PAPER Adiponectin receptor gene expression in human ... - Nature

International Journal of Obesity (2005) 29, 760–765 & 2005 Nature Publishing Group All rights reserved 0307-0565/05 $30.00 www.nature.com/ijo

PAPER Adiponectin receptor gene expression in human skeletal muscle cells is not regulated by fibrates and thiazolidinediones S Kaltenbach1w, H Staiger1w, M Weisser1, C Haas1, M Stumvoll2, F Machicao1 and H-U Ha¨ring1* 1 Department of Endocrinology, Metabolism and Pathobiochemistry, Medical Clinic Tu¨bingen, Eberhard-Karls-University Tu¨bingen, Germany; and 2Center for Internal Medicine, Medical Clinic III, University of Leipzig, Germany

BACKGROUND: Thiazolidinediones as PPARg agonists and fibrates as PPARa agonists improve insulin sensitivity in insulinresponsive tissues. Recent data show an induction of adiponectin receptor 2 (AdipoR2) by PPARa and PPARg agonists in human macrophages. OBJECTIVE: In this study, we examined the effects of thiazolidinediones and fibrates on the expression of adiponectin receptors in human skeletal muscle cells, an important cell type in the context of insulin resistance. RESULTS AND METHODS: In vitro differentiated human myotubes treated with troglitazone or rosiglitazone (20 h) showed no significant changes in AdipoR1 and AdipoR2 mRNA expression. PPARg activation was controlled by determination of PPARg mRNA induction. Likewise, differentiated myotubes treated with Wy-14,643 or fenofibrate (20 h) revealed no significant regulation of AdipoR1 and AdipoR2 mRNA. PPARa activation was assessed by measuring PDHK4 mRNA expression. CONCLUSION: Induction of AdipoR gene expression in human skeletal muscle cells is not involved in the insulin-sensitizing effects of thiazolidinediones or fibrates. International Journal of Obesity (2005) 29, 760–765. doi:10.1038/sj.ijo.0802957 Published online 12 April 2005 Keywords: adiponectin receptor; PPARg; thiazolidinedione; PPARa; fibrate

Introduction Adipose tissue is not only a simple energy storage depot but an important endocrine organ. The role of adipose tissuederived hormones as pivotal regulators of whole-body lipid and glucose metabolism gains more and more of importance. The adipokine adiponectin was found to enhance the effect of insulin on hepatic gluconeogenesis, accelerates peripheral free fatty acid uptake and induces b-oxidation in skeletal muscle and liver. In addition, adiponectin acts as an anti-inflammatory and antiatherogenic agent by diminishing monocyte adhesion to the endothelium, decreasing smooth muscle cell proliferation and reducing foam cell formation (for review, see Chandran et al1). All these effects are postulated to be mediated by the recently cloned

*Correspondence: Professor Dr med. H-U Ha¨ring, Department of Internal ¨ bingen, Otfried-Mu ¨ ller-Str. 10, D-72076 Medicine IV, Medical Clinic Tu ¨ bingen, Germany. Tu E-mail: [email protected] w Both authors contributed equally to the paper. Received 15 July 2004; revised 15 December 2004; accepted 23 January 2005; published online 12 April 2005

adiponectin receptors AdipoR1 and AdipoR2.2 Importantly, the skeletal muscle expression levels of both receptors were shown to be associated with insulin sensitivity and family history of type 2 diabetes.3 Hyperinsulinemia, as provoked by hyperinsulinemic–euglycemic clamp, increased the AdipoR1 mRNA content of skeletal muscle two-fold.4 With regard to pharmacological regulation of AdipoR expression, a recent publication reports significant induction of AdipoR2 gene expression by the thiazolidinedione (TZD) rosiglitazone and the fibrate Wy-14,643 in human macrophages.5 TZDs are the most potent triggers of adipose differentiation and were found to be direct and high-affinity ligands of PPARg.6–8 Furthermore, in vitro and ex vivo studies have consistently shown that TZDs improve insulin sensitivity in all major insulin-responsive tissues including skeletal muscle.9 Fibrates, acting as PPARa activators, are used therapeutically as potent hypolipidemic agents,10 and new evidences suggest that they might also prove effective for treating obesity and insulin resistance11 and for reducing the progression of atherosclerosis.12 With regard to the improving effects of TZDs and fibrates on insulin resistance and the inductive effect of these agents

Regulation of adiponectin receptor gene expression S Kaltenbach et al

761 on AdipoR2 gene expression in human macrophages, the aim of this study was to test whether adiponectin receptors are also positively modulated by PPARg and PPARa agonists in human skeletal muscle cells, a cell type crucial for wholebody insulin sensitivity.

Statistics Data were analyzed by the nonparametric Wilcoxon signed rank test and differences were considered significant when Po0.05.

Results Materials and methods Tissue sampling and cell culture Primary human skeletal muscle cells were grown from satellite cells obtained from percutaneous needle biopsies performed on the lateral portion of the quadriceps femoris (vastus lateralis) muscle as recently described in detail.13 The donors were normal weight nondiabetic Caucasian subjects (four women/six men, age 25.771.6 y, BMI 23.171.1 kg/m2, mean7s.e.) recruited from the Tuebinger Family Study for type 2 diabetes and gave informed written consent prior to the biopsy. Subcultured (first pass) cells, after growth to 80– 90% confluence, were differentiated into myotubes as described previously.13 On day 5 of differentiation, fresh medium containing troglitazone, rosiglitazone, Wy-14,643, fenofibrate, or DMSO (for vehicle control), respectively, was added to the cells at the indicated concentrations. The cells then were incubated for up to 20 h prior to RNA analysis. In one experimental setting, troglitazone was administered during the complete 5-day differentiation period. The study was approved by the local ethical committee.

RT-PCR RNA was isolated with RNeasy Mini Kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Total RNA treated with RNase-free DNase I was transcribed into cDNA using AMV reverse transcriptase and first-strand cDNA kit from Roche Diagnostics (Mannheim, Germany). Quantitative PCR was performed with SYBR Green I dye on a high-speed thermal cycler with integrated microvolume fluorometer according to the instructions of the manufacturer. We used primers from Invitrogen (Karlsruhe, Germany). The PCR conditions are given in Table 1. All measurements were performed in triplicates.

Table 1

We treated fully differentiated human myotubes with troglitazone (10 mM) for 20 h (n ¼ 11). To assess the effectiveness of troglitazone, we measured PPARg and D-6 desaturase gene expression of differentiated myotubes. Consistent with earlier results,14,15 troglitazone treatment resulted in a significant 1.8-fold induction of PPARg gene expression (n ¼ 11, P ¼ 0.00098) (Figure 1a) and a 55% reduction of D6 desaturase in human myotubes (not shown). Having proven the effectiveness of troglitazone, we studied modulating effects of troglitazone on mRNA expression of AdipoR1 and AdipoR2 in human myotubes. mRNA expression of both receptors tended to decrease by treatment with troglitazone. AdipoR1 was reduced by 13% and AdipoR2 by 22%. These effects, however, did not reach the level of significance (Figure 1b and c). Furthermore, we studied myotubes treated with troglitazone during the 5-day differentiation period, as described earlier.16 In this experimental setting, we found identical results (data not shown). In addition, we then treated differentiated myotubes with Wy-14,643 (10 mM) for 20 h and detected a significant twofold induction of PDHK4 gene expression compared to control conditions (n ¼ 9, P ¼ 0.00391) (Figure 2a). As described earlier, PDHK4 is a target gene of PPARa in skeletal muscle cells.17 However, treatment with Wy-14,643 did not have a significant regulatory impact on either AdipoR1 or AdipoR2 gene expression in differentiated myotubes (Figure 2b and c). To examine whether troglitazone or Wy-14,643 (10 mM each) exert short-term effects on AdipoR expression, we conducted time courses (0–20 h). As compared to the vehicle control, neither troglitazone nor Wy-14,643 significantly affected AdipoR1 (Figure 3a) and AdipoR2 (Figure 3b) mRNA expression at any time point tested. To test whether the lack of effects is restricted to these two compounds only or is specific for the TZD and the fibrate classes of drugs, we performed dose–response experiments with troglitazone (1– 10 mM), rosiglitazone (0.1–1 mM), Wy-14,643 (1–10 mM), and

PCR conditions

PPARg D-6 Desaturase AdipoR1 AdipoR2 PDHK4 28S-rRNA

Forward primer 50 -30

Reverse primer 50 -30

agaacagatccagtggttgc cctacaatcaccagcacgaa attgaggtaccagccagatg gattgtcatctgtgtgctgg ggttcatcagcatccgagta acggcgggagtaactatgact

gccaacagcttctccttctc ccatgcttggcacatagaga gaggtctatgaccatgtagc ctggagactggtaggtatca catgaagcagctactggact cttggctgtggtttcgct

Tannealing (1C)

No. of cycles

MgCl2 (mM)

64 64 66 64 62 63

40 45 45 45 45 50

4 4 4 4 3 4

International Journal of Obesity


762

a 0.8

a

PPARγ

0.30

PDHK4

*

0.6 0.5 0.4 0.3 0.2 0.1

mRNA content PDHK4/28S [RAU]

mRNA content PPARγ/28S [RAU]

*

0.7

0 control

8 6 4 2 0

mRNA content AdipoR2/28S [RAU]

c

b mRNA content AdipoR1/28S [RAU]

10

0.15

0.10

0.05

0

troglitazone

AdipoR1

0.20

20

control AdipoR1

16 14 12 10 8 6 4 2

control

troglitazone

0 control

16

Wy-14,643

18

AdipoR2

c

14



b 12

0.25

12

Wy-14,643

AdipoR2

14 12 10 8 6 4 2 0

control

8 6 4 2

troglitazone

Figure 1 Changes in gene expression induced by troglitazone treatment (20 h, 10 mM) of terminally differentiated myotubes. Cells were cultured and treated as described in Materials and methods. mRNA levels of PPARg (a), AdipoR1 (b), and AdipoR2 (c) were normalized to 28S-rRNA. The data are presented as means7s.e. of myotube cultures derived from 11 donors (n ¼ 11) (RAU ¼ relative arbitrary units). *Significantly different from control (Po 0.05, Wilcoxon signed rank test).


10

0

control

Wy-14,643

Figure 2 Changes in gene expression induced by Wy-14,643 treatment (20 h, 10 mM) of terminally differentiated myotubes. Cells were cultured and treated as described in Materials and methods. mRNA levels of PDHK4 (a), AdipoR1 (b), and AdipoR2 (c) were normalized to 28S-rRNA. The data are presented as means7s.e. of myotube cultures derived from 9 donors (n ¼ 9) (RAU ¼ relative arbitrary units). *Significantly different from control (Po 0.05, Wilcoxon signed rank test).


AdipoR1

a

24


763

a 18

20

AdipoR1


16 14 12 10 8 6 4

control troglitazone Wy-14,643

2

16

12

8

4

0 0

2

4

6

10 12 time [h]

14

16

18

20

0 C troglitazone rosiglitazone

AdipoR2

b

14

9

Wy-14,643

fenofibrate

Wy-14,643

fenofibrate

AdipoR2

8 12



b 16

8

10 8 6 4

control troglitazone Wy-14,643

2 0 0

2

4

6

8

10 12 time [h]

14

16

18

20

Figure 3 Time course of AdipoR expression during troglitazone and Wy14,643 (10 mM each) treatment. Cells were cultured and treated as described in Materials and methods. mRNA levels of AdipoR1 (a) and AdipoR2 (b) were normalized to 28S-rRNA. The data are presented as means7s.e. of myotube cultures derived from four donors (n ¼ 4) (RAU ¼ relative arbitrary units).

fenofibrate (6–60 mM). As depicted in Figure 4, none of these compounds exerted significant effects on AdipoR1 and AdipoR2 mRNA expression at any concentration tested.

Discussion Insulin-sensitizing effects of TZDs on peripheral insulinresponsive tissues are thought to be direct for example by altering glucose metabolism in skeletal muscle cells18,19 and indirect by altering lipid metabolism and hormon produc-

7 6 5 4 3 2 1 0 C troglitazone rosiglitazone

Figure 4 Dose–response characteristics of AdipoR expression after treatment with troglitazone (1, 5, and 10 mM), rosiglitazone (0.1, 0.5, and 1 mM), Wy14,643 (1, 5, and 10 mM), and fenofibrate (6, 30, and 60 mM). Cells were cultured and treated as described in Materials and methods. mRNA levels of AdipoR1 (a) and AdipoR2 (b) were normalized to 28S-rRNA. The data are presented as means 7s.e. of myotube cultures derived from four donors (n ¼ 4) (RAU ¼ relative arbitrary units).

tion in adipose tissue.20–22 For the adipokine TNF-a, it was shown that TZDs block TNFa’s inhibitory effect on insulinstimulated glucose uptake as well as TNFa gene expression in 3T3-L1 cells, and a study in diabetic mice revealed a normalizing effect of the TZD pioglitazone on overexpression of both TNFa receptors TNFR1 and TNFR2.23,24 Furthermore PPARg activation by TZDs inhibits leptin expression in vivo and in vitro.25,26 International Journal of Obesity


764 Moreover, adiponectin gene expression in adipocytes as well as serum adiponectin concentration were found to be increased after TZD treatment.19 We show here that treatment with troglitazone and rosiglitazone, although modulating expression of known PPARg target genes, such as PPARg itself and D-6 desaturase,14,15 does not induce mRNA expression of AdipoR1 and AdipoR2 in human skeletal muscle cells. This is in apparent contrast to recently published data showing induction of AdipoR2 by PPARg agonists rosiglitazone and GW929 in human macrophages.5 PPARa agonists are used as hypolipidemic agents.10 Investigations on PPARa-mediated effects on the skeletal muscle revealed enhancement of b-oxidation and decrease of fatty acid esterification into myocyte triacyglycerol.12 At the gene expression level, induction of PDHK4 mRNA expression in human skeletal muscle cells17 and induction of AdipoR2 gene expression in human macrophages was observed after treatment with PPARa agonists.5 By contrast, our results show that the PPARa agonists Wy-14,643 and fenofibrate, although significantly inducing PDHK4 gene expression, do not modulate AdipoR1 and AdipoR2 gene expression in human skeletal muscle cells. Therefore, we suggest that TZDs and fibrates do not enhance adiponectin signaling and do not exert their insulin-sensitizing and lipid-lowering effects by modulating adiponectin receptor expression in skeletal muscle cells. The reasons for this divergence to macrophages might be cell type-inherent and due to differences in the expression of transcriptional cofactors such as PGC1. In summary, we show here that PPARg and PPARa agonists do not regulate mRNA expression of AdipoR1 and AdipoR2 in human myotubes. Therefore, we conclude that induction of adiponectin receptor gene expression in human skeletal muscle cells is not involved in the insulin-sensitizing effects of TZDs and the lipid-lowering effects of fibrates.

4

5

6

7

8 9 10

11

12

13

14

15

Acknowledgements We thank the research volunteers for their participation. This study was supported in part by grants from the Deutsche Forschungsgesellschaft (KFO 114/1-1) and the University of ¨ bingen (F1284193 fortu ¨ ne program). Tu

References 1 Chandran M, Phillips S, Ciaraldi T, Henry R. Adiponectin: more than just another fat cell hormone? Diabetes Care 2003; 26: 2442– 2450. 2 Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003; 423: 762–769. 3 Civitarese AE, Jenkinson CP, Richardson D, Bajaj M, Cusi K, Kashyap S, Berria R, Belfort R, DeFronzo RA, Mandarino LJ, Ravussin E. Adiponectin receptors gene expression and insulin


16

17

18

19

20

sensitivity in non-diabetic Mexican Americans with or without a family history of type 2 diabetes. Diabetologia 2004; 47: 816–820. Debard C, Laville M, Berbe V, Loizon E, Guillet C, Morio-Liondore B, Boirie Y, Vidal H. Expression of key genes of fatty acid oxidation, including adiponectin receptors, in skeletal muscle of type 2 diabetic patients. Diabetologia 2004; 47: 917–925. Chinetti G, Zawadski C, Fruchart JC, Staels B. Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors PPARa, PPARg and LXR. Biochem Biophys Res Commun 2004; 31: 151–158. Adams M, Montague CT, Prins JB, Holder JC, Smith SA, Sanders L, ´ Rahilly S. Digby JE, Sewter CP, Lazar MA, Chatterjee VK, O Activators of peroxisome proliferator-activated receptor g have depot-specific effects on human preadipocyte differentiation. J Clin Invest 1997; 100: 3149–3153. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPARg). J Biol Chem 1995; 270: 12953–12956. Spiegelman BM. PPARg: adipogenic regulator and thiazolidinedione receptor. Diabetes 1998; 47: 507–514. Stumvoll M. ThiazolidinedionesFsome recent developments. Expert Opin Investig Drugs 2003; 12: 1179–1187. Fruchart JC, Duriez P, Staels B. Peroxisome proliferator-activated receptor-alpha activators regulate genes governing lipoprotein metabolism, vascular inflammation and atherosclerosis. Curr Opin Lipidol 1999; 10: 245–257. Ye JM, Doyle PJ, Iglesias MA, Watson DG, Cooney GJ, Kraegen EW. Peroxisome proliferator-activated receptor (PPAR)-a activation lowers muscle lipids and improves insulin-sensitivity in high fat-fed rats: comparison with PPAR-g activation. Diabetes 2001; 50: 411–417. Moller DE, Berger JP. Role of PPARs in the regulation of obesityrelated insulin sensitivity and inflammation. Int J Obes Relat Metab Disord 2003; 27: 17–21. ¨tzfeld J, Kausch C, Volk A, Klein HH, Rett K, Ha¨ring HU, Kru Stumvoll M. Insulin signaling and action in cultured skeletal muscle cells from lean healthy subjects with high and low insulin sensitivity. Diabetes 2000; 49: 992–998. Wahl HG, Kausch C, Machicao F, Rett K, Stumvoll M, Ha¨ring HU. Troglitazone downregulates delta-6 desaturase gene expression in human skeletal muscle cell cultures. Diabetes 2002; 51: 1060– 1065. Park KS, Ciaraldi TP, Lindgren K, Abrams-Carter L, Mudaliar S, Nikoulina SE, Tufari SR, Veerkamp JH, Vidal-Puig A, Henry RR. Troglitazone effects on gene expression in human skeletal muscle of type II diabetes involve up-regulation of peroxisome proliferator-activated receptor g. J Clin Endocrinol Metab 1998; 83: 2830– 2835. Kausch C, Kruetzfeld J, Witke A, Rettig A, Bachmann O, Rett K, Matthaei S, Machicao F, Ha¨ring HU, Stumvoll M. Effects of troglitazone on cellular differentiation, insulin signalling, and glucose metabolism in cultured human skeletal muscle cells. Biochem Biophys Res Commun 2000; 280: 664–674. Muoio DM, Way JM, Tanner CJ, Winegar DA, Kliewer SA, Houmard JA, Kraus WE, Dohm GL. Peroxisome proliferatoractivated receptor-a regulates fatty acid utilization in primary human skeletal muscle cells. Diabetes 2002; 51: 901–909. Burant CF, Sreenan S, Hirano K, Tai TA, Lohmiller J, Lukens J, Davidson NO, Ross S, Graves RA. Troglitazone action is independent of adipose tissue. J Clin Invest 1997; 100: 2900–2908. Park KS, Ciaraldi TP, Abrams-Carter L, Mudaliar S, Nikoulina SE, Henry RR. Troglitazone regulation of glucose metabolism in human skeletal muscle cultures from obese type II diabetic subjects. J Clin Endocrinol Metab 1998; 83: 1636–1643. Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K, Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K, Nakamura T, Shimomura I, Matsuzawa Y. PPARgamma ligands increase expression and plasma concentra-


765 tions of adiponectin, an adipose-derived protein. Diabetes 2001; 50: 2094–2099. 21 Katsuki A, Sumida Y, Murata K, Furuta M, Araki-Sasaki R, Tsuchihashi K, Hori Y, Yano Y, Gabazza EC, Adachi Y. Troglitazone reduces plasma levels of tumor necrosis factor-alpha in obese patients with type 2 diabetes. Diabetes Obes Metab 2000; 2: 189–1869. 22 Spiegelman BM, Flier JS. Adipogenesis and obesity: rounding out the big picture. Cell 1996; 87: 377–389. 23 Hofmann C, Lorenz K, Braithwaite SS, Colca JR, Palazuk BJ, Hotamisligil SG, Spiegelman BM. Altered gene expression for tumor necrosis factor-a and its receptor during drug and dietary modulation of insulin resistance. Endocrinology 1994; 134: 264–270.

24 Szalokowski D, White-Carrington S, Berger J, Zhang B. Antidiabetic thiazolidinediones block the inhibitory effect of tumor necrosis factor-a on differentiation, insulin-stimulated glucose uptake, and gene expression in 3T3-L1 cells. Endocrinology 1995; 136: 1474–1481. 25 Rieusset J, Auwerx J, Vidal H. Regulation of gene expression by activation of the peroxisome proliferator-activated receptor gamma with rosiglitazone (BRL 49653) in human adipocytes. Biochem Biophys Res Commun 1999; 265: 265–271. 26 De Vos P, Lefebvre AM, Miller SG, Guerre-Millo M, Wong K, Saladin R, Hamann LG, Staels B, Briggs MR, Auwerx J. Thiazolidinediones repress ob gene expression in rodents via activation of peroxisome proliferator-activated receptor gamma. J Clin Invest 1996; 98: 1004–1009.
