes 7-9) or UlTaqI (lanes 10-12) RNA. Nuclear transport of T antigen was analysed 2, 4 and 6 h later. For each time point proteins of the nuclear (upper panel) and cytoplasmic compartments (lower panel) from six oocytes were analysed on a 10% SDS-polyacrylamide gel. SV40 T antigen was detected by autoradiography. (B) Quantitation of T antigen nuclear accumulation. The autoradiogram shown in (A) was scanned and N/C ratios were calculated. The curve N/Cl shows transport kinetics of T antigen in oocytes preinjected with water and curve N/C2 preinjected with m3GpppGUl RNA.
length (Sumpter et al., 1992). Since this RNA, denoted hereinafter SmI -RNA, contains only an Sm site and lacks the capacity to bind U1-specific proteins, any contribution 577
U. Fischer et al.
B ..,.40 I
4f ; .S
A
N
.5 r -:4 =
5
3
K
3
5
/3'
.5 3
..
.. :.
:^. :
A
a
i.--- ( i:
F S
C .
:_:P
A
-..
___ .1
__-
6_
0
Fig. 6. Competition of transport between Ul and U5 snRNPs. (A) Oocytes were injected with water (A, lanes 1-3) or with 0.5 yg/oocyte m3GpppGUl (B, lanes 4-6), ApppGUl (C, lanes 7-9), m3GpppGU5 (D, lanes 10-12) or UlTaqI (E, lanes 13-15) RNA. The cells were incubated at 18°C for 3 h before a further injection of a mixture of [32P]pCp-labelled, in vitro reconstituted m3GpppGUl and m3GpppGU5 snRNPs (3 ng RNP/oocyte each). The in vitro reconstitution of Ul and U5 snRNPs was carried out as described in Materials and methods using a 10-fold molar excess of isolated snRNP proteins. After an additional incubation for 3, 5 or 18 h oocytes were manually dissected into nuclear (N) and cytoplasmic (C) fractions. For each incubation period, the RNA from three nuclei (upper panel) and corresponding cytoplasmic fractions (lower panel) was analysed by electrophoresis on a denaturing RNA gel followed by autoradiography. (B) Quantitation of the inhibition of nuclear transport of in vitro reconstituted Ul snRNP by competitor snRNAs as shown in (A). The N/C ratios for Ul snRNP transport in oocytes preinjected either with water (N/C UI) or with competitor ApppGUl RNA (N/C UlcAUl), competitor m3GpppG Ul RNA (N/C UIcm3GUI), competitor m3GpppG U5 RNA (N/CUIcm3GU5) or competitor Ul TaqI RNA (N/C UlcTaqI) were plotted against incubation times. (C) Quantitation of the transport inbibition of in vitro reconstituted US snRNP by competitor snRNAs shown in (A). The N/C ratios for US snRNP transport in oocytes preinjected either with water (N/C US) or with competitor ApppGUl RNA (N/C UScAUl), competitor m3GpppG Ul RNA (N/C U5cm3GUI) competitor m3GpppG US RNA (N/C U5cm3GU5) or competitor Ul TaqI RNA (N/C UScTaqI) were plotted against incubation times.
of snRNP proteins other than Sm proteins to the transport of the SmiII-RNP particle can be excluded. Smll-RNA was reconstituted efficiently with snRNP proteins in vitro into a core RNP (SmnI-RNP) that contained all of the core proteins, B, B', Dl, D2, D3, E, F and G, but no Ul-specific proteins, as confirmed by immunoprecipitation (Sumpter et al., 1992) and Mono-Q chromatography (not shown). As shown in Figure 7, m3GpppG-capped SmII-RNPs were transported efficiently to the nucleus. The same was found to be true of m7Gcapped SmI1-RNP (Figure 7); radioimmunoprecipitation analysis with m3G cap-specific antibody confirmed that the m7GpppG of the SmII-RNPs became efficiently hypermethylated to the m3GpppG cap structure in the oocyte (see below). Interestingly, the ApppG-capped SmIH-RNP was also transported to the nucleus to a significant extent, though more slowly than the m3GpppGcapped SmII-RNPs (Figure 7). This indicated that in contrast to Ul snRNP, the nuclear transport of the SmII-RNP is less strictly dependent on the presence of a 5'-terminal m3GpppG cap. In support of this interpretation, co-injection of isolated m3GpppG cap did not completely block the nuclear transport of m3G-capped SmII-RNP (Figure 7). The finding that m3GpppG cap inhibits the nuclear transport of m3G-capped SmII-RNP by -60% after 18 h was not unexpected and resembles the situation observed for nuclear transport of U5 snRNP (Fischer et al.,
578
1991; Michaud and Goldfarb, 1992). It is consistent with the idea that interaction of the m3GpppG cap of SmIl RNP or U5 RNP with the m3GpppG cap recognizing factor, while not being an essential requirement none the less enhances nuclear transport of the two snRNPs. The reason why the nuclear transport of m3GpppG-capped SmII-RNP in the presence of isolated m3GpppG cap is less efficient as compared with the transport of ApppG-capped SmII-RNP in the absence of isolated m3GpppG (see Figure 7B) is presently not clear and deserves further investigations. Two lines of evidence indicated that the SmII-RNP was transported to the nucleus by an active mechanism and not by passive diffusion. First, the transport was severely inhibited at 4°C (not shown). Secondly, the transport of SmII-RNP is saturable. This is shown in Figure 8A and B, where pre-injection into oocytes of excess ApppG-capped U1 RNA or m3G-capped Ul RNA, but not the Smdeficient Ul TaqI RNA, completely inhibited nuclear transport of subsequently injected SmII-RNP. This indicates that the transport receptor recognizing the Sm core domain is required for targeting the SmII-RNP to the nucleus. Dissociation of the SmII-RNPs in the oocytes under these conditions could be excluded, since these RNPs were immunoprecipitated efficiently from the ooplasm by antiSm antibodies (Figure 8C). Taken together, these data suggest that the transport signal residing on the Sm core domain is not only essential but also
Nucleo-cytoplasmic transport of U snRNPs in vitro
sufficient to target a minimal Sm - snRNP particle to the nucleus. We note further that despite the fact that the Sm site of the SmIH RNA stems from Ul RNA, the behaviour of SmI - RNP in transport resembles more closely that of U5 than that of Ul snRNP. This indicates that either the length or structure of the Ul RNA upstream of the Sm site determines at least in part the dependence on the m3G cap of nuclear U1 snRNP transport.
A 74 ;r 7
.mm-
4k
i~~~~~~~
I
Al
Mika
Aimik
4
so.qw
*
-7
4
I '.
7;_
_
%
B
2
7
A
-u
Fig. 7. Transport of SmII-RNP reconstituted in vitro in oocytes. (A)
32P-labelled SmII-RNA, transcribed in vitro and containing either an m3GpppG (lanes 1-3), an m7GpppG (lanes 4-6) or an ApppG cap structure (lanes 7-9) was reconstituted in vitro as described in Materials and methods using a 10-fold molar excess of isolated snRNP proteins. The SmII-RNP was then injected into the cytoplasm of oocytes (3 ng RNP/oocyte) and transport was analysed 3, 5 and 18 h later by dissecting five oocytes into nuclear (N) and cytoplasmic (C) fractions. The transport kinetics of m3GpppG-capped SmII-RNP in oocytes, co-injected with isolated m3GpppG (final concentration in the oocyte 1 mM) is shown in lanes 10-12 for the indicated time points. (B) Quantitation of the results shown in (A). The curves show transport kinetics for m3GpppG-capped (N/C m3GSmII), m7GpppGcapped (N/C m7GSmII) and ApppG-capped (N/C ASmII) in vitro reconstituted SmII-RNPs. The curve labelled N/C Smllcm3GpppG shows transport kinetics of SmiH-RNPs in the presence of isolated competitor m3GpppG cap.
Smil - RNPs assembled in oocytes are transportdeficient In the course of our transport studies with SmI - RNP we made the unexpected observation that SmIl - RNPs assembled in situ upon injection of SmII-RNA remained mostly in the ooplasm and were not transported to the nucleus to a significant amount ( < 3% of total RNA injected into the oocyte). This was in striking contrast to the behaviour of SmIH -RNP that had been reconstituted in vitro. This was found to be the case irrespective of the chemical nature of the 5 '-terminal cap (Figure 9A). Initially, we reasoned that Sm proteins might not have assembled on to the SmII -RNA in the ooplasm. However, association of at least some Sm proteins with SmIl -RNA is indicated by the finding that the anti-Sm antibody Y12 precipitated SmIl - RNA from oocyte extracts to a significant extent (Figure 9B, lane 1). Moreover, injected m7GpppG-capped SmII-RNA becomes hypermethylated to the m3GpppG cap, as demonstrated by the precipitability of SmII-RNP with anti-m3G cap-specific antibodies (Figure 9B, lane 2). It is known that this event requires the binding of Sm proteins to the snRNA's Sm site (Mattaj, 1986). However, the overall ability of SmII-RNA to assemble into Smnl -RNPs in the ooplasm is lower than that of U 1 RNA. This became evident when we titrated the oocyte Sm proteins by injection of increasing amounts of SmI -RNA along the lines of Figure 2. The extent of depletion of Sm proteins by Smll -RNA was monitored by the Sm precipitability of radioactively labelled U 1 snRNA that was subsequently injected into the oocytes. Roughly
A
C
1lii** --I---
Iw -
I
-
.,----
iss ,
7
B
I,
i-------
i
so A
i-
w
..
1, .:.
-
Fig. 8. Competition of transport of in vitro reconstituted SmIl-RNP by Ul snRNP. (A) Inhibition of SmHI-RNP nuclear transport by pre-injection of cold Ul snRNA. Oocytes were injected with water (lanes 1-3) or with ApppGUI (lanes 4-6) m3GpppGUl (lanes 7-9) or UlTaqI (lanes 10-12) RNA at a concentration of 0.5 yg RNA/oocyte. The cells were incubated for 3 h at 18°C before injection of 32P-labelled SmIl-RNP reconstituted in vitro (3 ng SmIH RNA/oocyte). The oocytes were incubated further and nuclear transport was analysed at the indicated times as described in Figure 3. (N) designates the nuclear, (C) the cytoplasmic content of SmII-RNA. (B) Quantitation of the transport inhibition shown in (A). Bands from the autoradiography were scanned and N/C ratios were calculated. The N/C ratios for SmII-RNP transport in oocytes pre-injected either with water (N/C SmII) or with competitor ApppGUI RNA (N/C SmnIcAU1), competitor m3GpppG Ul RNA (N/C SmIIcm3GUl) or competitor Ul TaqI RNA (N/C SmIlcTaqI) were plotted against incubation times. (C) Immunoprecipitation of SmII-RNPs from oocytes with the anti-Sm antibody Y12. Oocytes were injected either with water (lane 1) or 1 jtg/oocyte Ul snRNA (lane 2). After 3 h incubation, 32P-labelled SmIl-RNP reconstituted in vitro was injected and the cells were incubated for further 5 h. The cells were then homogenized and the RNA was immunoprecipitated and analysed as described in Figure 2B. SmIIl-RNA extracted from immunoprecipitates and supernatants is shown in the upper and lower panel, respectively. (A)-(C) show autoradiograms of gel-fractionated 32P-labelled SmII-RNA.
579
U.Fischer et al. A .
8 5
binding of Sm proteins to SmIl -RNA by incubation of the oocytes for 3 h at 18°C, m3GpppG-capped Ul snRNPs radiolabelled by reconstitution in vitro were injected into the same oocytes. As shown in Figure 9C, the Ul snRNPs were transported efficiently to the nucleus. Furthermore, there was
*8 I--
.. . .. _
Ie
I
llplll.,-,
S mi
..
-,
...r
-
2
"
4
no difference in the kinetics of transport of Ul snRNPs in the presence or absence of pre-injected SmII-RNA. Finally these observations are important for another reason: it may be objected that putative assembly defects in the reconstituted snRNPs are healed by complementation in the ooplasm with endogenous Sm proteins. However, the fact that U1 snRNPs reconstituted in vitro were imported into the nucleus even when the endogenous pool of free Sm proteins was removed by a prior injection of excess SmI -RNA makes this
possibility unlikely. C Q
7,
-,
r,
-
N,
m
~
-e
-
hP-.-
Fig. 9. SmII-RNP assembled in oocytes fails to migrate to the nucleus. (A) Nuclear migration of m3G-capped, 32P-labelled SmII-RNA injected into the cytoplasm of the oocyte. 3 ng SmIl RNA was injected into each oocyte and its transport analysed after 5 and 18 h by dissecting the cells into nuclear (N) and cytoplasmic (C) fractions. The RNA from three oocytes was extracted, separated on a denaturing RNA gel and visualized by autoradiography. (B) Immunoprecipitation of SmII-RNP assembled in situ with the anti-Sm antibody Y12 and the m3G-specific antibody RI 131 (Luihrmann et al., 1982). In vitro transcribed 32P-labelled m7GpppG-capped SmII and UlTaqI RNA was injected into oocytes and incubated for 18 h. Oocytes were homogenized and RNA was immunoprecipitated and analysed as described in Figure 2. The immunoprecipitates are shown in lanes 1 and 2, the supernatants of the immunoprecipitation in lanes 3 and 4, respectively. (C) SmIl-RNP assembled in situ does not inhibit nuclear transport of in vitro reconstituted Ul snRNPs. Oocytes were injected with either water (lanes 1 and 2) or 1 itg/oocyte SmII RNA (lanes 3 and 4) and incubated for 3 h at 18°C. The same oocytes were injected with [32P]pCp-labelled Ul snRNP reconstituted in vitro. The transport of Ul snRNP was analysed 3 and 5 h later, as described in Figure 3.
three times
much SmnIl-RNA as Ul RNA was needed endogenous pool of Sm proteins (not shown). From the data described above, it appears that the Smll-RNP particle, assembled in situ, is deficient in nuclear transport, despite the fact that this particle possesses most if not all Sm proteins as well as the m3G cap. A possible explanation for this interesting phenomenon is that during assembly of the SmII-RNP particle SmIH-RNA fails to induce the proper conformation of the NLS on the Sm core RNP. This would prevent the SmIH -RNP from interaction with the transport receptor that recognizes the Sm core domain. A consequence of this hypothesis is that excess assembled SmII-RNP in the oocyte should not inhibit nuclear transport of subsequently injected Ul snRNPs, owing to the inability of SmIl -RNPs to titrate out the receptor that recognizes the Sm core domain. This is exactly what we observed. Cold m7GpppG-capped Smll-RNA was injected into oocytes at concentrations where the endogenous pool of Sm proteins was titrated out quantitatively. After allowing as
to titrate the
580
Discussion In this report, a series of experiments has been presented that address the nature of the nuclear location signal of U snRNPs in the Sm class. In particular, we have used competition studies to define independently acting transport signals on the snRNP particle. Central to these investigations has been the availability of snRNPs reconstituted in vitro. Only in this way could we investigate the transport of snRNPs independently of their assembly in the cytoplasm. Nuclear snRNP import can be inhibited competitively Initial evidence for the active mediation of nuclear transport of Ul snRNP came from our observation that isolated m3GpppG cap, at high concentrations, inhibited the transport of Ul snRNP (Fischer and Liihrmann, 1990). In these studies, naked Ul RNA was injected into the cells, so that it had to assemble in situ into a functional snRNP transport substrate. Therefore, it could not rigorously be excluded that a putative m3G cap-recognizing factor might be involved in a final step of snRNP assembly rather than acting as a transport receptor. Our observation that isolated m3GpppG cap inhibits the transport of microinjected in vitro reconstituted m3G-capped Ul snRNPs make this possibility unlikely, and it shows that the m3G cap of Ul snRNP is indeed being recognized by a transport receptor. However, as observed previously, high concentrations of m3G cap (- 100-200 jM) were necessary to obtain quantitative inhibition, indicating only a low affinity of the isolated m3G cap with this factor (see also below). A saturation study of Ul snRNP transport with complete snRNPs was up to now not possible since injection of competitor snRNAs into oocytes would always titrate both the Sm proteins and the snRNP transport receptors. Such studies call for the use of reconstituted snRNPs. For experimental reasons, we have used snRNPs assembled in situ upon injection of snRNAs as competitors for the radioactive snRNPs whose transport could be observed. The initial rate of import of Ul snRNPs was reduced substantially by the injection of m3G-capped Ul RNA at concentrations about two orders of magnitude below those required to produce an effect with m3G cap alone. At concentrations of competitor Ul snRNP around 2-5 ,uM the transport of reconstituted snRNPs was virtually abolished (Figure 3). These data indicate clearly that the nuclear import of Ul snRNP is receptor-mediated.
Nucleo-cytoplasmic transport of U snRNPs in vitro
The Sm core domain contains a transport signal that is independent of the m3GpppG cap and may suffice to target a minimal snRNP particle to the nucleus The surprising difference between the concentration of isolated m3GpppG and that of complete U 1 snRNPs required to impede the import of U1 snRNP has already indicated that the competitor Ul snRNPs titrate a transport factor that interacts with high affinity with a region on Ul snRNP other than the m3G cap. This idea was confirmed by our observation that ApppG-capped Ul snRNPs inhibited Ul snRNP as efficiently as m3G-capped Ul snRNPs did (Figure 4). This allowed two provisional conclusions to be drawn. (i) There exists a transport receptor, present in oocytes in limiting amounts, which interacts with high affinity with a signal structure at U 1 snRNP. (ii) Its interaction with the signal structure is not dependent on recognition of the m3G cap. The hypothesis that the signal structure lies in the Sm core domain was verified by the results obtained with the reconstituted SmII-RNP particle. The SmII-RNA contained the 3'-terminal 42 nucleotides from U1 snRNA (encompassing the single-stranded Sm site and the 3'-terminal stem-loop of Ul snRNA), however, the 5'-terminal part of Ul RNA was replaced by an artifically designed stem-loop structure. Therefore SmIH-RNA can bind only the Sm proteins but not U1-specific proteins (Sumpter et al., 1992). m3GpppG-capped SmHI-RNPs reconstituted in vitro were transported as efficiently to the nucleus as Ul snRNP (Figure 7). Surprisingly, even ApppGcapped SmII-RNPs were targeted to the nucleus, though kinetically more slowly than the m3G-capped particles. Moreover we could show that the transport of SmII-RNP was saturable and could be competed by Ul snRNP (Figure 8). In sum these data suggest that the transport signal residing in the Sm core domain is not only essential but also sufficient to target a minimal Sm-snRNP particle to the nucleus. We wish to stress the observation that high concentrations of ApppG-capped Ul snRNPs did not inhibit nuclear import of SV40 T antigen. This demonstrates that the transport signal on the Sm core domain is distinct from the NLS of karyophilic proteins. It reinforces our conclusion that the competition of snRNP import we observe is specific and not due to a general occlusion of nuclear pores by the presence of competitor RNPs in the ooplasm. Consistent with our observations is the finding by Michaud and Goldfarb (1991, 1992) that a conjugate of synthetic peptide NLS with BSA did not affect nuclear import of U2 snRNP at concentrations that blocked the import of nucleoplasmin. The definition of an independent NLS at the Sm core domain of U1 snRNP raises the question of how many receptor molecules interact with and mediate the nuclear transport of U1 snRNP. While this question cannot at present be definitively answered, the indication from our competition studies that the Sm NLS interacts with its cognate transport receptor with an affinity about two orders of magnitude greater than the isolated m3GpppG cap does, supports the idea that one receptor may recognize both parts of the biparte NLS of Ul snRNP simultaneously; this would imply a strong binding site for the NLS on the Sm core domain and a weaker one for the m3G cap. It is clear from the results described in this report that the identification of the snRNP transport receptor(s) will require the use of intact snRNP particles.
The simultaneous recognition of the NLS on the Sm core domain of Ul RNP and the m3G cap would require these two parts of the U 1 RNP NLS to be spatially close to each other. The results of immuno-electron-microscopic studies are consistent with such a possibility: the m3G cap is found to be located at the surface of the round-shaped core RNP domain (Kastner and Liihrmann, 1989). Our studies also provide initial clues to what determines the differing m3G cap requirements of nuclear transport of Ul and U2 snRNPs as opposed to U4 and U5 snRNPs (Fischer et al., 1991). In principle, three possibilities could be envisaged to account for this difference. (i) The NLS residing on the Sm core domain of U4 and U5 snRNPs could be more active than that on Ul and U2 RNPs, causing a weaker dependence on the m3G cap signal. (ii) The length and higher structure of the RNA molecules may determine the requirement for the m3G cap. Note in this connection that Ul and U2 RNAs are longer than U4 and U5 RNAs. (iii) snRNP-specific proteins, though not essential for nuclear targeting of snRNPs, may still affect the kinetics of their transport. Our finding that nuclear U5 snRNP transport can be saturated with excess of Ul snRNPs and vice versa suggests that their transport is mediated by a common receptor that recognizes the Sm core domain. This makes the first possibility, that the NLS on the Sm core domain of Ul and U5 snRNP may have differential activities, rather unlikely. The further finding that SmII-RNPs reconstituted in vitro are transported in a manner that is independent of m3G cap suggests on the contrary that the 5'-terminal region of U1 RNA is in some way responsible for the m3G cap requirement of Ul RNA transport. A possible role of U 1-specific proteins in this respect can be excluded by the finding that nuclear transport of a mutant Ul RNA of the same size as wild-type U1 RNA but containing point mutations in each of the stem -loops I and II, so as to prevent binding of U 1-specific proteins, is still dependent on the presence of an m3G cap (I.Mattaj, U.Fischer and R.Luhrmann, unpublished results). Together, these data support the idea that the nuclear transport of Ul snRNP and in particular its dependence upon the m3G cap is influenced strongly by the structure of the Ul snRNA molecule. An observation not yet accounted for is the fact that the SmHI -RNPs prepared in vitro are transported efficiently to the nucleus while their assembly in the ooplasm fails to lead to effective nuclear transport. This is probably due to the low efficiency of the heterologous Sm site of SmII-RNA in bringing about the proper conformation of the NLS on the Sm core domain in the Xenopus cell. This idea is supported by our findings (i) that the Sm II RNPs assembled in situ can be precipitated with anti-Sm antibodies, i.e. Sm proteins are indeed bound to Sm II RNA (Figure 9B) and (ii) that the endogenous pool of free Xenopus Sm proteins can be exhausted by injection of excess of Sm II RNA without, however, titrating the transport receptor that recognizes the Sm core domain (Figure 9C). In vitro the lower efficacy of assembly around the heterologous Sm site of SmII-RNA appears to be compensated by the higher temperature (30-37°C as compared with 18°C in the oocyte) and the use of protein concentrations that are greater than those in vivo. This observation in no way weakens the conclusions of this paper and indeed underlines the efficiency of the reconstitution in vitro. It rather indicates that the structure of an Sm site functioning under natural conditions may be more sophisticated than previously believed. A 581
U.Fischer et al.
comparative structural investigation of the SmII-RNPs assembled in vitro and in vivo may provide us with information about the chemical nature of the nuclear location signal on the Sm core domain.
Material and methods Reconstitution in vitro of U snRNPs The reconstitution of U snRNPs in vitro was carried out essentially as described in Sumpter et al. (1992). In brief, snRNP proteins were isolated by incubation of 2 mg of immunoaffmnity purified U snRNPs (Bringmann et al., 1983) with 5 ml DEAE-cellulose (DE53, Whatmann) in the presence af 150 mM KOAc, 140 mM NaCl, 5 mM EDTA and 0.5 mM DTE. After incubation for 15 min on ice and 15 min at 37°C the DEAE-cellulose was pelleted by centrifugation. The supematant was removed and dialysed against reconstitution buffer (20 mM HEPES-KOH pH 7.9, 50 mM KCl, 5 mM MgCl2, 0.2 mM EDTA, 5 % glycerol, 0.5 mM DTE and 0.5 mM PMSF. The protein solution was concentrated to 0.5-1 yg/dl by using a centricon-3 tube (Amicon). The molar concentration of each protein preparation was calculated as the sum of the molecular weights of the core proteins, namely B, B', Dl, D2, D3, E, F and G, which was - 130 kDa. In a typical reconstitution assay 0.5-1 pmol U snRNA (1-3 x 106 c.p.m./pmol) was mixed with a 10-fold molar excess of snRNP proteins in buffer containing 20 mM HEPES-KOH at pH 7.9, 50 mM KCI, 5 mM MgCl2, 0.5 mM DTE and 0.5 U//tl RNasin. The reconstitution mixture (10 jsl) was incubated for 30 min at 30°C followed by 15 min at 37°C and was thereafter used directly for microinjection experiments. Freshly prepared U snRNPs reconstituted in vitro were used for each experiment. Plasmids and procedures for labelling of RNA
[32P]pCp labelling of gel-purified Ul and US snRNAs. 1 tg of gelpurified U snRNA was assayed for 3'-end labelling (England et al., 1978) in a buffer that contained 50 mM HEPES-KOH at pH 7.9, 18 mM MgCl2, 3 mM DTE, 10 ,ug/mI BSA, 1 U/4d T4 RNA ligase (BRL) and 60 1Ci [32P]pCp (3000 Ci/mmol). The assay mixture was incubated for 18 h at 4°C. Water was added to a fial volume of 100 iLl and the assay was extracted twice each with phenol and chloroform. The RNA was precipitated with 2.5 vol ethanol and 0.2 vol 6 M ammonium acetate for 1 h at -80C. The labelled RNA was pelleted and washed three times with 70% ethanol, air dried and resuspended in sterile water. The specific activity of the labelled RNA was -1-5 x 106 c.p.m./yg RNA. Transcription in vitro of U snRNA genes. The clones pHU I (Patton et al., 1987) and pSmII (Sumpter et al., 1992), linearized with BamHI and AvaI, respectively, were used for in vitro generation of SP6 snRNAs (Melton et al., 1984). The SmII-RNA clone encompassed the 3'-terminal 42 nucleotides of human Ul RNA comprising the single-stranded Sm-site and the 3'-terminal stem-loop. The 5'-terminal 115 nucleotides of U1 snRNA were replaced by a 22 nucleotide artificial stem-loop. This 64 nucleotide RNA has the following sequence: 5'-GAAUACAAGCUUAAGUAAGCUUAUAAUUUGUGGUAGUGGGGGACUGCGUU CGCGCUUUCCCCUG-3'. The truncated version of U1, lacking the Sm site and stem-loop E (UlTaqI-RNA) was generated by transcription of pHUl linearized with TaqI (Fischer et al., 1990). 1 ytg of linearized DNA was incubated in buffer containing 40 mM Tris-HCI at pH 8.0, 6 mM MgCl2, 2 mM spermidine, 50 mM NaCl, 25 mM DTE, 0.1 tgIAl BSA, 1 mM of the indicated cap dinucleotide, 250 AM each of GTP, CTP and ATP, 100 jLM UTP, 60 jiCi [a-32P]UTP and 1 U/Id SP6. Transcription was allowed to proceed for 45 min at 37°C. The reaction was stopped by adding 1 U/jd RNase-free DNase I and continuing the incubation for 15 min. RNA was extracted and precipitated as described above. The specific activity of the labelled RNA was 1-3 x 106 c.p.m./pmol RNA. Preparative transcription was carried out by raising the assay volume to 100 ,Il, the nucleotide concentrations to 1-2 mM each and the quantity of linearized DNA to 10 jig. The yield in a preparative transcription assay was typically between 50 and 100 jig RNA. The transcript prepared from the plasmid pHUl contained a 25 nucleotide extension beyond the last nucleotide (165) of mature Ul RNA. This 3' trailer sequence was subsequently removed by cleavage with RNase H (0.1 U/1d) in buffer containing 20 mM HEPES pH 7.4, 10 mM MgCl2, 50 mM KCI, 1 mM DTE and the DNA-oligonucleotide 5'-CTCTAGAGTCGACCTGCAGCCCAAG-3' (0.1 jIg/ld). After incubation of the reaction mixture for 1-1.5 h at 37°C, the DNA-oligonucleotide was digested with DNase I. The RNA was precipitated after phenol-extraction and resuspended in water.
Immunoprecipitation
The oocytes from which U snRNPs were to be immunoprecipitated were homogenized in PBS (130 mM NaCl and NaPO4 pH 8.0) and the insoluble
582
fraction was pelleted by centrifugation. The supernatant was carefully removed and incubated with specific antibodies bound to protein A-Sepharose for 2 h at 4°C. Immunoprecipitation was carried out as described previously (Fischer and Lulhrmann, 1990). The antibodies used in this study were Y12 [B-, B'- and D-specific, (Lerner et al., 1981)] and the monospecific serum Ri 131 which reacts exclusively with the m3G cap structure and does not cross-react with m7G cap structures (Luhrmann et al., 1982). Ten oocytes were analysed in each experiment.
Microinjection into oocytes Injection of RNAs and RNPs. Approximately 50 nl of [32P]RNA, [32P]U snRNPs reconstituted in vitro or cold snRNA was injected into the vegetal half of X. laevis oocytes. Oocytes were incubated in MBS buffer (Gurdon, 1974) at 18°C and dissected manually. RNA was purified by homogenizing the cytoplasmic and nuclear fractions in HM buffer (containing 50 mM Tris-HCI at pH 7.5, 5 mM EDTA, 1.5% SDS, 300 mM NaCl and 1.5 jg/ml proteinase K) for 30 min at 37°C and extracting the proteins with phenol. RNA was precipitated with 3 vol ethanol and analysed on a 10% TAE-polyacrylamide gel with 7.5 M urea. Three to five oocytes were injected and analysed for each time point. Injection of proteins translated in vitro. 1-3 Ag m7G-capped SV40 T antigen mRNA (transcribed from a T7 clone kindly provided by K.van Zee, Munich) was added to 25 ,d reticulocyte lysate (Promega Biotec, Madison, WI) supplemented with 2.5 Al amino acid mix containing 1 mM of each amino acid except for methionine, 5 1tl [35S]methionine (1000 Ci/mmol) and 45 1l H20. The mixture was incubated for 90 min at 30°C. The protein that had been translated in vitro was injected without further purification directly into the cytoplasm of the oocyte and incubated in MBS buffer supplemented with 100 Ag/ml cycloheximide (Sigma). Oocytes were dissected in 5:1 medium (83 mM KCI, 17 mM NaCl and 10 mM Tris-HCl at pH 7.4). The isolated nuclei were fixed and pelleted in 95% ethanol. The cytoplasms were homogenized in ice-cold 5:1 medium and the insoluble fraction was removed by centrifugation. The protein in the supematant was precipitated with 5 vol of acetone for 1 h at -80°C. Precipitated proteins were dissolved in protein sample buffer (containing 5 % 3-mercaptoethanol, 2% SDS, 10% glycerol, 0.025% bromophenol blue and 50 mM Tris-HCl at pH 6.8) and separated on an SDS-polyacrylamide gel (Laemmli, 1970). Gels were subsequently fixed in 40% methanol/10% acetic acid and rinsed for 30 min in 'amplify solution' (Amersham) before drying on a gel drier. The proteins were visualized by autoradiography. Exposure time was normally 24 h. Three to five oocytes were injected and analysed for each time point. Quantitation of nuclear accumulation of injected 32P-labelled U snRNAs and 35S-labelled T antigen. The nuclear accumulation (N/C ratio) was calculated by scanning autoradiograms obtained from RNA- and proteingels using a Quick Scan Densitometer (DESAGA). N/C values were plotted against the incubation time. Stability of the injected snRNAs/snRNPs in the oocytes. We have studied the stability of the various injected snRNAs and in vitro reconstituted snRNPs in the oocytes. Generally, 80-90% of in vitro reconstituted Ul and U5 snRNPs remained intact in the oocytes even 18 h after injection. The same was found to be true of in vitro reconstituted SmII-RNPs. When naked snRNAs were injected, - 65-75 % of U1 or U5 snRNAs were stable after 18 h. SmIl RNA was less stable, with -40-50% of the injected RNA remaining intact after 18 h.
Acknowledaements We thank Kari van Zee and Ellen Fanning for providing the SV40 T antigen clone, Joan A.Steitz for generous gifts of antibodies, and Iain Mattaj for communication of results prior to publication as well as for many helpful discussions. The excellent technical assistance of Irene Ochsner-Welpelo and Silke Borner is greatfully acknowledged. We also thank Verena Buckow for help in preparation of this manuscript. This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB 286/A4) and the Fonds der Chemischen Industrie. U.F. was in part supported by a fellowship from the graduate student programme for Cell and Tumor Biology, Philipps-
Universitait Marburg.
References Adam,S.A. and Gerace,L. (1991) Cell, 66, 837-847. Adam,S.A., Lobi,T.A., Mitchell,M.A. and Gerace,L. (1989) Nature, 337, 276-279.
Branlant,C., Krol,A., Ebel,J.P., Lazar,E., Haendler,B. and Jacob,M. (1982) EMBO J., 1, 1259-1265.
Nucleo-cytoplasmic transport of U snRNPs in vitro Bringmann,P., Rinke,J., Appel,B., Reuter,R. and Luihrmann,R. (1983) EMBOJ.,2, 1129-1135. De Robertis,E.M., Lienhard,S. and Parisot,R.F. (1982) Nature, 295, 572-577. Dingwall,C. and Laskey,R.A. (1991) Trends Biochem. Sci., 16, 478-481. Dworetzky,S.I. and Feldherr,C.M. (1988) J. Cell Biol., 106, 575-584. England,T.E. and Uhlenbeck,O.C. (1978) Nature, 275, 560-561. Feldherr,C., Kallenbach,E. and Schultz,N. (1984) J. Cell Biol., 99, 2216-2222. Fischer,U. and Luhrmann,R. (1990) Science, 249, 786-790. Fischer,U., Darzynkiewicz,E., Tahara,S.M., Dathan,N.A., Luhrmann,R. and Mattaj,I.W. (1991) J. Cell Biol., 113, 705-714. Garcia-Bustos,J., Heitman,J. and Hall,M.N. (1991) Biochim. Biophys. Acta Rev. Biomembr., 1071, 83-101. Goldfarb,D.S., Gari6py,J., Schoolnik,G. and Komberg,R.D. (1986) Nature, 322, 641-644. Gurdon,J.B. (1974) Control of Gene Expression in Animal Development. Harvard University Press, Cambridge, MA. Hamm,J., Darzynkiewicz,E., Tahara,S.M. and Mattaj,I.W. (1990) Cell, 62, 569-577. Kalderon,D., Richardson,W.D., Markham,A.F. and Smith,A.E. (1984a) Nature, 311, 33-38. Kalderon,D., Roberts,B.C., Richardson,W.D. and Smith,A.F. (1984b) Cell, 39, 499-509. Kastner,B. and Liihrmann,R. (1989) EMBO J., 8, 277-286. Kastner,B., Bach,M. and Liihrmann,R. (1990) Proc. Natl. Acad. Sci. USA, 87, 1710-1714. Konings,D.A.M. and Mattaj,I.W. (1987) Exp. Cell Res., 172, 329-339. Laemmli,U.K. (1970) Nature, 227, 680-685. Lanford,R.E., Kanda,P. and Kennedy,R.C. (1986) Cell, 46, 575-582. Lehmeier,T., Foulaki,K. and Luhrmann,R. (1990) Nucleic Acids Res., 18, 6475-6484. Lerner,M.R. and Steitz,J.A. (1979) Proc. Natl. Acad. Sci. USA, 76, 5495-5499. Lerner,E.A., Lerner,M.R., Janeway,C.A.,Jr and Steitz,J.A. (1981) Proc. Natl. Acad. Sci. USA, 78, 2737-2741. Liautard,J.P., Sri-Widada,J., Brunel,C. and Jeanteur,P. (1982) J. Mol. Biol., 162, 623-643. Liihrann,R., Appel,B., Rinke,J., Reuter,R., Rothe,S. and Bald,R. (1982) Nucleic Acids Res., 10, 7103-7113. Limann,R., Kastner,B. and Bach,M. (1990) Biochim. Biophys. Acta Gene Struct. Expression, 1087, 265 -292. Mattaj,I. (1986) Cell, 46, 905-911. Mattaj,J.W. (1988) In Birnstiel,M.L. (ed.), Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles. Springer-Verlag, Berlin, pp. 100-114. Mattaj,I.W. and De Robertis,E.M. (1985) Cell, 40, 111-118. Melton,D.A., Krieg,P.A., Rebagliahi,M.R., Maniatis,T., Zinn,K. and Green,M.R. (1984) Nucleic Acids Res., 12, 7035 -7056. Michaud,N. and Goldfarb,D.S. (1991) J. Cell Biol., 112, 215-223. Michaud,N. and Goldfarb,D. (1992) J. Cell Biol., 116, 851-861. Neuman de Vegvar,H.E. and Dahlberg,J.E. (1990) Mol. Cell. Biol., 10, 3365-3375. Newmeyer,D.D. and Forbes,D.J. (1988) Cell, 52, 641-653. Patton,J.R., Patterson,R.J. and Pederson,T. (1987) Mol. Cell. Biol., 7, 4030-4037. Reddy,R. and Busch,H. (1988) In Birnstiel,M.L. (ed.), Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles. Springer-Verlag, Berlin, pp. 1-37. Richardson,W.D., Mills,A.D., Dilworth,S.M., Laskey,R.A. and Dingwall,C. (1988) Cell, 52, 655-664. Robbins,J., Dilworth,S.M., Laskey,R.A. and Dingwall,C. (1991) Cell, 64, 615-623. Silver,P.A. (1991) Cell, 64, 489-497. Singh,R. and Reddy,R. (1989) Proc. Natl. Acad. Sci. USA, 86, 8280-8283. Sumpter,V., Kahrs,A., Fischer,U., Kornstidt,U. and Luhrmann,R. (1992) Mol. Biol. Rep., 16, 229-240. Wersig,C., Guddat,U., Pieler,T. and Bindereif,A. (1992) Exp. Cell Res., 199, 373-377. Received on August 14, 1992; revised on October 10, 1992
583
