Ó Springer-Verlag 1999
Mol Gen Genet (1999) 262: 738±748
ORIGINAL PAPER
S. Ishikawa á S. Kawahara á J. Sekiguchi
Cloning and expression of two autolysin genes, cwlU and cwlV, which are tandemly arranged on the chromosome of Bacillus polymyxa var. colistinus Received: 14 April 1999 / Accepted: 26 July 1999
Abstract The cwlV gene, which encodes Bacillus polymyxa var. colistinus autolysin was cloned and sequenced. cwlV comprises a 1497-bp ORF and encodes a polypeptide of 499 amino acid (aa) residues (Mr of 53,707 Da). The N-terminal sequence of the mature 23-kDa CwlV protein is NSXGKKVVVIDAGXGAKD(X, undetermined aa); this processed form corresponds to the C-terminal portion (183 aa, Mr of 20,050 Da) of the cwlV ORF. Sequencing of the ¯anking region revealed that another putative autolysin gene, cwlU, is located upstream of cwlV. cwlU encodes a polypeptide of 524 aa and its deduced sequence is 34.9% identical to the fulllength sequence of CwlV. Downstream of cwlV, the genes for a deduced lipoprotein (OrfW), an endonuclease III homolog (Nth), a non-homologous OrfX, a glutathione peroxidase homolog (Gpx), and the N-terminal region of OrfZ containing a ATP/GTP-binding site motif were found. Northern blotting and primerextension analyses revealed that cwlU is transcribed as a single cistron, but cwlV is transcribed with orfW. The unprocessed forms of CwlV and CwlU (VDS and UDS, respectively) and their predicted mature forms (Vcat and Ucat, respectively) were expressed in, and puri®ed from, Escherichia coli. Enzyme analysis indicated that VDS and Vcat exhibit low and high cell wall hydrolase activities toward B. polymyxa cell wall, respectively, but UDS and Ucat exhibit almost no and low cell wall hydrolase activities, respectively.
Communicated by K. Isono S. Ishikawa á J. Sekiguchi (&) Department of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, 3-15-1 Tokida, Ueda-shi, Nagano 386-8567, Japan E-mail:
[email protected] Tel.: +81-268-215344; Fax: +81-268-215331 S. Kawahara Shiraoi Pharmaceutical Plant, Asahi Chemical Industry Co. Ltd., 724-1 Midorimachi, Shiraoi-cho, Hokkaido 059-0913, Japan
Key words Peptidoglycan á Cell wall hydrolase gene á N-acetylmuramoyl-L-alanine amidase á Bacillus polymyxa var. colistinus
Introduction Microorganisms produce a set of enzymes capable of hydrolyzing the shape-maintaining and stress-bearing peptidoglycan layer of their own cell walls (Rogers et al. 1980; Doyle and Koch 1987; Shockman and HoÈltje 1994). Some of these peptidoglycan hydrolases can trigger cell lysis; therefore, they can truly be called autolysins or suicide enzymes (Rogers et al. 1980). In Bacillus subtilis, two major vegetative-phase autolysins [a 50-kDa N-acetylmuramoyl-L-alanine amidase (amidase) and a 90-kDa endo-b-N-acetylglucosaminidase (glucosaminidase)] were initially puri®ed and characterized (Herbold and Glaser 1975; Rogers et al. 1984). Recently, the genes [cwlB (lytC) and cwlG (lytD)] encoding the amidase and glucosaminidase, respectively, were cloned and studied at the molecular level (Kuroda and Sekiguchi 1991; Lazarevic et al. 1992; Margot et al. 1994; Rashid et al. 1995a). Insertional inactivation of the chromosomal cwlB gene of B. subtilis led to extraordinary resistance to cell lysis even after a 6-day incubation at 37° C (Kuroda and Sekiguchi 1991). Several other amidase genes have also been cloned from the genus Bacillus. From B. subtilis, four prophage-encoded amidase genes (cwlA, xlyA, xlyB and blyA) (Kuroda and Sekiguchi 1990; Foster 1991; Longchamp et al. 1994; da Silva et al. 1997; Regamey and Karamata 1998), a sporulation-speci®c amidase gene (cwlC) (Kuroda et al. 1993), and a putative amidase gene (cwlD) aecting spore germination (Sekiguchi et al. 1995) have been cloned, in addition to cwlB. From B. licheniformis, two amidase genes (cwlM and cwlL), and from Bacillus sp. a cell wall hydrolase (probably an amidase) gene have been cloned and studied (Potvin et al. 1988; Kuroda et al. 1992; Oda et al. 1993). Very recently, the genes for enzymes that lyse the spore cortex (SleB amidases) were
739
cloned from B. cereus and B. subtilis, respectively (Moriyama et al. 1996a, b), and their homolog, CwlJ, was found to be associated with spore germination (Ishikawa et al. 1998). On the basis of the sequence similarity between the catalytic domains of amidases, it is possible to classify them into three groups: class I includes CwlA, CwlL, XlyA, XlyB, BlyA and the Bacillus sp. amidase, class II contains CwlB (LytC), CwlC, CwlD and CwlM, and class III comprises SleB and CwlJ. B. polymyxa var. colistinus produces commercially important peptide antibiotics, colistins, which have effects on gram-negative bacteria (Koyama et al. 1950; Suzuki et al. 1963). During large-scale production of colistins in a fermenter, the cells lyse rapidly in the early stationary phase (our unpublished results). To avoid cell lysis and to achieve a higher yield of antibiotic, it is important to determine the properties of autolysins. Therefore, we puri®ed and characterized a major autolysin produced by B. polymyxa var. colistinus (Kawahara et al. 1997). This autolysin (CwlV) is an N-acetylmuramoyl-L-alanine amidase with a Mr of 23 kDa. Its N-terminal amino acid sequence is NSXGKKVVVIDAGXGAKD (X, undetermined amino acid residue). In this paper, we describe the cloning and characterization of the cwlV gene and its upstream and downstream regions. We also describe a gene for a new cell wall hydrolase, cwlU, which is highly homologous to cwlV; cwlV and cwlU are tandemly arranged on the chromosome. Moreover, we describe zymographic analysis of the gene products, CwlV and CwlU, and their catalytic domains.
Materials and methods Bacteria, growth conditions and plasmids The colistin-producing strain B. polymyxa var. colistinus Asp-14332 was used for preparing DNA and cell walls (Kawahara et al. 1997). B. subtilis 168S (Akamatsu and Sekiguchi 1987) was also used for preparing cell walls. Escherichia coli JM109 was used as a cloning host and E. coli M15 (pREP4) (Qiagen) was used for the production of autolysins. Plasmids pUC118 and pUC119 (Takara), and a His-tag plasmid, pQE-30 (Qiagen), were used to clone the cwlV and cwlU genes, and for production of the catalytic domains of CwlU and CwlV, respectively. Plasmid pSPT18 (Boehringer) was used for the synthesis of RNA probes. B. polymyxa var. colistinus was grown in shaken cultures at 33° C in S medium consisting of 10 g of meat extract (Kyokuto), 10 g of polypeptone (Kyokuto), 5 g of yeast extract (D-3; Wako), 10 g of maltose and 5 g of NaCl per liter, at pH 6.0 or pH 6.5. E. coli was cultured with agitation at 37° C in LB medium (Sambrook et al. 1989) or LB medium supplemented with 2% glucose. If necessary, ampicillin and kanamycin were added at ®nal concentrations of 100 lg/ml and 25 lg/ml, respectively. DNA sequencing, PCR and transformation Nucleotide sequencing was performed with double-stranded plasmid DNA as a template, using the M13 primers M13RV, M13M3 and M13M4 (Takara). Oligonucleotide primers were synthesized on an Applied Biosystems 391S DNA synthesizer, or purchased from Sawaday Technology (Tokyo) or OligoService (Tsukuba).
Sequencing was performed with an Applied Biosystems Model 373A DNA sequencer using a Dye Terminator or a Dye Primer Cycle sequencing kit (Applied Biosystems). Some of the PCR products were sequenced by the shotgun sequencing method as described previously (Yamamoto et al. 1996). To ®ll in gaps or to determine the sequence of an opposite strand (where needed), oligonucleotide primers were also synthesized. The sequences of both strands were determined for the 8.4-kb region containing the cwlU and cwlV genes. The fragments inserted in the His-tag plasmid were sequenced to rule out the possibility of fortuitous mutations. PCR was performed with a GeneAmp PCR System 9600 (Applied Biosystems) using Taq polymerase and the primers shown in Table 1, according to the manufacturer's instructions. Transformation of E. coli was performed as described by Sambrook et al. (1989). Computer analysis The DNA sequences obtained were compiled using an autoassembler (INHERIT; Applied Biosystems) and further analyzed to locate possible ORFs using GeneWorks (IntelliGenetics) or GENETYX-MAC (Software Development). The amino acid sequences of the putative products of ORFs were examined for similarity to sequences reported previously in a non-redundant protein sequence data bank using the FASTA and BLAST search programs on the DDBJ server. Multiple alignment was performed using CLUSTAL W (Thompson et al. 1994) with tree and bootstrap software (supported by DDBJ), and the tree was drawn with TREEVIEW Software (DDBJ). Ampli®cation and sequencing of the V29-PvuII and V18.2-Sau3AI fragments To sequence part of the cell wall hydrolase gene cwlV of B. polymyxa var. colistinus, 29 mer oligonucleotides (V29; Table 1) were synthesized based on the amino acid sequence GKKVVVIDAG in the previously identi®ed N-terminal amino acid sequence of the mature CwlV protein (Kawahara et al. 1997). B. polymyxa var. colistinus DNA was digested with HindIII and PvuII, followed by ligation to HindIII and SmaI-digested and alkaline phosphatase-treated pUC118 DNA. The ligated DNA was precipitated with ethanol and then suspended in ultra-pure water. A fragment was ampli®ed from this DNA by PCR using the primers V29 and M13RV (Takara). The resulting fragment (0.4 kb; the V29-PvuII fragment) was sequenced using the V29 and M13RV primers. Based on the sequence of the V29-PvuII fragment, the ¯anking region was also ampli®ed. The chromosomal DNA was digested with Sau3AI, followed by ligation to BamHI-digested and alkaline phosphatase-treated pUC118 DNA. To amplify the fragment V18.2-Sau3AI, PCR was ®rst performed with the primers V325.1 and M13 M4 (Takara), and then a 1-ll sample from the ®rst PCR was used for a second PCR using the inside primers V18.2 and M13 M3 (Takara). The V18.2-Sau3AI fragment was puri®ed with a Geneclean II kit (Bio 101), and then blunt-ended with T4 DNA polymerase. Each fragment was ligated to SmaI-digested pUC118 DNA, and transformed into E. coli JM109. The V18.2-Sau3AI fragment was sequenced as described above.
Ampli®cation and sequencing of the V18.1-EcoRV, U2-HindIII and InvEcoT22I fragments Chromosomal DNA was digested with EcoRV, followed by ligation to SmaI-digested and alkaline phosphatase-treated pUC118 DNA. The ®rst PCR was performed with the primers V325.2 and M13 M4, followed by a second PCR with the inside primers V18.1
740 Table 1 Primers used in this study
Primer a
V29 V18.1 V18.2 V325.1 V325.2 owetFWb owetRVb owetRV2b V1.2c VcatBFc V2c UDSBFc UcatBFc U2 PEXV PEXU Useq U1.2c
Sequence
Position (5¢®3¢)
GGIAAA/GAAA/GGTIGTIGTIATT/C/AGAT/CGCIGG CGAAATACCAACTGCCCC CATTCGTTATGGGAATTT AAAGACCTTCAACCTGGCG CGTTTCCCGAATTACATGG TGTAAAACGACGGCCAGTGCCTCTAAGCAAACATCG CAGGAAACAGCTATGACCCAGATATCCTACTTCAAGC CAGGAAACAGCTATGACCGCATTTACGGCTTCTTGC CGCGGATCCGCTTCGAGTGGAACACAAATC GCGCGGATCCAACAGCAATGGTAAAAAGGTT GCGCCAAGCTTCCTTACTTGACGTTGGCAAGCG GCGCGGATCCGAATTGTTTTTGGATGGCAA GCGCGGATCCTATGTCGAAGGACGGCG AATAGCTTATATCACAAGCC AACCGCCCACATGAAGAC ATAGCCGCTAGTATCACC AATCGCACCGTCTTTTGC CGGAATTCTGTTTTTGGATGGCAAAAGG
3596 3661 3964 3676 4000 4251 4036
® ® ® ® ® ® ®
s3624 3644 3981 3694 3982 4268 4018
2708 3587 4173 854 1763 2368 2689 804 228 858
® ® ® ® ® ® ® ® ® ®
2728 3607 4152 873 1779 2349 2672 787 245 877
a
I, inosine The 5¢ end regions of the primers owetFW, owetRV and owetRV2 primers anneal to the sequencing primers )21 M13 FW and M13 REV, which are indicated in italics c The restriction sites for BamHI (V1.2, VcatBF, UDSBF, UcatBF), HindIII (V2) and EcoRI (U1.2) in the indicated primers are underlined b
and M13 M3, and 1 ll of the ®rst PCR product. The ampli®ed fragment (approximately 2 kb; V18.1-EcoRV) was used to construct a randomly overlapping library for sequencing (Yamamoto et al. 1996). To sequence the region further upstream of the cwlV gene, chromosomal DNA was digested with HindIII and PvuII, followed by ligation to HindIII+SmaI-digested and alkaline phosphatasetreated pUC118 DNA. A fragment was ampli®ed from this DNA by PCR with primers U2 and M13 M4. The 2.4-kb fragment (U2HindIII) was used to construct a randomly overlapping library for sequencing. B. polymyxa var. colistinus chromosomal DNA (5 lg) was completely digested with EcoT22I (Takara), followed by extraction with phenol/chloroform and precipitation with ethanol. The digested DNA fragments were suspended in 100 ll of ultra-pure water, and a 20-ll aliquot was mixed with T4 DNA ligase (0.8 ll; Nippon Gene), 10´ buer (100 ll; Nippon Gene) and ultra-pure water (879 ll). After reaction, the self-ligated DNA solution was concentrated with a Centricon-100 (Amicon) to 30 ll. A EcoT22I DNA fragment was ampli®ed by PCR with rTth DNA polymerase XL (Perkin Elmer), owetRV and owetFW as primers, and the selfligated DNA as a template. After sequencing of the distal end from cwlV with primer M13 REV (Table 1), a new primer, owetRV2, was synthesized based on the sequence obtained. Then a 4.5-kb fragment (InvEcoT22I fragment) was ampli®ed with DNA polymerase XL, owetFW and owetRV2 as primers, and B. polymyxa var. colistinus DNA as a template, and used to construct a randomly overlapping library for sequencing. RNA analysis A cell suspension (20 OD660) in S medium (Kawahara et al. 1997) was centrifuged, frozen in liquid nitrogen and then stored at )80° C. Then pellets were disrupted in a mortar containing liquid nitrogen. The cell extract was used for RNA preparation with Isogen (Nippon Gene) according to the manufacturer's instructions. Northern blot analysis of RNAs fractionated by electrophoresis in agarose gels containing formaldehyde was performed as described by Sambrook et al. (1989). RNA probes were prepared with a DIG RNA labeling kit (Boehringer Mannheim). For the cwlU- and cwlV-speci®c probes, 1.6 and 1.5-kb fragments containing the respective structural genes were cloned into pSPT18, resulting in plasmids pSPTU and pSPTV. These plasmid
DNAs were digested with HindIII and then subjected to agarose gel electrophoresis. Plasmids were extracted from the gel and puri®ed with a Geneclean II kit, and used for run-o transcription with SP6 RNA polymerase. Hybridization with the RNA probes was performed according to the label manufacturer's instructions. Primer-extension analysis was performed as described previously (Kuroda and Sekiguchi 1993). The primers PEXU and PEXV (Table 1) were complementary to nucleotides 787±804 and 2672± 2689 in the sequence in Fig. 2, respectively. The primers were 5¢ labeled with [c-32P]ATP (3,000 Ci/mmol; Amersham) and T4 polynucleotide kinase (Nippon Gene) according to the manufacturer's instructions. Templates for the sequencing ladder were prepared as follows. For the cwlU template, the PCR product ampli®ed with primers Useq and U1.2 (Table 1) was digested with PstI and DraI, and the 0.6-kb fragment containing the upstream region of the cwlU gene was ligated to the PstI and HincII sites of pUC118, resulting in pUCUU. For the cwlV template, the PCR product ampli®ed with primers U1.2 and V2 (Table 1) was subjected to a ®ll-in reaction with T4 DNA polymerase. Then the product was digested with EcoRI, followed by ligation with the EcoRI and SmaI sites of pUC118, resulting in pUCUV. Sequencing ladders were created with a BcaBEST Dideoxy Sequencing Kit-dATP Version (Takara) according to the manufacturer's instructions. Construction of Vcat and Ucat expression plasmids The catalytic regions of cwlV and cwlU were ampli®ed by PCR with the primer pairs VcatBF and V2, and UcatBF and U2, respectively (Fig. 1 and Table 1), and B. polymyxa var. colistinus DNA as a template. Then the ampli®ed fragment of cwlV was digested with BamHI and HindIII, followed by ligation to the corresponding sites of pQE-30. The resultant plasmid, pQEVcat, was used for the transformation of E. coli M15 (pREP4). The ampli®ed fragment of cwlU was ®lled in with T4 DNA polymerase, and digested with BamHI. The resulting fragment was ligated to the BamHI and SmaI sites of pQE-30, yielding the plasmid pQEUcat. The regions of cwlV and cwlU without signal sequences were ampli®ed by PCR with the primer pairs V1.2 and V2, and UDSBF and U2, respectively (Fig. 1 and Table 1), and B. polymyxa DNA as a template. The cwlV fragment was digested with BamHI and HindIII, followed by ligation to the corresponding sites of
741
Fig. 1 Structure and genetic organization of the region around the cwlV gene on the B. polymyxa var. colistinus chromosome. The upper part of the Figure shows physical and genetic maps of the B. polymyxa var. colistinus chromosome. The large arrows indicate the direction of transcription, and the thin arrows indicate the positions and directions of the directly repeated amino acid sequences. Hatched boxes indicate the putative signal sequences and stippled boxes indicate the regions that encode the catalytic domains of the cell wall hydrolases. Fragments ampli®ed by PCR, and their inserts in pQEUDS, pQEUcat, pQEVDS and pQEVcat are shown in the lower part of the Figure. The arrows indicate the positions and directions of the primers pQE-30. The resulting plasmid, pQEVDS, was used for the transformation of E. coli M15 (pREP4). The cwlU fragment was ®lled in, and digested with BamHI. The resulting plasmid was ligated to the BamHI and HincII sites of pQE-30, yielding the plasmid pQEUDS. Preparation of bacterial cell walls, SDS-PAGE and zymographic analyses Cell walls of B. subtilis 168S were prepared essentially as described previously (Kuroda and Sekiguchi 1990). For the preparation of B. polymyxa var. colistinus cell wall, cells were boiled in 2 M NaCl for 10 min, and then centrifuged and washed with 0.15 M TRISHCl (pH 8.1). Then the washed cells were suspended into 0.15 M TRIS-HCl (pH 8.1) containing trypsin (0.3 mg/ml). After a 1 h incubation at 37° C, the cells were disrupted by ultrasonication, and cell walls were prepared as described previously (Kuroda and Sekiguchi 1990). SDS-PAGE of proteins and zymography were performed in 12% polyacrylamide gels containing 0.1% (wt/vol) B. polymyxa var. colistinus or B. subtilis cell wall as described by Laemmli (1970) and Rashid et al. (1995b), respectively.
Results Sequencing of the autolysin gene cwlV of B. polymyxa var. colistinus and its ¯anking regions We used a synthetic 29 mer oligonucleotide mixture (V29), based on the N-terminal sequence of an autolysin from B. polymyxa var. colistinus, and M13RV as primers, and B. polymyxa DNA as a template, to amplify
a small fragment (V29-PvuII) of the cwlV region by PCR (Fig. 1). Then, based on the sequence of the V29-PvuII fragment, we synthesized the V18.1 and V18.2 primers, and ampli®ed and sequenced the V18.1-EcoRV and V18.2-Sau3AI fragments, which cover the regions upstream and downstream of the V29-PvuII region, respectively (Fig. 1). Furthermore, we sequenced the U2-HindIII fragment which lies upstream of the V18.1EcoRV region. The region downstream from cwlV was ampli®ed by inverse PCR using the primers owetFW and owetRV2 (Table 1). Thus the sequence of a 4147-bp stretch extending downstream from the PvuII site was obtained (Fig. 1). Nucleotide sequence of cwlV and its ¯anking regions Nucleotide sequencing of the entire 8453 bp region revealed eight ORFs (ORF1-ORF8 numbered from the leftmost ORF in Fig. 1) two of which are incomplete. ORF2, ORF3, ORF4, ORF5, ORF6, and ORF7 comprise 1572, 1497, 648, 672, 270, and 543 bp, respectively, and deduced q-independent transcription terminators (DG )25.0, )22.5, )30.7, )20.2, and )22.7 kcal/mol, respectively) are located between ORF1 and ORF2, ORF2 and ORF3, ORF4 and ORF5, ORF6 and ORF7, and ORF7 and ORF8, respectively (Figs. 1 and 2). The GC contents of ORF2, ORF3, ORF4, ORF5, ORF6, and ORF7 are 45.7%, 46.0%, 46.8%, 46.0%, 41.5%, and 40.0%, respectively. Predicted sequences of CwlV and CwlU ORF3 corresponds to the cwlV gene, which encodes a polypeptide of 499 residues (Mr, 53,707). The N-terminal region (amino acids 1±23) is assumed to be a signal sequence, because it contains two positively charged amino acids (K2 and K3), followed by a hydrophobic core (aa 4±17) and a signal peptide cleavage site
742
(G21HA¯A24; the consensus sequence is underlined and the arrow indicates the predicted cleavage site). The N-terminal sequence of the mature CwlV (NSXGKKVVVIDAGXGAKD, where X is undetermined; Kawahara et al. 1997) extends from position 317 with respect to the N-terminus of the unprocessed CwlV (Fig. 2). Therefore, the mature CwlV is a polypeptide of 183 aa, with a pI of 9.26 and a Mr of 20,050 Da. Since the mature CwlV puri®ed from a B. polymyxa culture exhibits a Mr of 23 kDa on SDS-PAGE, its size corresponds reasonably well to that expected from the sequencing results. The amino acid sequence of CwlV exhibits a high degree of similarity to those of the catalytic domains of B. subtilis CwlB (39.8% identity over 176 aa; Kuroda and Sekiguchi 1991), CwlC (31.5% over 178 aa; Kuroda et al. 1993), CwlD (28.9% over 194 aa; Sekiguchi et al. 1995), B. licheniformis CwlM (30.3% over 175 aa; Kuroda et al. 1992), and E. coli AmiA (30.1% over 226 aa; Troup et al. 1994) and AmiB (25.0% over 380 aa; Tsui et al. 1994) (data not shown). There is no signi®cant similarity between the non-catalytic domain of CwlV and those of cell wall hydrolases. However, CwlV has typical direct repeats (aa 54±69 and 116±131) in its N-terminal portion (Fig. 2). ORF2 encodes a polypeptide (Mr, 56,879 Da) of 524 aa (Fig. 2). Amino acid sequence comparisons surprisingly revealed that ORF2 also exhibits a high degree of homology with the catalytic domains of CwlB (34.9% identity over 175 aa), CwlC (33.7% over 187 aa), CwlD (28.7% over 202 aa), CwlM (32.9% over 173 aa), AmiA (29.1% over 233 aa), and AmiB (30.4% over 237 aa). Pairwise comparison of the CwlU and CwlV proteins indicated that they are 47.8% identical over 182 aa of the catalytic domain and 34.9% identical over the entire sequence (data not shown). CwlU also contains a deduced signal sequence at its N-terminal region [two positively charged aa, K2 and K3, followed by a hydrophobic core (aa 4±17) and a deduced signal sequence cleavage site, V23NA¯A26] (Fig. 2). Direct repeats were found at aa 53±72 and 115±134. Characterization of the other ORFs The amino acid sequence of the C-terminal part of ORF1 exhibits signi®cant similarity with those of the 3isopropylmalate dehydratase genes (leuD) of Haemophilus in¯uenzae (Fleischmann et al. 1995), E. coli (Yura et al. 1992), B. subtilis (Wipat et al. 1996), and Salmonella typhimurium (Friedberg et al. 1985). Since there is a typical q-independent terminator downstream of leuD, leuD and cwlU seem to be transcribed independently (Fig. 1). On the other hand, the N-terminal portion of the product of ORF4, which lies downstream of cwlV, and encodes 216 aa (Mr, 23,259 Da), exhibits signi®cant similarity to lipoproteins of Neisseria gonorrhoeae (Hoehn and Clark 1992) and Mycobacterium avium (Booth et al. 1993). ORF4 (orf W ) seems to contain a signal sequence [two positively charged residues, K3 and
K4, followed by a hydrophobic core (aa 5±16)], and its product may be a lipoprotein, because the sequence A17GAGC21 is similar to the consensus sequence for lipoproteins [L/A/V/ILA/S/VG/A¯C; the arrow indicates the signal sequence cleavage site] (Wu and Tokunaga 1986). ORF5 encodes a polypeptide (Mr, 25,538 Da) of 224 aa, and exhibits extremely high sequence similarity to a probable endonuclease III of B. subtilis (71.8% over 209 aa; Bruand et al. 1995) and endonuclease III of E. coli (45.9% over 209 aa; Asahara et al. 1989). ORF6 (orfX) does not exhibit signi®cant similarity to any proteins in a non-redundant protein database. ORF7 (gpx) encodes a polypeptide (Mr, 20,860 Da) of 181 aa and exhibits high similarity to the glutathione peroxidase homologs of Neisseria meningitidis (41.4% over 181 aa; Moore and Sparling 1995) and B. subtilis ([sp:BSAA_BACSU] 44.8% over 181 aa; A. V. Sorokin, V. Azevedo, E. Zumstein, N. Galleron, S. D. Ehrlich, P. Serror 1996), and with glutathione peroxidase Hyr1p of Saccharomyces cerevisiae ([sp:GSHJ_ YEAST] 40.4% over 178 aa; G. Aljinovic, F. M. Pohl, T. M. Pohl 1994). The partial sequence of ORF8 exhibits high similarity with that of a hypothetical protein of B. subtilis ([sp: YPBR_BACSU]; Iwakura et al. 1988). Expression of cwlV and cwlU in B. polymyxa var. colistinus The Northern analysis in Fig. 3 shows that only one transcript hybridized to an RNA probe containing the cwlU gene. This transcript, estimated to be 1.6 kb long, was detected in 8±12 h cultures (i.e. exponential to early stationary growth phase). Since the cwlU gene consists of 1584 bp, and deduced q-independent terminators are located between leuD and cwlU, and between cwlU and cwlV, cwlU is monocistronically transcribed. A dierent transcript (2.3 kb) hybridized to a probe containing the cwlV gene, and was strongly detected in a 24-h culture, which corresponds to the stationary phase (Fig. 3). Since the cwlV and orfW genes comprise 1497 bp and 648 bp, respectively, and the distance between these genes is 52 bp, and a q-independent terminator is present between orfW and ORF5, cwlV is probably transcribed together with orfW. These data clearly indicate that cwlU and cwlV are expressed independently. From the sequence information and the results of Northern analysis, it seemed likely that the 5¢ ends of the cwlU and cwlV transcripts are located immediately upstream of the cwlU and cwlV genes, respectively. The cwlU transcript was observed by primer extension analysis in RNA from cells at 8 and 12 h (Fig. 4A). Assuming that the transcript ends at the putative terminator, the length of the transcript calculated from the sequence is 1.67 kb (Fig. 2). From the similarities in length, the primer extension products seem to correspond to the 5¢ end of the 1.6-kb transcript. The )35 (TTGACG) and )10 (TATTGT) regions, which are 16 bp apart, are very similar to those of the B. subtilis rA
743 Fig. 2 Nucleotide sequence of the leuD-cwlU-cwlV-orfW region. Only the sequence of the non-transcribed DNA is shown, from position +1 to 5040 bp. The putative amino acid sequences of the orfs are shown below the nucleotide sequence, and the amino acid numbers given are de®ned with respect to the N-terminal amino acid of each protein. The putative ribosome binding sites (RBS) and deduced promoter regions ()35 and )10 regions) are underlined. Oppositely oriented arrows indicate inverted repeats. Filled and open arrowheads indicate transcriptional start sites and deduced signal sequence cleavage sites, respectively. Dots indicate amino acid residues determined by N-terminal amino acid sequencing. Amino acid sequence repeats are indicated by broken underlines below the amino acid sequence. The sequence data have been submitted to the DDBJ/EMBL/GenBank DNA databases under Accession No. AB003153
744
Production of CwlV and CwlU in E. coli
Fig. 3 Northern analysis of the cwlU and cwlV genes. Each lane contained 7 lg of RNA from a B. polymyxa var. colistinus culture grown at 33° C for 8, 12, 24, 36 or 48 h. Northern hybridization was performed with RNA probes speci®c for the cwlU and cwlV genes, as described under Materials and methods. The positions of 23S rRNA (2.9 kb) and 16S RNA (1.6 kb) are shown by open arrowheads. Signi®cant hybridization bands are indicated by ®lled arrowheads and the transcript sizes are indicated
consensus sequence (TTGACA for the )35 region and TATAAT for the )10 region with spacing of 17 bp) (Moran 1993). The transcriptional signal of cwlV was observed clearly with RNAs from cells at 24 h (Fig. 4B). Since the terminator is located downstream of orfW, we assume the signal corresponds to the transcriptional initiation site of cwlV. The promoter region of cwlV shows rather high similarity to the consensus sequence of the )10 region of the B. subtilis rA promoter, but very weak similarity to that of the )35 region (Fig. 2).
The 3¢ terminal regions of cwlV and cwlU were ampli®ed and ligated to a His-tag plasmid, pQE-30. Therefore, the cwlV insert encoded a small His-tag sequence (MRGSH HHHHHGS) and the mature CwlV protein sequence (N317±K499 in Fig. 2). The corresponding cwlU insert encoded the above His-tag sequence and the deduced mature CwlU protein sequence (Y332±N524 in Fig. 2). The resultant plasmids, pQEVcat and pQEUcat, were used to transform E. coli M15 (pREP4). The entire coding regions of cwlV and cwlU, with the exception of the signal sequences, were also ampli®ed and ligated to pQE-30, resulting in pQEVDS and pQEUDS. The Histagged proteins were produced in E. coli, followed by puri®cation on a nickel column (data not shown). Figure 5A shows puri®ed protein bands of 26, 27, 55 and 55 kDa corresponding to Vcat (Mr, 21,425 Da; 195 aa), Ucat (Mr, 22,239 Da; 212 aa), VDS (Mr, 52,393 Da, 488 aa) and UDS (Mr, 55,141 Da; 508 aa), respectively, on SDS-PA gels. Zymography of the proteins revealed that Vcat exhibits a strong activity toward B. subtilis and B. polymyxa var. colistinus cell walls, but that Ucat exhibits weak activity and almost no activity toward B. polymyxa and B. subtilis cell walls, respectively (Fig. 5). VDS exhibited very weak activity toward B. polymyxa cell wall and almost no activity toward B. subtilis cell wall. UDS exhibited almost no activity toward B. polymyxa and no activity toward B. subtilis. In spite of their extremely high sequence similarity (47.8%), it is interesting the mature proteins exhibit quite dierent activities. Moreover, their precursor proteins exhibited much lower activities than the putative mature proteins (Fig. 5). Phylogenetic analysis of CwlV and CwlU
Fig. 4A, B Determination of transcription start sites by primerextension analysis. RNAs (5 lg each) were hybridized with the speci®c 5¢ end-labeled primers PEXU and PEXV (Table 1). The extended products obtained with reverse transcriptase were subjected to electrophoresis in 6% (wt/vol) polyacrylamide sequencing gels and signals were analyzed with a multi bioimager (STORM 860; Molecular Dynamics) on an imaging plate (BAS-MP; Fuji). Dideoxy DNA sequencing reactions with the same primers were electrophoresed in parallel (lanes G, A, T and C). The positions of the products are indicated by arrowheads on the sequencing gels and in the corresponding nucleotide sequences. A cwlU, B cwlV
Cell wall hydrolyzing amidases, and orthologs of CwlU and CwlV were compared, and a neighbor-joining dendrogram of the sequences of the catalytic domains of class II amidases is presented in Fig. 6. Since CwlU and CwlV belong to the same subclass and they are tandemly arranged on the B. polymyxa chromosome (Fig. 2), it is very likely that both CwlU and CwlV arose from a common ancestral enzyme through gene duplication and evolved into the present enzymes adapted for their respective cellular functions. The high degree of sequence similarity between the non-catalytic domains of CwlU and CwlV also supports the above prediction. Recent research on cell wall hydrolases in B. subtilis has indicated that cell separation, cell wall turnover, motility, mother cell lysis and spore germination are greatly aected by the combination of cell wall hydrolases produced (Rashid et al. 1993; Smith and Foster 1995, 1997; Ishikawa et al. 1997; Blackman et al. 1998). The redundancy of CwlU and CwlV suggests that they may play a role in cellular function as a complementary set.
745
Fig. 5A±C SDS-PAGE and zymography of the puri®ed UDS, Ucat, VDS and Vcat proteins. A SDS-PAGE of the recombinant UDS, Ucat, VDS and Vcat proteins puri®ed from cultures of E. coli M15 (pREP4, pQEUDS), M15 (pREP4, pQEUcat), M15 (pREP4, pQEVDS) and M15 (pREP4, pQEVcat). The gel was stained with Coomassie Brilliant Blue. B Zymograph of activity toward B. polymyxa var. colistinus cell wall. C Zymograph of activity toward B. subtilis cell wall. Zymography was carried out as described previously (Rashid et al. 1995b). Lane M contained protein standards (Bio-Rad), the molecular masses of which are shown on the left in A. One microgram of each protein was applied to the gels
Discussion The cwlU gene is transcribed as a single cistron and the cwlV gene is transcribed together with the orfW gene. The autolysin gene of phage PBS1, xlyA (Longchamp et al. 1994), the deduced phage-derived autolysin gene cwlA (Foster 1991), and the homologous gene in B. licheniformis (Lee et al. 1991; Oda et al. 1993) are transcribed together with holin genes. These amidases are members of class I, and the holin gene products form holes in the cell membrane, thereby stimulating leakage of the cell wall hydrolases (autolysins), which facilitates cell lysis (Young 1992; Steiner et al. 1993). In the case of B. polymyxa var. colistinus, cells lyse rapidly during the early stationary phase. However, the gene immediately upstream of cwlUV is leuD, and the downstream gene, orfW, is not a holin gene, but a lipoprotein gene. Therefore, passage of CwlU and CwlV across the cell membrane is probably not facilitated by holin activity. CwlA, CwlL and XlyA do not contain a typical signal sequence and belong to the phage-related lytic enzymes of class I, but CwlU and CwlV contain signal sequences and belong to class II amidases, which include CwlB, CwlC and CwlD. The major autolysin gene, cwlB, is polycistronically transcribed with a lipoprotein gene, lppX, and a modi®er protein gene, cwbA (Lazarevic et al. 1992; Kuroda and Sekiguchi 1993). Therefore, the operon structure of cwlV is similar to that of cwlB, except for the loss of the cwbA homolog. The recently published B. subtilis genome sequence (Kunst et al. 1997) suggests the existence of other lipoprotein genes that seem to form operons with cell wall hydrolase genes, i.e., yqiH (lipoprotein)-yqiI (class II amidase homolog)-yqiK (glycerophosphoryl diester phosphodiesterase homolog),
yddE (transposon protein homolog)-yddF-yddG-yddH (CwlF type endopeptidase homolog)-yddI-yddJ (lipoprotein), and yqgT(B. sphaericus endopeptidase I homolog)-yqgU (lipoprotein)-yqgV. YqiH exhibits 34.3% sequence identity over 99 aa with LppX, but does not show any sequence similarity to OrfW. YqiI exhibits 53.1%, 36.1% and 41.0% identity over 192, 191 and 183 aa with CwlB, CwlU and CwlV, respectively (data not shown). The physiological roles of lppX and other lipoprotein homologs remain unknown, but ecient secretion through the membrane or interaction of a lipoprotein anchored on the membrane with a cell wall hydrolase have been proposed as their functions. Tandemly organized cell wall hydrolase genes, such as those found in B. polymyxa, are quite rare. But there is another example of tandem arrangement of cell wall hydrolase genes in bacteria. In the E. coli genome, a new amidase homolog, f447 protein (Swiss-Prot P36548), is located just upstream of the gene for a membrane-bound lytic murein transglycosylase, mltA (Blattner et al. 1997). In contrast with the case of f447 and MltA, both cwlU and cwlV are amidase genes and exhibit high sequence similarity. Moreover, it is known that the Staphylococcus aureus atl gene is a fusion product, comprising glucosaminidase and amidase domains (Oshida et al. 1995). This glucosaminidase and amidase act synergistically to disperse cell clusters into single cells (Sugai et al. 1995). The C-terminal regions, corresponding to the catalytic domains of CwlU and CwlV, exhibit high sequence similarity with eight (deduced) amidases from various bacteria (data not shown). The N-terminal regions of CwlU and CwlV are non-catalytic domains which contain tandemly repeated sequences, but do not show any amino acid sequence similarity with other proteins in a non-redundant protein database. In the case of CwlB, the non-catalytic domain plays a role in cell wall binding (Kuroda and Sekiguchi 1991), and in the case of the B. licheniformis autolysin, the C-terminal domain of CwlM confers the substrate speci®city (Kuroda et al. 1992). Since UDS and VDS exhibited much lower activities than Ucat and Vcat, respectively, the non-catalytic domains seem to have a negative eect on cell wall hydrolase activity (Fig. 5). Phylogenetic analysis of class II amidases indicated that the protein pairs CwlU and CwlV, and the major
746
Fig. 6 Neighbor-joining phylogenetic tree of the amino acid sequences of the catalytic domains of class II amidases. Bootstrap values (percentage of 1000 bootstraps) of more than 50% are shown near the internodes, and topologies that are supported by more than 95% of the bootstrap trees are depicted in bold. The amino acid positions (with respect to the N-terminal amino acid sequence of each protein) of the sequences used for construction of the tree are as follows: B. polymyxa CwlV and CwlU (residues 322±497, and 337±515, respectively; Fig. 2), Synechocystis s75217, s74823, and s77287 (residues 164±338, 474±647, and 348±518, respectively; Kaneko et al. 1996), E. coli AmiA (residues 57±277; Troup et al. 1994), AmiB (residues 192±417; Tsui et al. 1994), and f447 (residues 218±438; Blattner et al. 1997), S. typhimurium AmiA (residues 57±277; Xu and Elliott 1993), H. in¯uenzae AmiB (residues 23±248; Fleischmann et al. 1995), H. pylori AmiA (residues 217±437; Tomb et al. 1997), C. perfringens s49554 (residues 1±178; Lyristis et al. 1994) and YpiX (residues 1±178; Garnier and Cole 1988), Bacillus LytP (residues 2± 176; Yu 1994, GenBank Accession No. X60071), B. subtilis CwlD (residues 41±230; Sekiguchi et al. 1995), CwlB (residues 320±496; Kuroda and Sekiguchi 1991), CwlC (residues 2±176; Kuroda et al. 1993), YqiI and YrvJ (residues 30±205, and 348±518, respectively; Kunst et al. 1997), and B. licheniformis CwlM (residues 2±176; Kuroda et al. 1992)
B. subtilis vegetative autolysin, CwlB, and its paralog YqiI, are members of the same subclasses, respectively (Fig. 6). As described above, the latter two genes form or presumably form operons with lipoprotein genes. B. subtilis CwlC, B. licheniformis CwlM, and Bacillus sp. LytP belong to the same subclass, but B. subtilis CwlD is in a dierent subclass. CwlB plays a role in the autolysis of vegetative cells and in cell wall turnover during the vegetative phase (Kuroda and Sekiguchi 1991; Margot et al. 1994; Blackman et al. 1998), and a role in mother cell lysis in combination with CwlC (Smith and Foster 1995). CwlC is produced during the late sporulation
phase (Kuroda et al. 1993). CwlD is produced during the middle sporulation phase (Sekiguchi et al. 1995) and plays a role in cortex maturation (Atrih et al. 1996; Popham et al. 1996). Therefore, it is probable that these dierent subclasses re¯ect dierent cellular functions. This paper provides the ®rst instance of the tandem organization of a pair of the same type of cell wall hydrolase genes on the chromosome. Moreover, these genes are functional, are expressed independently and their products retain enzyme activity. In the extracellular fraction of B. polymyxa var. colistinus, several autolysins with dierent Mrs were found on zymographs, a 23-kDa autolysin being the major cell wall hydrolase in amount (data not shown). Therefore, it would be interesting to determine the substrate speci®city and cell wall-binding ability of the unprocessed forms of CwlV and CwlU, and compare them with those of their mature derivatives. Acknowledgements This research was partly supported by Grantin-Aid for Scienti®c Research on Priority Areas (No. 296) from the Ministry of Education, Science, Sports and Culture.
References Akamatsu T, Sekiguchi J (1987) Genetic mapping and properties of ®lamentous mutations in Bacillus subtilis. Agric Biol Chem 51:2901±2909 Asahara H, Wistort PM, Bank JF, Bakerian BH, Cunningham RP (1989) Puri®cation and characterization of Escherichia coli endonuclease III from the cloned nth gene. Biochemistry 28:4444±4449
747 Atrih A, ZoÈllner P, Allmaier G, Foster SJ (1996) Structural analysis of Bacillus subtilis 168 endospore peptidoglycan and its role during dierentiation. J Bacteriol 178:6173±6183 Blackman SA, Smith TJ, Foster SJ (1998) The role of autolysins during vegetative growth of Bacillus subtilis 168. Microbiology 144:73±82 Blattner FR, et al (1997) The complete genome sequence of Escherichia coli K12. Science 277:1453±1474 Booth RJ, Williams DL, Moudgil KD, Noonan LC, Grandison PM, McKee JJ, Prestidge RL, Watson JD (1993) Homologs of Mycobacterium leprae 18-kilodalton and Mycobacterium tuberculosis 19-kilodalton antigens in other mycobacteria. Infect Immun 61:1509±1515 Bruand C, Sorokin A, Serror P, Ehrlich SD (1995) Nucleotide sequence of the Bacillus subtilis dnaD gene. Microbiology 141:321±322 da Silva E, Longchamp PF, Karamata D (1997) Identi®cation of XlyB, the second lytic enzyme of the defective prophage PBSX. In: Abstracts of the Ninth International Conference on Bacilli, July 15±19, Universite de Lausanne, Lausanne, p 25 Doyle RJ, Koch AL (1987) The functions of autolysins in the growth and division of Bacillus subtilis. Crit Rev Microbiol 15:169±222 Fleischmann RD, et al (1995) Whole-genome random sequencing and assembly of Haemophilus in¯uenzae Rd. Science 269:496± 512 Foster SJ (1991) Cloning, expression, sequence analysis and biochemical characterization of an autolytic amidase of Bacillus subtilis 168 trpC2. J Gen Microbiol 137:1987±1998 Friedberg D, Rosenthal ER, Jones JW, Calvo JM (1985) Characterization of the 3¢ end of the leucine operon of Salmonella typhimurium. Mol Gen Genet 199:486±494 Garnier T, Cole ST (1988) Complete nucleotide sequence and genetic organization of the bacteriocinogenic plasmid, pIP404, from Clostridium perfringens. Plasmid 19:134±150 Herbold DR, Glaser L (1975) Bacillus subtilis N-acetylmuramic acid L-alanine amidase. J Biol Chem 250:1676±1682 Hoehn GT, Clark VL (1992) The major anaerobically induced outer membrane protein of Neisseria gonorrhoeae, Pan 1, is a lipoprotein. Infect Immun 60:4704±4708 Ishikawa S, Hara Y, Yamane K, Sekiguchi J (1997) Regulation and characterization of new deduced cell wall hydrolase genes (cwlJ and cwlF) which are produced during sporulation and vegetative growth phases, respectively, of Bacillus subtilis. In: Abstracts of the Ninth International Conference on Bacilli, July 15±19, Universite de Lausanne, Lausanne, p 10 Ishikawa S, Yamane K, Sekiguchi J (1998) Regulation and characterization of a newly deduced cell wall hydrolase gene (cwlJ) which aects germination of Bacillus subtilis spores. J Bacteriol 180:1375±1380 Iwakura M, Kawata M, Tsuda K, Tanaka T (1988) Nucleotide sequence of the thymidylate synthase B and dihydrofolate reductase genes obtained in one Bacillus subtilis operon. Gene 64:9±20 Kaneko T, et al (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3:109±136 Kawahara S, Utsunomiya C, Ishikawa S, Sekiguchi J (1997) Puri®cation and characterization of an autolysin of Bacillus polymyxa var. colistinus which is most active at acidic pH. J Ferment Bioeng 83:419±422 Koyama Y, Kurosawa A, Tsuchiya A, Takakura K (1950) A new antibiotic `colistin' produced by spore-forming soil bacteria. J Antibiot 3:457±458 (in Japanese) Kunst F, et al (1997) The complete genome sequence of the Grampositive bacterium Bacillus subtilis. Nature 390:249±256 Kuroda A, Sekiguchi J (1990) Cloning, sequencing and genetic mapping of a Bacillus subtilis cell wall hydrolase gene. J Gen Microbiol 136:2209±2216 Kuroda A, Sekiguchi J (1991) Molecular cloning and sequencing of a major Bacillus subtilis autolysin gene. J Bacteriol 173:7304± 7312
Kuroda A, Sekiguchi J (1993) High-level transcription of the major Bacillus subtilis autolysin operon depends on expression of the sigma D gene and is aected by a sin(¯aD) mutation. J Bacteriol 175:795±801 Kuroda A, Sugimoto Y, Funahashi T, Sekiguchi J (1992) Genetic structure, isolation and characterization of a Bacillus licheniformis cell wall hydrolase. Mol Gen Genet 234:129±137 Kuroda A, Asami Y, Sekiguchi J (1993) Molecular cloning of a sporulation-speci®c cell wall hydrolase gene of Bacillus subtilis. J Bacteriol 175:6260±6268 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680±685 Lazarevic V, Margot P, Soldo B, Karamata D (1992) Sequencing and analysis of the Bacillus subtilis lytRABC divergon: a regulatory unit encompassing the structural genes of the N-acetylmuramoyl-L-alanine amidase and its modi®er. J Gen Microbiol 138:1949±1961 Lee JK, Edwards CW, Hulett FM (1991) Identi®cation of four unique clones encoding 10 kDa proteins from Bacillus that cause phenotypic complementation of a phoA mutant strain of Escherichia coli. J Gen Microbiol 137:667±677 Longchamp PF, MaueÈl C, Karamata D (1994) Lytic enzymes associated with defective prophages of Bacillus subtilis: sequencing and characterization of the region comprising the Nacetylmuramoyl-L-alanine amidase gene of prophage PBSX. Microbiology 140:1855±1867 Lyristis M, Bryant AE, Sloan J, Awad MM, Nisbet IT, Stevens DL, Rood JI (1994) Identi®cation and molecular analysis of a locus that regulates extracellular toxin production in Clostridium perfringens. Mol Microbiol 12:761±777 Margot P, MaueÈl C, Karamata D (1994) The gene of the N-acetylglucosaminidase, a Bacillus subtilis 168 cell wall hydrolase not involved in vegetative cell autolysis. Mol Microbiol 12:535±545 Moore TD, Sparling PF (1995) Isolation and identi®cation of a glutathione peroxidase homolog gene, gpxA, present in Neisseria meningitidis but absent in Neisseria gonorrhoeae. Infect Immun 63:1603±1607 Moran CP Jr (1993) RNA polymerase and transcription factors. In: Sonenshein AL, Hoch JA, Losick R (eds) Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington DC, pp 653±667 Moriyama R, Hattori A, Miyata S, Kudoh S, Makino S (1996a) A gene (sleB) encoding a spore cortex-lytic enzyme from Bacillus subtilis and response of the enzyme to L-alanine-mediated germination. J Bacteriol 178:6059±6063 Moriyama R, Kudoh S, Miyata S, Nonobe S, Hattori A, Makino S (1996b) A germination-speci®c spore cortex-lytic enzyme from Bacillus cereus spores: cloning and sequencing of the gene and molecular characterization of the enzyme. J Bacteriol 178:5330± 5332 Oda Y, Nakayama R, Kuroda A, Sekiguchi J (1993) Molecular cloning, sequence analysis, and characterization of a new cell wall hydrolase, CwlL, of Bacillus licheniformis. Mol Gen Genet 241:380±388 Oshida T, Sugai M, Komatsuzawa H, Hong Y-M, Suginaka H, Tomasz A (1995) A Staphylococcus aureus autolysin that has an N-acetylmuramoyl-L-alanine amidase domain and an endo-bN-acetylglucosaminidase domain: cloning, sequence analysis, and characterization. Proc Natl Acad Sci USA 92:285±289 Popham DL, Helin J, Costello CE, Setlow P (1996) Muramic lactam in peptidoglycan of Bacillus subtilis spores is required for spore outgrowth but not for spore dehydration or heat resistance. Proc Natl Acad Sci USA 93:15405±15410 Potvin C, Leclerc D, Tremblay G, Asselin A, Bellemare G (1988) Cloning, sequencing and expression of a Bacillus bacteriolytic enzyme in Escherichia coli. Mol Gen Genet 214:241±248 Rashid MH, Kuroda A, Sekiguchi J (1993) Bacillus subtilis mutant de®cient in the major autolytic amidase and glucosaminidase is impaired in motility. FEMS Microbiol Lett 112:135±140 Rashid MH, Mori M, Sekiguchi J (1995a) Glucosaminidase of Bacillus subtilis: cloning, regulation, primary structure and biochemical characterization. Microbiology 141:2391±2404
748 Rashid MH, Sato N, Sekiguchi J (1995b) Analysis of the minor autolysins of Bacillus subtilis during vegetative growth by zymography. FEMS Microbiol Lett 132:131±137 Regamey A, Karamata D (1998) The N-acetylmuramoyl-L-alanine amidase encoded by the Bacillus subtilis 168 prophage SPb. Microbiology 144:885±893 Rogers HJ, Perkins HR, Ward JB (1980) Microbial cell walls and membranes. Chapman and Hall, London Rogers HJ, Taylor C, Rayter S, Ward JB (1984) Puri®cation and properties of autolytic endo-b-N-acetylglucosaminidase and the N-acetylmuramoyl-L-alanine amidase from Bacillus subtilis strain 168. J Gen Microbiol 130:2395±2402 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual (2nd edn). Cold Spring Harbor Laboratory Press, Cold Spring harbor, N.Y. Sekiguchi J, Akeo K, Yamamoto H, Khasanov FK, Alonso JC, Kuroda A (1995) Nucleotide sequence and regulation of a new putative cell wall hydrolase gene, cwlD, which aects germination in Bacillus subtilis. J Bacteriol 177:5582±5589 Shockman GD, HoÈltje J-V (1994) Microbial peptidoglycan (murein) hydrolases. In: Ghuysen J-M, Hakenbeck R (eds) Bacterial cell wall. Elsevier, Amsterdam, pp 131±166 Smith TJ, Foster SJ (1995) Characterization of the involvement of two compensatory autolysins in mother cell lysis during sporulation of Bacillus subtilis 168. J Bacteriol 177:3855±3862 Smith TJ, Foster SJ (1997) Autolysins during sporulation of Bacillus subtilis 168. FEMS Microbiol Lett 157:141±147 Steiner M, Lubitz W, BlaÈsi U (1993) The missing link in phage lysis of Gram-positive bacteria: gene 14 of Bacillus subtilis phage /29 encodes the functional homolog of lambda S protein. J Bacteriol 175:1038±1042 Sugai M, Komatsuzawa H, Akiyama T, Hong Y-M, Oshida T, Miyake Y, Yamaguchi T, Suginaka H (1995) Identi®cation of endo-b-N-acetylglucosaminidase and N-acetylmuramyl-L-alanine amidase as cluster-dispersing enzymes in Staphylococcus aureus. J Bacteriol 177:1491±1496
Suzuki T, Inouye H, Fujikawa K, Suketa Y (1963) Studies on the chemical structure of colistin. J Biochem 54:25±33 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speci®c gap penalties and weight matrix choice. Nucleic Acids Res 22:4673±4680 Tomb J-F, et al (1997) The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539±547 Troup B, Jahn M, Hungerer C, Jahn D (1994) Isolation of the hemF operon containing the gene for the Escherichia coli aerobic coproporphyrinogen III oxidase by in vivo complementation of a yeast HEM13 mutant. J Bacteriol 176:673±680 Tsui H-CT, Zhao G, Feng G, Leung H-CE, Winkler ME (1994) The mutL repair gene of Escherichia coli-K12 forms a superoperon with a gene encoding a new cell-wall amidase. Mol Microbiol 11:189±202 Wipat A, Carter N, Brignell SC, Guy BJ, Piper K, Sanders J, Emmerson PT, Harwood CR (1996) The dnaB-pheA (256°±240°) region of the Bacillus subtilis chromosome containing genes responsible for stress responses, the utilization of plant cell walls and primary metabolism. Microbiology 142:3067±3078 Wu HC, Tokunaga M (1986) Biogenesis of lipoproteins in bacteria. Curr Topics Microbiol Immunol 125:127±157 Xu K, Elliott T (1993) An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium. J Bacteriol 175:4990±4999 Yamamoto H, Uchiyama S, Fajar AN, Ogasawara N, Sekiguchi J (1996) Determination of a 12 kb nucleotide sequence around the 76° region of the Bacillus subtilis chromosome. Microbiology 142:1417±1421 Young R (1992) Bacteriophage lysis: mechanism and regulation. Microbiol Rev 56:430±481 Yura T, Mori H, Nagai H, Nagata T, Ishihama A, Fujita N, Isono K, Mizobuchi K, Nakata A (1992) Systematic sequencing of the Escherichia coli genome: analysis of the 0±2.4 min region. Nucleic Acids Res 20:3305±3308
