Organization and variation of the mitochondrial DNA control region in ...

Genes & Genomics (2010) 32: 335-344 DOI 10.1007/s13258-010-0023-8

RESEARCH ARTICLE

Organization and variation of the mitochondrial DNA control region in five Caprinae species Junghwa An · Hideo Okumura · Yun‐Sun Lee · Kyung‐Seok Kim · Mi‐Sook Min · Hang Lee 1)

Received: 25 February 2010 / Accepted: 29 April 2010 / Published online: 31 August 2010 © The Genetics Society of Korea and Springer 2010

Abstract The complete mitochondrial DNA (mtDNA) control region was analyzed from five species of the subfamily Caprinae; Naemorhedus caudatus, N. goral, Capra hircus, Capricornis swinhoei, and Capricornis crispus. Among these species, the control region ranged from 1,096 to 1,212 bp in length. Our results were compatible with the scheme of three domains (ETAS, Central, and CSB) within the control region. A + T < G + C was observed in all the domains. In the Korean gorals, of the 31 variable sites in the whole control region resulting in 15 haplotypes, 27 variable sites were in the ETAS domain. We found two to three tandem repeat in all five species examined in this study, three in N. caudatus and N. goral, two in Capra hircus and C. crispus, and one in C. swinhoei, respectively. All of these repeat units include two short sections of mirror symmetry (TACAT and ATGTA). Short mirror symmetries were well‐resolved among five different species, although left domain has high substitution rates. By Kimura’s two parameter method, the genetic distances between the genera Naemorhedus and Capricornis were calculated and divergence time between Naemorhedus and Capricornis may be nearly 2Myr.

Keywords

Mitochondrial DNA; control region; D loop; Caprinae; Naemorhedus; Capricornis

J. An · Y.‐S. Lee · K.‐S. Kim · M.‐S. Min( ) · H. Lee( ) Conservation Genome Resource Bank for Korean Wildlife (CGRB), Research Institute for Veterinary Science, and College of Veterinary Medicine, Seoul National University, Seoul 151‐742, Korea, e-mail: [email protected] e-mail: [email protected] H. Okumura, Wildlife Ecology Laboratory, Department of Wildlife Biology, Forestry and Forest Product Research Institute, Tsukuba, Ibaraki 305‐8687, Japan

Introduction The mitochondrion is an important cytoplasmic organelle that produces abundant energy for a cell and contains its own genome. Circular mitochondrial genome encodes 13 proteins, 22 transfer RNAs (tRNAs) and two ribosomal RNAs (12S and 16S rRNAs). Mitochondrial genome has been a popular marker of choice for elucidating the phylogenetic relationships of recently diverged species as it is maternally inherited (Giles et al., 1980; Masuda and Yoshida, 1994; Wilson et al., 1985) with no recombination, and mutation rates are approximately 10 times faster than single‐copy nuclear DNA (Brown et al., 1979). The control region, also called the displacement‐loop region (D‐loop), is the main regulatory region for transcription and replication of mtDNA (Desjardins and Morais, 1990; L’Abbe et al., 1991). This region is the only non‐coding area and is Pro Phe located between tRNA and tRNA in mammal mitochondrial DNA. Sbisà et al. (1997) and Pesole (1999) proposed that the mammalian control region contains three major domains including the extended terminal associated sequenced domain (ETAS), central domain, and the conserved sequence block domain (CSB). Although diverse taxa of mammals share the general structure, the functional meaning for each domain has not been clearly understood. Limited studies proposed that the ETAS plays a role in the termination signal for replication (Sbisà et al., 1997), the CSB apprears to operate in priming H‐strand replication (Walberg and Clayton, 1981), and the central domain is presumed to be the site of origin for replication (Sbisà et al., 1997; Shadel and Clayton, 1997). Three domains were structurally inferred from the distribution of the variable nucleotide positions and differential nucleotide frequencies in different parts of the control region (Brwon et al., 1986). ETAS and CSB domains show the majority of the variability in mitochondrial genome because of the variable number tandem repeats (VNTRs), whereas the central domain appears to be more conservative across different taxa (Baker and

336

Marshall, 1997; Sbisà et al., 1997). Owing to the assumption of the most rapidly evolving region of mitochondrial DNA, the control region has been recognized as one of the most popular molecular markers for population genetics and phylogenetic studies of a variety of taxa (e.g., Kirchman and Franklin, 2007 in birds; Takahashi and Goto, 2001 in fishes; Nagata et al., 1999 in Deer; Castro et al., 2007 in whale). In addition, several studies characterizing the overall structure of the control region have aided the better understanding of organization and evolutionary significances across diverse taxa such as in birds (Ruokonen and Kvist 2002), in human (Irwin et al., 2007), in voles (Matson and Baker, 2001), and in fishes (Zhao et al., 2006). Among these structural analyses, a few were taken from the artiodactyls such as in Suidae (Ghivizzani et al., 1993), in Cervidae (Douzery and Randi 1997), in Japanese serow (Okumura 2004), in Sika deer (Nagata et al., 1999), and in sheep (Zardoya et al., 1995). Based on artiodactyls' result, conserved sequence motifs were identified in all three domains. However, the composition of CSB domain (for example, existence of CSB2 and CSB3) in right region of the control region, copy number, sequence size and location of tandem repeat varied across species. For example, the CSB2 and CSB3 have been believed to be absent in artiodactyls from cow studies (Anderson et al., 1982). Sbisà et al. (1997) found out that most artiodactyls contain a fused form of CSB2+CSB3 in the control region except Suidae, which possessed distinct CSB2 and CSB3 segments (Ghivizzanti et al., 1993). CSB1 and polypyrimidine tracts were commonly identified in most mammal species (Dillon and Wright, 1993; Zardoya et al., 1995; Okumura, 2004), and Zardoya (1995) suggested that polypyrimidine tracts might be a commonly shared feature across artiodactyl species. Tandem‐repeated sequences in the control region were not mentioned in early studies on the control region of artiodactyla species (Anderson et al., 1982; Jäger et al., 1992), but subsequent studies on comprehensive analysis of control region organization identified repeated sequences in ETAS and CSB domains for example one repeat of 79 bp in sika deer (Douzery and Randi 1997), maximum seven repeats of 37 to 40 bp in sika deer (Nagata et al., 1999), four repeats of 75 bp in Ovis aries (Wood and Phua 1996), two repeats of 76 bp in Japanese serow (Okumura 2004). The most recent studies on the control region of Caprini, including the genus Naemorhedus and Capricornis, indicated that all Caprini have between two and four tandem repeats of ~75 bp, suggesting that the presence of at least two tandem repeats in the control region of Caprini is positively selected (Hassanin et al., 2009). Based on Hassanin’s classification revision (Hassanin and Douzery, 1999), the long‐tailed goral (Naemorhedus caudatus) belongs to the enlarged tribe, called Caprini sensu lato, within

Genes & Genomics (2010) 32:335-344

the subfamily Antilopinae (Bovidae). The genera Capricornis and Naemorhedus were classified into three species, respectively (Corbet and Hill, 1992; Groves and Grubb, 1985; Mead, 1989), and the phylogenetic relationship of these genera and species remains under question. Therefore, phylogenetic status of the two genera (Naemorhedus and Capricornis) as well as the interspecific taxonomic status within each genus needs to be clarified. Due to limitation of collecting samples from endangered or threatened Naemorhedus and Capricornis species, it is difficult to preceed molecular phylogenetic analysis to find out their precise classification scheme. Recent molecular phylogenetic studies using partial cytochrome b gene showed that the substantial level of genetic distance between the Naemorhedus and Capricornis supports their designation to separate genera (Min et al., 2004). In addition, Min et al. (2004) proposed that Korean and Russian gorals may be distinct from the Chinese goral, and among three species of the genus Capricornis, Formosan serow (C. swinhoei) is more closely related to C. sumatraensis than to the Japanese serow (C. crispus). Concerning the organizational analysis of the control region, composition of the domains and tandem repeats was described in detail in Japanese serow (Capricornis crispus) (Okumura, 2004). However, little information on organization of control region of the genus Naemorhedus is currently available and few molecular studies on the phylogenetic relationship between Capricornis and Naemorhedus have been carried out. In this study, we analyzed the complete control region of five species of the tribe Caprini. The aims of this paper are (1) to characterize the structural features of mitochondrial control region in the Naemorhedus species, (2) to compare these features among five Caprinae species, and (3) to figure out the evolutionary meaning of variation of the control region.

Materials and Methods Sample collection and DNA extraction Twenty five samples of tissue and blood from Naemorhedus caudatus were obtained from captive animals (n=9) held in zoos and from the wild in the northeastern region (n=16) of South Korea. Most tissue samples were collected by necropsy and shipped within 24hr for processing or held at ‐80℃. One blood sample for Naemorhedus goral was legally imported with a CITES (Convention on International Trade in Endangered Species) permit from the Night Safari. Whole bloods samples were placed into a 7ml glass tube containing liquid 7.5% EDTA solution and shipped frozen. Eighteen blood samples of Capra hircus were received from the live-

Genes & Genomics (2010) 32:335-344

stock research institute in South Korea that has investigated the genetic heritage of Korean native domestic breeds. All samples were deposited into the Conservation Genome Resource Bank for Korean Wildlife (www.cgrb.org) and assigned a serial number by the CGRB recording system. Table 1 contains information of the species analyzed in the present study. DNA was extracted from tissue and blood using DNeasy tissue kit (Qiagen, USA) according to manufacturer’s instructions. All extracted DNAs were diluted to approximately 20 ng/㎕ and preserved in ‐20 ℃ freezer for further use.

337

et al., 1997), with the alignment of ambiguous positions adjusted by sight. The variant sites were double checked by viewing the four‐colored electromorph of sequencing results. Numbers of nucleotide substitutions were calculated using Kimura’s two parameter method (Kimura, 1980). Pairwise transition and transversion estimates, uncorrected distance estimates, and distribution of variable nucleotide positions were calculated in MEGA v.4.0.2 (Tamura et al., 2007). Control region domains and elements were identified and the boundaries defined based on sequence data described for several mammals by Sbisà et al. (1997).

PCR amplification and sequencing Specific primers were designed to the control region of long‐ tailed goral (Naemorhedus caudatus) from a sequence in GenBank (EU177870 in Bos taurus, AY356357 in Naemorhedus caudatus). Primers (Cytb up 5´ CACCCCAGCAAACCCACTCAGCACACCCCCTCAC 3´, NH16129 5´ CATTAAATAGCTACCCCCAGTTA 3´, and R467 5´ GATRCTTGCATGTGTAAKTYTA 3´) bind to the 3´ end of cytoPhe chrome b and tRNA gene sequences and amplify the whole control region. Total volume of the reaction mixture was 25 ㎕ containing 10~100 ng genomic DNA, 10 mM Tris‐HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.5 μM of each primer and 1 unit Taq polymerase (Takara, Cat. No. R001A, Japan). A Takara thermal cycler machine (Takara, Japan) was programmed for an initial denaturation for 5 min at 94 ℃, 35 cycles of denaturation for 30 sec at 94 ℃, primer annealing for 30 sec at 50 ℃ and extension for 60 sec at 72 ℃ followed by a final extension of 10 min at 72 ℃. The PCR products of mtDNA were purified on 1~1.5 % agarose gels using QIAEX II Gel Extraction Kit (Qiagen, Cat. No. 20021, CA, USA) and sequenced with both forward and reverse primers. The complete sequences of the control region (D‐loop) were determined by automatic sequencing on an ABI 3100 DNA Sequencer (Applied Biosystems, CA, USA). The sequences from the complete data set were deposited in GenBank under accession numbers EU259133 for Naemorhedus goral, EU259134‐EU250151 for Capra hircus, and EU259152‐EU259176 for Naemorhedus caudatus. DNA sequence analysis For the comparison analysis of the control region, the following sequences under the GenBank accession numbers and analyzed; Capricornis swinhoei, AY149646 and AY149645; Capricornis crispus, AB055684‐AB055699, AB125258‐ AB125260, AB194608 and AB055700. DNA sequences were initially edited with BioEdit software (Hall, 1999) and aligned using the Clustal X multiple alignment programs (Thomson

Results and Discussion Control region sequence variation and base composition The primer pair Cytbup/R467 and Cytbup/16129r amplified successfully double‐stranded DNAs of approximately 1,000 bp that included the mtDNA control region and its flanking threonine and proline tRNA genes to sequence. DNAs of twenty five Korean gorals, one Himalayan goral, and eighteen Korean native goats were used for this study. Sequences of two C. swinhoei and twenty seven C. crispus were retrieved from GenBank for this study. The control region of the five species examined ranged from 1,096 to 1,212 bp in length. A total of 15 haplotypes and 8 haplotypes were found in the 25 specimens from Korean gorals (GenBank accession numbers: EU259152‐EU259176) and 18 from Korean native goats (GenBank accession numbers: EU259134‐259151), respectively. The size range of the control region in N. caudatus and N. goral was 1,099‐1,129 bp, for which latter species had 29 bp insertion at 3’ end and 1 bp insertion in the central domain (data not shown). The length of the control region in C. crispus and C. swinhoei varied from 1,096 to 1,123 bp with an additional tandem repeat of 74 bp in the ETAS domain (left domain) of C. swinhoei. The length and base composition of the three domains among the species analyzed for this study are shown in Table 2. In all species, A+TC>A>T and C>A>G>T, respectively, with the exception of Capricornis crispus, which showed A>C>G>T in the central domain. All species consistently had thymine (T) displayed the least in all domains of the control region. The CSB domain seemed to include diverse nucleotide constraints with respect to the two other domains; G>C>A>T in the CSB domain similar to the ETAS domain in Capricornis swinhoei, C>A>G>T in CSB domain like the central domain in Capra hircus, and C=A>G>T in Capricornis crispus and Naemorhedus goral.

338

Genes & Genomics (2010) 32:335-344

Table 1. List of specimens included in present analyses. Species and identification

CGRB No.

Haplotype

Origin of specimens

Accession No.

Korean goral 1 (KG1)*

9

KG-A

Everland zoo

EU259152


41

KG-B

Sam-cheok Gangwondo

EU259153


63

KG-C

Everland zoo

EU259155


65

KG-D

In-jae Gangwondo

EU259156


67

KG-E

Go-sung Gangwondo

EU259160


73

KG-F

Go-sung Gangwondo

EU259161


86

KG-B

Ul-jin Gyungsangbukdo

EU259154


87

KG-F

Yang-gu Gangwondo

EU259162


100

KG-G

Yang-yang Gangwondo

EU259165


91

KG-H

Everland zoo

EU259166


92

KG-I

Yang-gu Gangwondo

EU259169


93

KG-H

Everland zoo

EU259167


94

KG-F

Everland zoo

EU259163


133

KG-J

Go-sung Gangwondo

EU259170


138

KG-K

In-jae Gangwondo

EU259171


109

KG-D

In-jae Gangwondo

EU259157


108

KG-D

In-jae Gangwondo

EU259158


253

KG-L

Everland zoo

EU259172


254

KG-H

Everland zoo

EU259168


351

KG-D

Everland zoo

EU259159


475

KG-M

Everland zoo

EU259173


1852

KG-N

In-jae Gangwondo

EU259174


1870

KG-N

In-jae Gangwondo

EU259175


2048

KG-F

Go-sung Gangwondo

EU259164


1952

KG-O

Dong-hae Gangwondo

EU259176

1571

HG-A

Singapore zoo

EU259133

Korean native goat 3 (KNG3)*

4704

KNG-A

National livestock research institute

EU259134


4705

KNG-B


EU259135


4706

KNG-C


EU259136


4708

KNG-D


EU259138


4710

KNG-D


EU259139


4711

KNG-E


EU259148


4712

KNG-C


EU259137


4713

KNG-D


EU259140


4714

KNG-D


EU259141


4715

KNG-D


EU259142


4718

KNG-D


EU259143


4719

KNG-D


EU259144


4720

KNG-F


EU259149


4721

KNG-G


EU259150

Naemorhedus caudatus from South Korea

Naemorhedus goral from Sigapore Himalayan goral (HG)* Capra hircus

from South Korea

Genes & Genomics (2010) 32:335-344

339

Table 1. (continued). Species and identification Korean native goat 21 (KNG21)* Korean native goat 22 (KNG22)* Korean native goat 23 (KNG23)* Korean native goat 24 (KNG24)* Capricornis swinhoei from Taiwan 〃 Capricornis crispus from Japan 〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃〃

CGRB No.

Haplotype

4722 4723 4724 4725 -

KNG-D KNG-D KNG-H KNG-D CS-a CS-b Yama-a Yama-b Yama-c Kiso-a Kiso-b Kiso-c Shiz-a Shiz-b Shiz-c Shiz-d Shiz-e Shiz-f Shiz-g Shiz-h Shiz-i Shiz-j Kiso-d Shiz-l Shiz-m Shiz-k Kiso-e Kiso-f Kiso-g Kiso-h Kiso-i Kiso-j Kiso-k

Origin of specimens livestock research institute livestock research institute livestock research institute livestock research institute Horng et al., 2003 Horng et al., 2003 Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, 2004 Okumura, 2004 Okumura, 2004 Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, 2004 Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished Okumura, Unpublished

National National National National

Accession No. EU259145 EU259146 EU259151 EU259147 AY149646 AY149645 AB055684 AB055685 AB055686 AB055687 AB055688 AB055689 AB055690 AB055691 AB055692 AB055693 AB055694 AB055695 AB055696 AB055697 AB055698 AB055699 AB125258 AB125259 AB125260 AB055700 AB194608 AB194609 AB194610 AB194611 AB194612 AB363069 AB363070

*sequenced in this study

Naemorhedus caudatus showed a different pattern of base composition (C>G>A>T) compared to the other two domains. 31 variable sites (2.8%) out of 1,099 bp were observed in the control region sequence from 25 Korean goral (KG) samples, resulting in 15 haplotypes in control region. All of the threonin tRNA gene sequences were identical, whereas one substitution in KG5 was found in the proline tRNA gene sequence. Four variable sites among haplotypes were transversional substitutions, whereas 27 sites were transitional substitutions. With the Korean native goats (KNG), 21 variable sites (1.7%) out of 1,212 bp were observed in the control region from 18 samples, generating eight haplotypes. All of the threonine and proline tRNA gene sequences of KNG were

identical. Three variable sites among haplotypes were transversional substitutions, whereas 18 were transitional substitutions. As for the Japanese serow (JS), 87 variable sites (7.93 %) of 1,097 bp were identified and all except for two variable sites were transitional substitutions. Organization of the control region General structure of the control region including three domains previously defined (Saccone et al., 1987) was observed in five Caprinae species. Three domains within the control region were verified by the presence of conserved sequences, as well as by the allocation of variability. Owing to the high sim-

340

Genes & Genomics (2010) 32:335-344

Table 2. Sequence lengths and base frequencies of the three domains of the control region. Organism

ETAS Domain

Central Domain

CSB Domain

Bp

G(%)

A(%)

T(%)

C(%)

Bp

G(%)

A(%)

T(%)

C(%)

Bp

G(%)

A(%)

T(%)

C(%)

C. crispus (n=27)

524

35.7

22.5

13.6

28.2

238

24.8

28.6

18.5

28.1

334

27.5

28.4

15.6

28.4

C. swinhoei (n=2)

533

37.3

21.4

12.6

28.7

238

25.2

27.3

18.1

29.4

352

29.0

27.6

15.6

27.8

N. caudatus (n=15)

534

39.0

20.8

11.0

29.2

238

25.2

27.3

18.1

29.4

327

27.8

26.9

15.3

30.0

N. goral (n=1)

535

36.8

21.7

12.9

28.6

238

24.0

27.8

19.8

28.6

356

27.2

28.4

16.0

28.4

Capra hircus (n=8)

648

36.7

24.5

11.0

27.8

238

23.1

29.0

18.5

29.4

326

24.9

25.5

18.4

31.3

n indicates the number of haplotypes of control region sequences. Table 3. Pairwise sequence difference between species based on the central domain of the control region. KG

HG

FS

JS

KNG

KG HG

0.030

FS

0.031

0.039

JS

0.036

0.037

0.041

KNG

0.048

0.039

0.043

0.043

KG; Korean goral, HG; Himalayan goral, FS; Formosan serow, JS; Japanese serow, KNG; Korean native goat

ilarities among species, the central domain was unambiguously determined by comparison with bovine sequence (EMBL accession No. V00654) and sequences from Japanese serow (Okumura, 2004). The central domain of the five species examined for this study spans 239 nucleotides, of which 217 sites are invariable in all the sequences. It was located approximately 525‐886 bp from the multiple alignment of central domain sequences, of which Naemorhedus caudatus, N. goral, Capricornis crispus, C. swinhoei, and Capra hircus were situated in the position of 536‐773, 537‐774, 525‐762, 534‐771, and 649‐886, respectively. Only one variable site each was found among 15 Korean goral haplotypes (at the nucleotide position 184 in central domain) and among eight Korean native goat haplotyes (at the nucleotide position 69 in central domain), respectively. For two of C. swinhoei, 11 variable sites were found at 3, 4, 5, 36, 41, 72, 73, 135, 154, 157, and 187. In 27 Japanese serow haplotypes, nine variable sites were identified at the nucleotide positions 5, 69, 72, 96, 97, 142, 154, 184, and 203. N. caudatus (n=15) had a range of distance values of 0.000‐0.004 in the central domain of the control region. Genetic distance in the central domain of Capra hircus

control region examined in this study ranged from 0.000 to 0.053, and that of C. crispus ranged from 0.000 to 0.053. C. swinhoei had rather larger genetic distance values, ranging from 0.021 to 0.057 in the central domain of the control region. It was not possible to define a range of distance values for N. goral because of the small sample size (n=1). The N. caudatus and C. crispus appeared to have one synapomorphic site at the positions 139 and 38, respectively, from the multiple alignment of the central domain of control region. Genetic distance between species ranged from 0.030 to 0.048 (Table 3). In the right domain, three conserved sequence blocks (CSBs) have been classified in most vertebrates (Walberg and Clayton, 1981). The CSB‐1 motif has been commonly found in mammals, whereas the presence of CSB‐2 and CSB‐3 motifs has been under debate in artiodactyla and cetaceans. Saccone et al. (1991) proposed that CSB‐2 was restricted to an array of only five cytosines in cow, and CSB‐3 was absent in the cow and dolphin. Zardoya (1995) found a polypyrimidine tract localized between CSB‐1 and the phenylalanine tRNA gene in sheep, and suggested that the polypyrimidine tract might be a common property of artiodactyla species. In the right domain, a motif of approximately 26 bp was identified as the CSB‐1 by comparison with the cow sequence (nucleotide positions 887‐1004 in Naemorhedus caudatus; 911‐1034 in Naemorhedus goral, 772‐912 in Capricornis swinhoei, 811‐ 927 in C. crispus, and 1000‐1078 in Capra hircus). In addition, a polypyrimidine tract sequence containing runs of cytosine residue was found in Korean goral, Himalayan goral, Korean native goat, Japanese serow, and Formosan serow. The part of the mtDNA control region alignments containing the CSB‐1 and CSB‐2 (polypyrimidine tract) motifs is shown in Fig. 1. The CSB‐1 motifs were relatively conserved among these five species (Fig. 2). The left domain of the control region is characterized by

Genes & Genomics (2010) 32:335-344

341

Figure 1. Diagram of the mtDNA control region (1099 bp) and threonine tRNA and proline tRNA of the Korean goral. Number 1‐3 indicate tandem repeat (TR) units (76 bp each).

Figure 2. Alignment of CSB 1 and 2 of the control region in 5 caprine species. Dots indicate identities to Korean goral 1 (Nemorhaedus caudatus, KG 1) sequences at the top.

high substitution rates in most mammals. In the Korean gorals, of the thirty one variable sites in the entire control region, 27 variable sites were found in the ETAS domain (nucleotide positions 1‐533) including tandem repeats (Fig. 1) In the Korean native goat, of 21 variable sites in the whole control region, 12 variable sites were found in the left domain. In the 27 haplotypes of Japanese serow, 62 variable sites were found in the left domain. There have been a number of evidences of tandem repeats in the mammalian control region (Fumagalli et al., 1996). Tandem repeats in the left domain have been reported in sheep (Zardoya et al., 1995; Wood and Phua, 1996), sika deer (Douzery and Randi, 1997; Nagata et al., 1999; Cook et al., 1999), and evening bat (Wilkinson and Chapman, 1991), but identified in the right domain in some other species, e.g., green monkey (Karawya and Martin, 1987), rabbit (Mignotte et al., 1990) and dog (Kim et al., 1998). We found two to three tandem repeats in all five species examined in this study, three tandem repeats in Korean goral [nucleotide position 271‐347 (76 bp), 348‐424 (76 bp), and 425‐500 (75 bp)], two tandem repeats in the Korean native goats [nucleotide positions 551‐627 (76 bp) and 628‐704 (76 bp)], three tandem repeats in Himalayan goral [nucleotide positions

274‐347 (73 bp), 348‐424 (76 bp), and 425‐501 (76 bp)], two tandem repeats in the Japanese serows [nucleotide positions 272‐348 (76 bp) and 349‐425 (76 bp)], and one tandem repeat in Formosan serow [nucleotide position 344‐419 (76 bp)]. These homologous tandem repeat (TR) units are shown in Figure 3. The sequence divergences among all the species are shown in Table 4. Mean sequence divergences within three tandem repeat units in the Korean goral (KG 1) and within three tandem repeat units in the Himalayan goral (HG) were comparatively high (0.187 and 0.202, respectively), whereas they were fairly high between two units in Japanese serow (AB055684; 0.118) and Korean native goat (KNG 3; 0.080). These results indicated that the divergence time of tandem repeats in the Korean and Himalayan goral is probably longer than that in Japanese serow and Korean native goat. The first tandem repeat unit (TR‐1) of the Himalayan goral showed rather high sequence divergences (0.233 – 0.266) not only with two other units of the Himalayan goral but also with all units from other species except with TR‐1 from the Korean goral. This probably means that the TR‐1 of the Himalayan goral occurred long before another repeat unit (TR‐2 or TR‐3) was generated. On the other hand, sequence divergences between

342

Genes & Genomics (2010) 32:335-344

Table 4. Uncorrected P distance matrix among tandem repeat units of the control region in Korean goral (Nemorhaedus caudatus), Himalayan goral (N. goral), Korean native goat (Capra hircus), Japanese serow (Capricornis crispus), and Formosan serow (Capricornis swinhoei).

Korean goral (KG1)*

Korean goral

Himalayan goral

TR‐1 TR‐2 TR‐3

TR‐1 TR‐2 TR‐3

Korean native goat TR‐1

TR‐2

Japanese serow TR‐1

TR‐2

Formosan serow TR‐1

TR‐1 TR‐2 0.228 TR‐3 0.267 0.066

Himalayan goral (HG)

TR‐1 0.095 0.194 0.235 TR‐2 0.279 0.068 0.135

0.233

TR‐3 0.284 0.112 0.156

0.266 0.108

Korean native goats (KNG 3)* TR‐1 .244

0.092 0.160

0.209 0.080 0.178

TR‐2 0.243 0.145 0.197

0.235 0.106 0.193

0.080

Japanese serow (AB055684) TR‐1 0.149 0.105 0.158

0.207 0.147 0.166

0.105

0.105

TR‐2 0.241 0.053 0.092

0.233 0.094 0.143

0.120

0.132

0.118

Formosan serow (AY149646) TR‐1 0.230 0.053 0.092

0.237 0.069 0.085

0.093

0.118

0.092

0.079

* KG 1 and KNG 3 were used as a representative sequence for each species

the same units of Korean and Himalayan goral were rather low (0.095 in TR‐1, 0.068 in TR‐2), which is concordant with the fact that these two species has high sequence similarity in the entirely of the control region. All of these repeat units contain two short sections of mirror symmetry (TACAT and ATGTA) (Fig. 3). One pair of mirror symmetry was located in TR 1 of Korean goral whereas two pairs were positioned in the other TR segments in the remaining of species. No substitution was found in the mirror sequences, with the exception of one substitution in TR 1 of the Himalayan goral. Short mirror symmetries were fairly well conserved among five different species although the left domain has high substitution rates. These mirror matrix were considered to be a stable hairpin loops that could be characterized as a recognition site for on block of H‐strand synthesis (Saccone et al., 1991), stressing the functional importance of

Figure 3. Alignment of tandem repeat (TR) units of four species. Dots denote identity with nucleotides in the first unit (TR1) of Korean goral. Dashes denote spaces for alignment. KG: Korean goral (Nemorhaedus caudatus), HG: Himalayan goral (N. goral), KNG: Korean native goat (Capra hircus), JS: Japanese serow (Capricornis crispus), and CS: Formosan serow (Capricornis swinhoei). Boxed sequences are mirror symmetry sequences (TACAT, ATGTA).

these short mirror symmetry sequences (Okumura, 2004). The genetic divergence among five species The genetic distances of the complete control region among five Caprinae species were estimated by Kimura’s two parameter method. The mean genetic distances within each species ranged from 0.6% (Korean native goats) to 4.6% (Formosan serow). The mean estimated distance between the Naemorhedus and Capricornis species was 17.1%, whereas the distances among the Naemorhedus species, Capricornis species, and Capra hircus ranged from 21.0% to 23.3%. Based on short and variable sequences of the control region by Loftus et al. (1994), the estimated substitution rate between bison and cattle was 10.62% per 1 Myr. This value might be overestimated than the one calculated from complete sequence of control region, which contains several conserved sequences. The divergence time between Naemorhedus species and Capricornis species might be nearly 2Myr.

Acknowledgement The authors would like to thank Night Safari, managed by wildlife reserves Singapore for providing one blood sample of N. goral. This research was Korea Research Foundation Grant funded by the Korean Government (MOEHRD) (KRF‐2007‐357‐C00079) and the KOSEF grant funded by the Korea government (MEST) (No. 2009‐0080227), and by a grant from the Cultural Properties Administration of Korea for the genetic study of the Korean goral.

Genes & Genomics (2010) 32:335-344

References Anderson S, De Bruijn MHL, Coulson AR, Eperon IC, Sanger F and Young IG (1982) Complete sequence of bovine mitochondrial DNA conserved features of the mammalian mitochondrial genome. J. Mol. Biol. 156: 683‐717. Baker AJ and Marshall HD (1997) Mitochondrial control‐region sequences as tools for understanding the evolution of avian taxa. In Avian molecular systematics and evolution, D.P. Mindell, ed., Academic Press, New York, pp. 49‐80. Brown GG, Gedaleta G, Pepe G, Saccone C and Sbisa E (1986) Structural conservation and variation in the D‐loop containing region of vertebrate mitochondrial DNA. J. Mol. Biol. 192: 503‐511. Brown WM, George MJr and Willson AC (1979) Repid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 76: 1967‐1971. Castro ALF, Stewart BS, Wilson SG, Hueter RE, Meekan MG, Motta PJ, Bowen BW and Karl SA (2007) Population genetic structure of Earth’s largest fish, the whale shark (Rhincodon typus). Mol. Ecol. 16: 5183–5192. Cook CE, Wang Y and Sansabaugh G (1999) A mitochondrial control region and cytochrome b phylogeny of sika deer (Cervus nippon) and report of tandem repeats in the control region. Mol. Phylogenet. Evol. 12: 47‐56. Corbet GB and Hill JE (1992) The mammals of the Indomalayan region: a systematic review. Oxford University Press, Oxford, USA, pp. 488. Desjardins P and Morais R (1990) Sequence and gene organization of the chicken mitochondrial genome. A novel gene order in higher vertebrates. J. Mol. Biol. 212: 599‐634. Dillon MC and Wright JM (1993) Nucleotide sequence of the Dloop region of the sperm whale (Physeter macrocephalus) mitochondrial genome. Mol. Biol. Evol. 10: 296‐305. Douzery E and Randi E (1997) The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic content. Mol. Biol. Evol. 14: 1154‐1166. Fumagalli L, Taberlet P, Favre L and Hausser J (1996) Origin and evolution of homologous repeated sequences in the mitochondrial control region (D‐loop) comparisons of control region (D‐loop) sequences between monotreme and therian mammals. Mol. Biol. Evol. 13: 798‐808. Ghivizzani SC, Mackay SKD, Madsen CS, Laipis PJ and Hauswirth WW (1993) Transcribed heteroplasmic repeated sequence in the porcine mitochondrial DNA D‐loop region. J. Mol. Evol. 37: 36‐47. Giles RE, Blanc H, Cann HM and Wallace DC (1980) Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad. Sci. USA 77: 6715‐6719. Groves CP and Grubb P (1985) Reclassification of the serows and gorals (Nemorhaedus: Bovidae). In The Biology and Management of Mountain Ungulates, S. Lovari, ed., Croom Helm, London, pp. 45‐50. Hall T (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41: 95‐98. Hassanin A and Douzery JPE (1999) The tribal radiation of the family bovidae (artiodactyla) and the evolution of the mitochondrial cytochrome b gene. Mol. Phylogenet. Evol. 13: 227‐243. Hassanin A, Ropiquet A, Couloux A and Cruaud C (2009) Evolution of the mitochondrial genome in mammals living at high altitude: new insights from a study of the tribe Caprini (Bovidae,

343 Antilopinae). J. Mol. Evol. 68: 293‐310. Irwin JA, Saunier JL, Strouss KM, Sturk KA, Diegoli TM, Just RS, Coble MD, Parson W and Parsons TJ (2007) Development and expansion of high‐quality control region databases to improve forensic mtDNA evidence interpretation. Forensic Sci. Int. Genet. 1: 154‐157. Jäger VF, Hecht W and Herzog A (1992) Untersuchungen an mitochondrialer DNS (mtDNS) von hessischem Rehwild (C. capreolus). Z. Jagdwiss 38: 26‐33. Karawya EM and Martin RG (1987) Monkey (CV‐1) mitochondrial DNA contains a unique triplication of 108 bp in the origin region. Biochem. Biophys. Acta 909: 30‐34. Kim K, Lee S, Jeong H and Ha J (1998) The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondirial genome. Mol. Phylogenet. Evol. 10: 210-220. Kimura M (1980) A simple method for estimating evolutionary rates of base substitution through comparative studies of nucleotide sequence. J. Mol. Evol. 16: 111‐120. Kirchman JJ and Franklin JD (2007) Comparative phylogeography and genetic structure of Vanuatu birds: Control region variation in a rail, a dove, and a passerine. Mol. Phylogenet. Evol. 43: 14‐23. L’Abbe DL, Duhaime JF, Lang BF and Morais R (1991) The transcription of DNA in chicken mitochondria initiates from one major bidirectional promoter. J. Biol. Chem. 266: 10844‐10850. Masuda R and Yoshida MC (1994) Nucleotide sequence variation of cytochrome b genes in three species of weasels, Mustela itatsi, Mustela sibirica, and Mustela nicalis, detected by improved PCR product‐direct sequencing technique. J. Mamm. Soc. Japan 19: 33‐43. Matson CW and Baker RJ (2001) DNA sequence variation in the mitochondrial control region of red‐backed voles (Clethrionomys). Mol. Biol. Evol. 18: 1494‐1501. Mead JI (1989) Nemorhaedus goral. Mammalian Species 335: 1‐5. Mignotte F, Gueride M, Champagne A and Mounolou J (1990) Direct repeats in the non‐coding region of rabbit mitochondrial DNA. Eur. J. Biochem. 194: 561‐571. Min M, Okumura H, Jo D, An J, Kim K, Kim C, Shin N, Lee M, Han C, Voloshina IV and Lee H (2004) Molecular phylogenetic status of the Korean goral and Japanese serow based on partial sequences of the mitochondrial cytochrome b gene. Mol. Cells 17: 365‐372. Nagata J, Masuda R, Tamate HB, Hamasaki S, Ochiai K, Asada M, Tatsuzawa S, Suda K, Tado H and Yoshida MC (1999) Two genetically distinct lineages of the sika deer, Cervus nippon, in Japanese islands: comparison of mitochondrial D‐loop region sequences. Mol. Phylogenet. Evol. 13: 511‐519. Okumura H (2004) Complete sequence of mitochondrial DNA control region of the Japanese serow Capricornis crispus (Bovidae: Caprinae). J. Mamm. Soc. Japan 29: 137‐145. Pesole G, Gissi C, De Chirico A and Saccone C (1999) Nucleotide substitution rate of mammalian mitochondrial genomes. J. Mol. Evol. 48: 427‐434. Ruokonen M and Kvist L (2002) Structure and evolution of the avian mitochondrial control region. Mol. Phylogenet. Evol. 23: 422‐432. Saccone C, Pesole G and Sbisa E (1991) The main regulatory region of mammalian mitochondrial DNA: structure‐function model and evolutionary pattern. J. Mol. Evol. 33: 83‐91. Saccone C, Attimonelli M and Sbis E (1987) Structural elements highly preserved during the evolution of the D‐loop‐containing region

344 in vertebrate mitochondrial DNA. J. Mol. Evol. 26: 205‐211. Sbisà E, Tanzariello F, Reyes A, Pesole G and Saccone C (1997) Mammalian mitochondrial D‐loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 205: 125‐140. Shadel GS and Clayton DA (1997) Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 66: 409‐435. Takahashi H and Goto A (2001) Evolution of East Asian nine spine sticklebacks as shown by mitochondrial DNA control region sequences. Mol. Phylogenet. Evol. 21: 135–155. Tamura K, Dudley J, Nei M and Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596‐1599. Thomson JD, Gibson TJ, Plewniak F, Jeanmougin F and Higgin DG (1997) The Clustal_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25: 4876‐4882.

Genes & Genomics (2010) 32:335-344 Walberg MW and Clayto DA (1981) Sequence and properties of the human KB cell and mouse L cell D‐loop regions of mitochondrial DNA. Nucl. Acids Res. 9: 5411‐5421. Wilkinson GS and Chapman AM (1991) Length and sequence variation in evening bat D‐loop mtDNA. Genetics 128: 607‐617. Wilson AC, Cann RL, Carr SM, George M, Gyllensten UB, Helm‐ Bychowski KM, Higuchi RG, Palumbi SR, Prager EM, Sage RD and Stoneking M (1985) Mitochondrial DNA and two perspectives on evolutionary genetics. Biol. J. Linn. Soc. 26: 375‐400. Wood NJ and Phua SH (1996) Variation in the control region sequence of the sheep mitochondrial genome. Anim. Genet. 27: 25‐33. Zardoya R, Villalta M, Lopez‐Perez MJ, Garrido‐Pertierra A, Montoya J and Bautista JM (1995) Nucleotide sequence of the sheep mitochondrial DNA D‐loop and its flanking tRNA genes. Curr. Genet. 28: 94‐96. Zhao X, Ferrari MCO and Chivers DP (2006) Threat sensitive learning of predator odours by a prey fish. Behaviour 143: 1103‐1121.