PDF file

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright

Author's personal copy Biochimica et Biophysica Acta 1789 (2009) 477–486

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / b b a g r m

Characterization of the region of the aryl hydrocarbon receptor required for ligand dependency of transactivation using chimeric receptor between Drosophila and Mus musculus Kyoko Kudo a, Takeshi Takeuchi b, Yusuke Murakami c, Masayuki Ebina a, Hideaki Kikuchi a,c,⁎ a b c

United Graduate School of Agricultural Sciences, Iwate University, Morioka 020-8550, Japan Institute of Development, Aging and Cancer, Tohoku University, Sendai 980-8575, Japan Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki 036-8561, Japan

a r t i c l e

i n f o

Article history: Received 29 April 2009 Received in revised form 17 June 2009 Accepted 17 June 2009 Available online 25 June 2009 Keywords: Aryl hydrocarbon receptor TCDD Mouse Drosophila Hepa-1c1c7 S2

a b s t r a c t The aryl hydrocarbon receptor (AhR) is a ligand-activated transcriptional factor. Although 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) is high affinity and toxic to many vertebrate animals, invertebrate AhRs including Drosophila melanogaster AhR (spineless) have no ability to bind exogenous chemicals as ligands. To analyze the ligand-binding domain (LBD) of AhR, we used chimeras between mouse and Drosophila AhR. The chimeric AhR revealed that the LBD determines constitutive transactivation in Drosophila AhR or ligand-dependent activation in mouse AhR. The LBD was further divided into three blocks that corresponded to amino acids 230–300, 301–361, and 361–420 of the mouse sequence. Six chimeric proteins clarified that amino acids 291–350 of the Drosophila LBD, i.e. the middle region, were required to keep the protein in the active form in the absence of ligand binding, whereas in the mouse AhR, this region was required to maintain the protein in the inactive form in the absence of ligand. Furthermore, Arg346 in the middle region of the mouse LBD, was identified as amino acids that were critical for AhR activation by sitedirected mutagenesis. © 2009 Elsevier B.V. All rights reserved.

1. Introduction The aryl hydrocarbon receptor (AhR) is a member of the basic helix–loop–helix-Per–Arnt–Sim (bHLH-PAS) superfamily. It is a ligand-dependent transcriptional factor that regulates the transcription of several response genes; the best characterized of which is the CYP1A1 gene, whose product metabolizes exogenous chemicals [1–3]. Various environmental pollutants, such as polycyclic aromatic hydrocarbons (PAHs) and halogenated aromatic hydrocarbons (HAHs), bind with high affinity to AhR [4]. Numerous HAHs, including the AhR ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), have been characterized as planar molecules. Exposure to the most potent of these chemicals produces a wide variety of species- and tissue-specific toxic effects and can promote the formation of tumors [5–7]. The toxicity of pollutants has been evaluated mainly according to their ability to activate the AhR system. It has been proposed that inactive AhR remains in the cytosol. Ligand binding induces the receptor to undergo a series of processes, which involve translocation into the nucleus due to a conformational change in the AhR, association with the AhR nuclear translocator (ARNT), recognition of xenobiotic responsive elements in the target genes, and induction of transcrip⁎ Corresponding author. United Graduate School of Agricultural Sciences, Iwate University, Morioka 020-8550, Japan. Fax: +81 171 39 3586. E-mail address: [email protected] (H. Kikuchi). 1874-9399/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagrm.2009.06.003

tion as mentioned above. Therefore, the binding affinity of pollutants and the induction of target genes are related to their toxicity [8]. Knock-in mice that contain the human AhR, which has a low affinity for TCDD, are less susceptible to TCDD-inducible toxicity than mice that possess AhRs with a high affinity for TCDD [9]. The PAS proteins are external sensor proteins that are conserved through evolution. Many PAS proteins have been identified throughout the animal kingdom from fish to mammals and even flies [10]. PAS proteins mediate the signals that regulate circadian rhythm, oxygen balance, and xenobiotic metabolism [11,12]. The AhR was identified as a bHLH-PAS factor and its signaling mechanism has been studied extensively. As described above, binding of the ligand to the AhR results in conformational change, nuclear localization, and transactivation [13]. PAS domains, which generally consist of two repeated motifs (PAS-A and PAS-B), are important for ligand binding [14]. The PAS domains of partner PAS proteins interact to allow dimer formation, but in addition, the PAS-B domain of the AhR can bind xenobiotic chemicals [12,15]. The majority of proteins in the PAS superfamily do not share the ligand-binding ability of the AhR; only the FixL, PYP and Met gene products have been reported to bind ligands [12,14,16–19]. Although AhR homologs have been found in invertebrate species, for example Drosophila melanogaster AhR (spineless) and Caenorhabditis elegans AhR, invertebrate AhRs are different from the vertebrate proteins. In fact, Drosophila AhR and C. elegans AhR cannot bind exogenous ligands [20,21]. However,

Author's personal copy 478

K. Kudo et al. / Biochimica et Biophysica Acta 1789 (2009) 477–486

Drosophila AhR does form a heterodimer with the Drosophila ARNT homolog (Tango) and activates transcription without binding a ligand [22,23]. What controls the inherent differences of functions of AhR between vertebrate and invertebrate? We questioned whether key amino acids exist in PAS domain or any factors affect on ligand dependency. In this paper, we used chimeras between mouse and Drosophila AhR to narrow the regions and to analyze the amino acids involved in ligand dependency. The present study showed that Drosophila AhR had no transactivation activity in Hepa-1c1c7 cells, and that a chimeric AhR, in which the PAS-B domain of the Drosophila protein had been introduced into the mouse AhR, exhibited constitutive transactivation. Furthermore, we could narrow the region that is characteristic in ligand dependency using chimera AhR between mouse and Drosophila. These results suggest a molecular mechanism for the differences in the binding of dioxin compounds between species. 2. Materials and methods 2.1. Cell culture The mouse Hepa-1c1c7 hepatoma cell line was cultured in 5% CO2 at 37 °C in Dulbecco's modified Eagle's medium (Nissui, Tokyo, Japan) that contained 5% fetal bovine serum (Biosource International, Inc., Camarillo, CA), 100,000 U/l penicillin, 100 μg/l streptomycin, and 3.7 g/ l NaHCO3. The D. melanogaster S2 cell line was generously provided by Dr. K. Miura (Mie University, Tsu, Japan). S2 cells were cultured at 25 °C in Express Five Serum-free medium (Gibco BRL) that contained 9 mM L-glutamine. 2.2. Chemicals TCDD was obtained from Cambridge Isotope Laboratories (Andover, MA), diluted with DMSO, and used at a final concentration of 2 nM. 2.3. Plasmid constructs for chimeric AhR Dr. Stephen T. Crews (University of North Carolina at Chapel Hill, USA) generously provided the full-length Drosophila AhR (spineless) cDNA, which was described as sscA5 in their report [23,24]. For the reporter gene assays in mouse Hepa-1c1c7 cells, a construct was generated in which Drosophila AhR (dAhR) cDNA, which was truncated at the N-terminal end and encoded amino acids 36–884, was fused with the Gal4-DNA-binding domain (Gal4-DBD) in the mammalian expression vector pFA-CMV (Stratagene, La Jolla, CA). The cDNA was first amplified by PCR using specific primers (Table 1) and the PCR product was ligated into pT7 Blue using pT7 Blue Perfectly Blunt Cloning Kit (Novagen, Inc. Madison, WI). This plasmid DNA was digested with SmaI and NcoI and the N-terminal fragment of dAhR in pBluescriptIISK (+) was replaced by the SmaI–NcoI fragment. The SmaI–HindIII full-dAhR fragment was cut out from the pBSII-dAhR and was ligated into unique cloning sites of pFA-CMV. To construct the chimera between the mouse and Drosophila AhR genes, pBSIISK(+) constructs that contained the mouse AhR (mAhR) or dAhR coding sequences were used as PCR templates. Six fragments that corresponded to the DNA-binding (amino acids 36–224 of dAhR and 37–229 of mAhR), ligand-binding (amino acids 225–410 of dAhR

Table 1 Primers for chimeric Gal4-dAhR. dAhR.SmaIF dAhR.1904R

5′- GGATCCGCCCGGGCTCGGCATCGGGAGCGC -3′ 5′- GCTGACCTTGAAGTCCATGG -3′

Table 2 Primers for chimeric AhR. DMD-1 DMD-2 (pFA-F) DMD-3 DMD-4 DMD-5 DMD-6 DDM-1 DDM-2 DDM-3 DDM-4 (pFA-R) MDD-1 MDD-2 MDD-3 MDD-4

5′- GAAATTCATTGCCAGGAAGCCGCTC -3′ 5′- CAGCATAGAATAAGTGCGAC -3′ 5′- CGGCGGCAGGGGATCCATTATGGG -3′ 5′- AGCGGCTTCCTGGCAATTTCC -3′ 5′- GATGGACCGTCCGAGGAGC -3′ 5′- TGGATCCCCTGCCGCCGCCGGTGAC -3′ 5′- TTTGGGTTTTCATCAGTC -3′ 5′- CGTATTGGCAGAGCGTGGGC -3′ 5′- CCACGCTCTGCCAATACGCACC -3′ 5′- GACTGTGAATCTAAAATACAC -3′ 5′- CTGGTTTTCTGCGCCTGGACATC -3′ 5′- GCTGACCTTGAAGTCCATGG -3′ 5′- CAGCATAGAATAAGTGCGAC -3′ 5′- GTCCAGGCGCAGAAAACCAGATG -3′

and 230–421 of mAhR), and transactivation (amino acids 411–884 of dAhR and 422–805 of mAhR) domains of the two AhR proteins were amplified by PCR using Pfx DNA polymerase (Invitrogen Corp., Carlsbad, CA). The following reaction conditions were used: an initial denaturation for 2 min at 94 °C; 35 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 68 °C for 1 min 30 s. The primers that were used are shown in Table 2. The primary PCR products of Drosophila (D) and mouse (M) fragments were purified from primers before the second step. The overlaps were approximately 20 bases of each primary PCR products, following to combining and annealing at 72 °C. Secondary PCR of the chain extension reaction was performed using LA Taq DNA polymerase (TaKaRa Bio Inc. Otsu, Japan) with outer primers (Table 2). The PCR products were subcloned into pT7-blue. Then, the purified plasmid DNAs were cut with SmaI and NotI in 3′-region of mAhR or SmaI and SacII in 3′-region of dAhR, and the fragments were subcloned into the same unique cloning sites in the pFA-CMV/mAhR or pFA-CMV/dAhR, respectively. For expression in S2 cells, the fragments of mAhR or dAhR were subcloned into the same unique cloning sites in the pAc5.1-V5/HisA vector (Invitrogen Corp., Carlsbad, CA). The sequence of the constructs was confirmed by DNA sequencing using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and analyzed on an ABI PRISM DNA sequencer 310 (Applied Biosystems). Six chimeric AhRs were individually named MDD, MMD, DMD, DMM, DDM and MDM. For further fine mapping of the chimeric protein, pFA-CMV that contained the chimeric MDM-AhR was used as the template for each PCR reaction. To make the additional chimeric Drosophila/mouse expression plasmids, six fragments that corresponded to the Nterminal (N) (amino acids 225–291 of dAhR and 230–299 of mAhR), middle (M) (amino acids 292–350 of dAhR and 300–361 of mAhR), and C-terminal (C) (amino acids 351–417 of dAhR and 362–420 of mAhR) regions of the ligand-binding domain (LBD) were amplified by PCR using Pfx DNA polymerase. The same reaction conditions were used as described above. The primers that were used are shown in Table 3. Heteroduplex synthesis and subcloning were performed as described above. Then, the purified plasmid DNAs were digested with SmaI and NotI, and the fragments were subcloned into the same unique cloning sites in the pFA-CMV/mAhR plasmid. 2.4. Site-directed mutagenesis The single point mutants were created using the Gene Tailor™ Site-Directed Mutagenesis System (Invitrogen Corp.) [25]. Primers were designed to introduce the single point mutations. The chimeric MDM-AhR sequence from SmaI to NotI site inserted in pBSIISK(+) was used as the template for the PCR reaction by using Fast Taq DNA polymerase (Roche Diagnostics, Mannheim, Germany). The template DNA was pretreated with methylase at 37 °C for 60 min. The following PCR reaction conditions were used: an initial denaturation for 4 min at

Author's personal copy K. Kudo et al. / Biochimica et Biophysica Acta 1789 (2009) 477–486 Table 3 Primers for chimeric MDM AhR. mdm-1 mdm-2 mdm-3 mdm-4 dmd-1 dmd-2 dmd-3 dmd-4 mAhR.710F mAhR.1967R

5′- CAAAGGGCAGCTTATCCTGGGCTACGCGGAC -3′ 5′- CTGTAAATCAAGCGCGAGCTCGTCTGCAGCC -3′ 5′- GTAGCCCAGGATAAGCTGCCCTTTGGCAT -3′ 5′- CAGACGAGCTCGCGCTTGATTTACAGAAATG -3′ 5′- CGCGGCAAGCACATTCTGGGCTATACA -3′ 5′- GTAGACCAGGCGTGCATTGGACTGGAC -3′ 5′- TAGCCCAGAATGTGCTTGCCGCGCT -3′ 5′- CAGTCCAATGCACGCCTGGTCTACAAGAAC -3′ 5′- TGA ATGGCTTTGTGCTG -3′ 5′- AAA ATCAATCCCAAGGT -3′

95 °C; 30 cycles each of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 2 min. All the PCR products were transformed into DH5α-T1 cells to remove methylated template DNA. Then, the purified plasmid DNAs was digested with SmaI and NotI, and the fragments were subcloned into the same unique cloning sites in the pFA-CMV/MDM plasmid that contained the Gal4-DBD. The sequence of the constructs was confirmed by DNA sequencing as described above. 2.5. Reporter gene assay Cells were cotransfected with 0.1 μg of the pFA-AhR chimeric or point mutated constructs, 0.4 μg of the pFR-Luc reporter plasmid (Stratagene), which contained the Gal4-binding site upstream of the firefly luciferase coding sequence, and 0.2 μg of pCAG-lacZ as an internal control, which contained the beta-galactosidase coding sequence to check the transfection efficiency. pFA-CMV was used as a negative control plasmid, and the wild-type mAhR expression construct as a positive control. For the S2 cells, the cells were cotransfected with 0.1 μg of the pAct-tgo plasmid, which was generously provided by Dr. Stephen T. Crews [22]. Twenty-four hours after transfection, the cells were treated with medium that contained TCDD at a final concentration of 2 nM or DMSO as a control. The cells were harvested and then lysed with Reporter Lysis Buffer (Promega Corp., Madison, WI). Luciferase activity in the cell extracts was analyzed by using a Luciferase Assay Reagent (Promega Corp.) and a Fluoroskan Ascent fluorometer (Labsystems, Helsinki, Finland). The values in the diagrams represent the mean ± SE of three independent experiments. 2.6. Preparation of cell extracts and immunoprecipitation Cell extracts were prepared and immunoprecipitation was performed according to a modified version of the method described previously by Backlund et al. [26]. Briefly, Hepa-1c1c7 cells were transfected with 1 μg of the pFA-CMV constructs, harvested at 48 h after transfection, and resuspended in 300 μl of cell lysis buffer, which contained 20 mM Tris–HCl (pH 7.4), 137 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, 5 mM NaF, 1 mM Na3VO4, 10 mM Na2MoO4, 20 μM leupeptin, 10 μg/ml aprotinin, and 1 mM PMSF. The cells were lysed by incubation at 4 °C for 15 min with gentle agitation, and the cell lysate was passed through a 21-gauge needle. The lysates were centrifuged for 10 min at 10,000 ×g. The supernatant (1 mg of protein) was precleared by the addition of 2 μl of normal mouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA) and 20 μl of Protein A Sepharose (CL-4B; GE Healthcare Amersham Biosciences, plc., Buckinghamshire, UK) followed by incubation for 30 min at 4 °C with gentle agitation. To immunoprecipitate the wild-type and mutant Gal4-AhR fusion proteins, 20 μl of anti-Gal4-DBD antibody-conjugated agarose beads (sc-510AC; Santa Cruz) was added to the precleared total cell lysate (1 mg of protein) and the mixture was incubated overnight at 4 °C with gentle agitation. The bound complexes were washed twice with immunoprecipitation buffer (20 mM Tris–HCl, pH 7.4, 137 mM NaCl, 1% glycerol, 0.1% TritonX-100, 2 mM EDTA, 5 mM NaF, 1 mM Na3VO4,

479

10 mM Na2MO4, 20 μM leupeptin, 10 μg/ml aprotinin, and 1 mM PMSF) and then washed twice with wash buffer (20 mM Tris–HCl, pH7.4, 137 mM NaCl, 5 mM NaF, 1 mM Na3VO4, 10 mM Na2MoO4, 20 μM leupeptin, 10 μg/ml aprotinin, 1 mM PMSF). Finally, the agarose beads were resuspended in SDS sample buffer (0.01% bromophenol blue, 2% SDS, 5% sucrose, 62.5 mM Tris–HCl, pH6.8, 5% 2-mercaptoehanol) and the immunoprecipitated proteins were analyzed by western blotting. 2.7. Western blotting SDS-PAGE was performed using a 6% polyacrylamide separating gel and a 4% polyacrylamide stacking gel. After electrophoresis, the proteins were transferred to PDVF membrane (GE Healthcare Amersham Biosciences, plc.). The membrane was washed with Tween-TBS (50 mM Tris–HCl, pH 8.0, 137 mM NaCl, 2.7 mM KCl and 0.05% Tween 20) for 10 min, and then blocked for 1 h in TBS (50 mM Tris–HCl, pH 8.0, 137 mM NaCl, and 2.7 mM KCl) that contained 5% skimmed milk (blocking buffer). The membrane was washed twice by agitating in 0.05% Tween-TBS for 10 min and incubated overnight with the antibody against Gal4-DBD (sc-510A; Santa Cruz), which had been diluted in blocking buffer. To detect the interaction between AhR and Tango, we used an antibody against Tango that was generously provided by Dr. Stephen T. Crews [27]. After the membrane had been washed twice in Tween-TBS for 1 h, it was incubated for 2 h with an HRP-conjugated antibody against mouse IgG, which had been diluted in blocking buffer. It was then washed four times with Tween-TBS, each for 15 min. Specific immunoreactive bands were detected using an enhanced chemiluminescence kit (ECL Advance Western Blotting Detection Kit, GE Healthcare Amersham Biosciences, plc.) and X-ray film (Fujifilm Co., Tokyo, Japan). 3. Results 3.1. Design of a chimera between Drosophila and mouse AhRs To construct the chimeric AhR proteins, we used the full-length cDNA sequences for the Drosophila and mouse AhRs, which encode proteins of 884 (97.7 kDa) and 805 (90.4 kDa) amino acids, respectively [24,28–29]. The similarity between the Drosophila and mouse AhRs at the amino acid level is low and only 30% of the amino acids are identical. However, they have a slightly higher sequence identity (40%) in the region that corresponds to the LBD (amino acids 230–421) of mAhR, and amino acids 225–410 of dAhR (Fig. 1A). In order to identify the amino acid residues that are involved in ligand binding in vertebrate AhRs, we prepared chimeric AhRs between the non-ligand-binding dAhR and the ligand-binding mAhR as shown in Fig. 1B. We constructed six chimera in total by exchanging three domains (DNA-binding, ligand-binding, and transactivation domains) (Fig. 2A). 3.2. Drosophila LBD contributes to constitutive activity but mouse LBD does not To evaluate the ligand dependency of the six chimeric AhRs, we performed reporter gene assays in mouse Hepa-1c1c7 or Drosophila S2 cells. As shown in Fig. 2A, the wild-type mAhR and DMM chimeric protein showed ligand-dependent transcriptional activity, but DDM and MDM showed constitutive activity. The AhRs that contained the Drosophila C-terminal amino acid sequence, dAhR, MDD, MMD and DMD, could not activate transcription in Hepa1c1c7 cells. Therefore, it was possible that the Drosophila C terminus could not interact with a mouse transcriptional cofactor. To test this possibility, we performed the same experiment using Drosophila S2 cells. Fig. 2B shows that the AhRs that contained the Drosophila LBD, such as MDM, DDM and dAhR, were constitutively active. However,



Fig. 1. Alignment of the PAS-B sequences of vertebrate and invertebrate AhRs and domain structure of the mouse and Drosophila AhRs. (A) The PAS-B sequences of vertebrate and invertebrate AhRs were aligned using the CLC Sequence Viewer 5 software (http://www.soft82.com/download/windows/clc-sequence-viewer/). (B) The AhR contains a bHLH region that is involved in dimerization with ARNT and in DNA binding. The PAS domain contains the structural repeats, PAS-A and PAS-B, which are involved in AhR/ARNT dimerization (PAS-A) and binding of the ligand and Hsp90 (PAS-B). The C-terminal Q-rich domain is responsible for the transactivation activity of the AhR. Stars show the mouse-AhR mutants that are described in this paper (G294, I319, C327, A375 and Q377).

Author's personal copy K. Kudo et al. / Biochimica et Biophysica Acta 1789 (2009) 477–486

481

Fig. 1 (continued).

the transcriptional activity of DMM, which contained the mouse LBD and transactivation domain (TAD), was ligand-dependent in S2 cells, and the results were similar to those obtained in Hepa-1c1c7 cells. The lower panel of each figure shows the fold increase in luciferase activity due to TCDD (luciferase activity in the presence of TCDD divided by that in the absence of TCDD). These results indicated that the mouse LBD was responsible for ligand-dependent transactivation. Fig. 2C shows that full-length chimeric AhR proteins could be detected by western blotting. These results indicate that specific amino acids within the LBD may be responsible for liganddependent or -independent activity. In order to confirm Tango binding with AhR in S2 cells, we investigated the binding of dAhR to Tango by immunoprecipitation (Fig. 2C lower panel, Tgo). Drosophila AhR and the chimeric DDM-AhR showed a clear interaction with Tango in S2 cells. 3.3. Analysis of LBD by subdivision of MDM chimeric AhR In order to analyze the LBD of mAhR, we subdivided the LBD of the MDM chimeric AhR. To construct the chimeric expression constructs, six fragments were produced in which three small domains within the LBD were exchanged (Fig. 3A). To evaluate the transactivation activity of these six chimeric AhRs, which were named mdd, mmd, dmd, dmm, ddm and mdm, we performed reporter gene assays. As shown in Fig. 3B, mmm, mmd and dmm showed ligand-dependent activity, whereas ddd, mdm, ddm and mdd were constitutively active. Interestingly, comparison of the value of fold induction for mmm with that for mdm showed that the middle portion of the Drosophila LBD region had a critical role in constitutive activity. On the other hand, dmd, dmm, mmd and mmm, which all contained the middle portion of the mouse LBD, did not have transcriptional activity in the absence of TCDD. The chimeric protein dmd was inactive in the absence and presence of TCDD. This lack of activity may be attributable to the N- and C-terminal Drosophila domains, which showed poor activity in the dmm and mmd chimera, respectively. This result suggests that the middle portion of the Drosophila LBD region may be required for ligand-independent transcriptional activity and for maintaining activity in the absence of a ligand. Fig. 3C shows that the levels of protein expression of these chimeric constructs were almost equal. 3.4. Identification of amino acids in mouse LBD that are responsible for ligand-dependent transactivation Given that the LBD is important for ligand-dependent activity (Figs. 2 and 3), we tried to identify which amino acids in the LBD, especially in

the middle region, play an essential role. Previous reports have identified the key amino acid residues in the LBD of mAhR as Ile319, Cys327 and Ala375 [30–33]. These amino acids are conserved reasonably well among vertebrate animals (Fig. 1A). The corresponding amino acids in dAhR were assigned as Val308, Val316and Cys364, respectively, and they were located in a hydrophobic pocket, as shown in Fig. 4A. We searched for amino acids that were conserved among vertebrate AhRs, but were not conserved in the Drosophila and C. elegans proteins. We selected two amino acid residues, Gly293 and Gln377, in the mAhR, which were in the region of the hydrophobic pocket (Fig. 4A). We introduced point mutations into the chimeric MDM-AhR: the Drosophila amino acids described above were replaced individually with those found in the mAhR. We evaluated the mutant AhR proteins by reporter gene assay. It was expected that the replacement of these amino acid residues in the chimeric MDM-AhR would change the ligand dependency of the protein. Fig. 4B and C shows that the C364A, V316C and S283Q mutations decreased the level of transactivation of the reporter gene to that obtained with wild-type mAhR. However, these mutations did not change the ligand dependency from dAhR- to mAhR-type. The V308I mutation did not affect transactivation and the H366Q mutation reduced the activity of the protein markedly. Single point mutations may not be sufficient to change the characteristics of the AhR. Therefore, we designed a series of proteins in which multiple amino acids were mutated. These included M2 (H366Q/S283G), M3 (H366Q/S283G/V308I), M4 (H366Q/S283G/V308I/C364A), and M5 (H366Q/S283G/V308I/C364A/V316C). Fig. 4D shows that the combination of mutations did not alter the transcriptional activity or the ligand dependency when compared to the effect of the H366Q mutation alone. Fig. 4E shows that the levels of protein expression of the mutational constructs are almost equal but V308I and H366Q was poor expression. 3.5. Mutation analysis of the LBD region of mouse AhR The LBD of mAhR is important for ligand-dependent activation, as described above. Jacobs et al. and Procopio et al. have determined previously that an Arg residue in the LBD interacts with the chlorine of TCDD, and the benzene ring of a Phe residue participates in holding the benzene ring of TCDD in the hydrophobic pocket [34,35]. Initially, we designed a number of mAhR mutants that were point mutated in the LBD, and evaluated them by reporter gene assay (data not shown). We identified two amino acids that were involved in transactivation of the reporter gene (Fig. 5A). F345A and R346A showed reduced transcriptional activity. This result was in agreement with those shown in Fig. 4. Due to the fact that Phe345 and Arg346 are located in the hydrophobic pocket of AhR, they are the first amino acid residues that have been



Fig. 2. Transactivation of a reporter gene by chimeric Gal4-AhR fusion proteins in transiently-transfected mouse Hepa-1c1c7 (A) or D. melanogaster S2 (B) cells, and expression levels of the chimeric AhRs (C). Cells were cotransfected with the pFA-CMV/chimeric AhR constructs (0.1 μg), the pFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg) as an internal control. We used pFA-CMV plasmid DNA as a negative control and the wild-type mAhR expression construct as a positive control. On the day after transfection, the cells were treated for 24 h with 2 nM TCDD (open bars) or DMSO (filled bars) as a control. The luciferase activity of the cell extracts was normalized with respect to β-galactosidase activity. Data are shown as the mean ± SD from three independent experiments. The lower panel of each graph shows the fold increase in luciferase activity due to TCDD (luciferase activity in the presence of TCDD divided by that in the absence of TCDD). (C) Hepa-1c1c7 cells were transfected with 1.0 μg of the pFA-CMV/chimeric AhR constructs. After incubation for 48 h, total cell extracts were immunoprecipitated using an antibody against Gal4-DBD. The expression level of the Gal4-AhR proteins was analyzed by western blotting using an antibody against Gal4-DBD. The upper panel shows the expression levels of the proteins in Hepa-1c1c7 cells and the lower panel shows their expression levels in S2 cells. The bottom panel for the S2 cells shows the membrane after it was reprobed with an antibody against Tango (Tgo).

reported to be associated with ligand binding. We determined that Phe345 and Arg346 in mAhR corresponded to Tyr334 and Arg335 in dAhR (as shown in Fig. 1, open stars). We therefore tested whether Y334F and R335A mutations in MDM-AhR affected transactivation (Fig. 5A, right panel). The Y334F mutation decreased the level of transactivation of the reporter gene slightly to that obtained with mAhR, whereas the R335A mutant showed poor activity. Fig. 5C shows the levels of protein expression. Although the expression level of the Y334F mutant (the arrow head in the long exposure panel) was low compared with that of R335A, the activity of Y334F was higher than that of R335A. Fig. 5D shows a summary of the functional domains of AhR and the key amino acid residues that are described above. 4. Discussion The AhR is a member of the bHLH-PAS superfamily of transcription factors and is widely conserved throughout the animal kingdom.

Interestingly, in many species, the activation of AhR requires binding to xenobiotic chemicals. In vertebrate AhRs, the activation mechanism is ligand-dependent [10]. However, in invertebrate AhRs, activation is not ligand-dependent and the proteins are constitutively active, at least in Drosophila and C. elegans [20,21]. In this report, we showed that the functional domain that determines ligand-dependent or -independent activity corresponds to amino acids 300–361 in mAhR. These results are in agreement with previous findings by McGuire et al., which indicated that the deletion of the LBD (amino acids 230–421) from mAhR resulted in constitutive activation [36]. Moreover, we showed that a much smaller region (amino acids 300–361) was essential for ligand binding by swapping this fragment with that of dAhR, which does not require ligand binding for transactivation. The mouse sequence in this region contributes to ligand-dependent activation by participating in the ligand-binding site, therefore this sequence may keep mAhR inactive in the absence of ligand.


483

Fig. 3. Transactivation of a reporter gene by a chimeric LBD within the mAhR protein. (A) Diagram of chimeric constructs. Six chimeric constructs were generated by exchanging three small domains within the LBD, which were designated the N, M and C regions. (B and C) Hepa-1c1c7 cells were cotransfected with the pFA-CMV/chimeric AhR constructs (0.1 μg), the pFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg). pFA-CMV and the wild-type mAhR expression construct were used as a negative and a positive control, respectively. Twenty-four hours after transfection, the cells were treated with 2 nM TCDD (filled bars) or DMSO, as a control (open bars). The cells were harvested by the addition of lysis buffer and luciferase activity was measured. Data are shown as the mean ± SD from three experiments. The right hand panel of each graph shows the fold increase in luciferase activity due to TCDD (luciferase activity in the presence of TCDD divided by that in the absence of TCDD). (D) Hepa-1c1c7 cells were transfected with the pFA-CMV/chimeric AhR plasmids (1 μg). After incubation for 48 h, total cell extracts were immunoprecipitated using an antibody against Gal4-DBD. The expression level of the Gal4-AhR proteins was analyzed by western blotting using an antibody against Gal4-DBD.

However, we did not investigate the affinity constants of the mutants by ligand-binding assay. Further analysis will be necessary to determine whether the mutants that we examined can bind the ligand. It has been shown previously that the amino acids that are associated with ligand binding in mAhR are Ala375, Phe318A, Ile319 and His320 [30–33]. In the present study, we found that Phe345 and Arg346 may have played a critical role in the activation by ligand binding. Furthermore, the F345A mutant was shown to be localized in the cytoplasm by fluorescence imaging of an AhR/F345A-YFP (yellow fluorescent protein) fusion protein in COS-1 cells (data not shown) in the presence of TCDD. Interestingly, the R346A mutant localized to the nucleus (data not shown). These results suggest that Phe345 may be involved in nuclear import by ligand-binding activation. On the other

hand, Arg346 may be associated with transcriptional activity. Given that Arg346 in mAhR and Arg335 in dAhR were required for transcriptional activity, these Arg residues were necessary to keep both of the AhRs in the active form irrespective of the requirement for ligand binding. On the other hand, other amino acids had little direct effect on ligand-dependent activity of AhR. In some cases, the amount of protein detected is relatively low. In particular, the fact that the protein level of V308I and Y334F are lower than WT may be caused by degradation in cell. It is possible that these changes of amino acid in AhR-MDM altered the conformation of the protein and it enhanced the protein degradation. However the transcriptional activity of the constructs are relatively high. We may explain this observation as follows. Because the constitutively active AhR-MDM does not require the ligand binding, the mutant proteins could initiate the transcription



Fig. 4. Effect of point mutations within the LBD of the chimeric MDM-AhR protein on the transactivation activity and protein expression level. (A) Schematic representation of the 3D structure of the hydrophobic region in the LBD of mAhR. The five arrows indicate the positions of the single point mutations that were introduced into the Gal4-AhR construct. This structural model was generated using the program 3D-PSSM (http://www.sbg.bio.ic.ac.uk/~3dpssm/index2.html). The 3D structure was simulated using 800 amino acids of the full-length mouse AhR (805 amino acids), and was based on the crystal structure of homologous PAS family members, in particular the PAS-B structure of hypoxia inducible factor 2α, which has high homology to AhR. (B–D) Hepa-1c1c7 cells were cotransfected with the pFA-CMV/chimeric AhR constructs (0.1 μg), the pFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg). pFA-CMV and the wild-type mAhR expression construct were used as a negative and a positive control, respectively. Twentyfour hours after transfection the cells were treated with 2 nM TCDD (filled bars) or DMSO (open bars), as a control, and were harvested by the addition of lysis buffer. The luciferase activity in the cell extracts was measured. Data are shown as the mean ± SD from three independent experiments. (E) Hepa-1c1c7 cells were transfected with pFACMV/MDM and the series of mutants that are described in panel D. The expression level of the Gal4-AhR proteins was analyzed as described in the legend for Fig. 3. Specific immunoreactive bands were detected using an enhanced chemiluminescence kit, ECL Advance Western Blotting Detection Kit (upper panel) and ECL plus Western blotting detection reagents (lower panel).


485

Fig. 5. Effect of point mutations within the LBD of mAhR and MDM-AhR on the transactivation activity (A and B). Hepa-1c1c7 cells were cotransfected with the mutated pFA-CMV/ AhR constructs (0.1 μg), the pFR-Luc reporter plasmid (0.4 μg), and pCAG-lacZ (0.2 μg). pFA-CMV and the wild-type mAhR expression construct were used as a negative and a positive control, respectively. Twenty-four hours after transfection, the cells were treated with 2 nM TCDD (filled bars) or DMSO (open bars) as a control. The cells were harvested by the addition of lysis buffer and luciferase activity was measured. Data are shown as the mean ± SD from three independent experiments. (C) Hepa-1c1c7 cells were transfected with pFACMV/mAhR, pFA-CMV/MDM (1 μg) or the point mutated constructs. The expression level of the Gal4-AhR proteins was analyzed as described in the legend for Fig. 3. Specific immunoreactive bands were detected using an enhanced chemiluminescence kit, ECL Advance Western Blotting Detection Kit (upper panel) and ECL plus Western blotting detection reagents (lower panel). (D) Summary of the functional domains of AhR and key amino acid residues. The novel domain that is essential for determining whether the transactivation activity is ligand-dependent or -independent was identified as amino acids 291–350 in the Drosophila AhR.

promptly and the small amount of protein may be enough to start the transcription. Again further analysis will be required to determine whether these mutants can bind the ligand. As shown in Fig. 2B, dAhR was constitutively active when the reporter gene assay was performed in Drosophila S2 cells. Due to the fact that dAhR required Tango, the homolog of mouse ARNT, for activity in this assay (data not shown), pAct-Tango was cotransfected with pAc5.1-dAhR for the reporter gene assay. This is in agreement with the previous observation by Emmons et al. [23]. The chimeric AhRs that contained the Drosophila TAD, DMD, MMD and MDD, showed reduced levels of activation compared with those that contained the mouse TAD. We assume that dAhR requires interaction with Tango and the TAD of Tango for full activity, due to the weak transactivation activity of the Drosophila TAD. According to this hypothesis, we can explain the low transactivation level of the chimeric AhRs that contain the Drosophila TAD: the chimeric AhRs that contain the mouse DBD or LBD (DMD, MMD and MDD) may not bind to Tango efficiently. Drosophila AhR and the chimeric DDM-AhR showed a clear interaction with Tango in S2 cells. Further analysis is required to examine the role of Tango in the transcription complex in S2 cells.

In conclusion, we have identified two molecular mechanisms that are involved in the ligand-dependent or -independent activation of AhR. Firstly, amino acids 291–350 of dAhR were required to activate transcription in the absence of ligand. Secondly, the middle portion of the mouse LBD was required to inactivate transcription in the absence of ligand, and the adjacent N- and C-terminal regions were required for ligand-dependent activity. It was evident that Arg346 of mAhR and Arg335 of dAhR were required to keep these proteins in their active forms, irrespective of the requirement for ligand binding. Our results support the role of AhR as a sensor of extracellular signals that induces biological responses, and argue for the characterization of the conformational state of AhR in the active or inactive form. Acknowledgements We thank Dr. Stephen T. Crews for providing us with the full-length Drosophila AhR cDNA used for these studies. We also thank Dr. K. Miura for providing us with S2 cell. This work was supported by Grant-in-Aid for Science Research (B) (No.15310032) from the Ministry of Education, Culture, Sports, Science and Technology



(Monbu Kagakusho). We thank the staff of the Gene Research Center, Hirosaki University for the use of the facility. References [1] M.S. Denison, J.M. Fisher, J.P. Whitlock, Inducible, receptor-dependent protein– DNA interactions at a dioxin-responsive transcriptional enhancer, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 2528–2532. [2] J.P. Whitlock, S.T. Okino, L. Dong, H.P. Ko, R. Clarke Katzenberg, Q. Ma, H. Li, Cytochromes P450 5: induction of cytochrome P4501A1: a model for analyzing mammalian gene transcription, FASEB J. 10 (1996) 809–818. [3] J.P. Whitlock, Induction of cytochrome P4501A1, Annu. Rev. Pharmacol. Toxicol. 39 (1999) 103–125. [4] M.S. Denison, S.R. Nagy, Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals, Annu. Rev. Pharmacol. Toxicol. 43 (2003) 309–334. [5] S.H. Safe, Modulation of gene expression and endocrine response pathways by 2,3,7,8-tetrachlorodibenzo-p-dioxin and related compounds, Pharmacol. Ther. 67 (1995) 247–281. [6] A. Poland, J.C. Knutson, 2,3,7,8-tetrachlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examination of the mechanism of toxicity, Annu. Rev. Pharmacol. Toxicol. 22 (1982) 517–554. [7] L.S. Birnbaum, The mechanism of dioxin toxicity: relationship to risk assessment, Environ. Health Perspect. 102 (Suppl. 9) (1994) 157–167. [8] A.B. Okey, M.A. Franc, I.D. Moffat, N. Tijet, P.C. Boutros, M. Korkalainen, J. Tuomisto, R. Pohjanvirta, Toxicological implications of polymorphisms in receptors for xenobiotic chemicals: the case of the aryl hydrocarbon receptor, Toxicol. Appl. Pharmacol. 207 (2005) 43–51. [9] T. Moriguchi, H. Motohashi, T. Hosoya, O. Nakajima, S. Takahashi, S. Ohsako, Y. Aoki, N. Nishimura, C. Tohyama, Y. Fujii Kuriyama, M. Yamamoto, Distinct response to dioxin in an arylhydrocarbon receptor (AHR)-humanized mouse, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 5652–5657. [10] M.E. Hahn, Aryl hydrocarbon receptors: diversity and evolution, Chem. Biol. Interact. 141 (2002) 131–160. [11] B.L. Taylor, I.B. Zhulin, PAS domains: internal sensors of oxygen, redox potential, and light, Microbiol. Mol. Biol. Rev. 63 (1999) 479–506. [12] R.J. Kewley, M.L. Whitelaw, A. Chapman Smith, The mammalian basic helix–loop– helix/PAS family of transcriptional regulators, Int. J. Biochem. Cell. Biol. 36 (2004) 189–204. [13] M.J. Lees, M.L. Whitelaw, Multiple roles of ligand in transforming the dioxin receptor to an active basic helix–loop–helix/PAS transcription factor coplex with the nuclear protein Arnt, Mol. Cell. Biol. 19 (1999) 5811–5822. [14] M.S. Denison, A. Pandini, S.R. Nagy, E.P. Baldwin, L. Bonati, Ligand binding and activation of the Ah receptor, Chem. Biol. Interact. 141 (2002) 3–24. [15] S.T. Crews, C.M. Fan, Remembrance of things PAS: regulation of development by bHLH-PAS protein, Curr. Opin. Genet. Dev. 9 (1999) 580–587. [16] W. Gong, B. Hao, S.S. Mansy, G. Gonzalez, M.A. Gilles Gonzalez, M.K. Chan, Structure of a biological oxygen sensor: a new mechanism for heme-driven signal transduction, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 15177–15182. [17] J.L. Pellequer, K.A. Wager Smith, S.A. Kay, E.D. Getzoff, Photoactive yellow protein: a structural prototype for the three-dimensional fold of the PAS domain superfamily, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 5884–5890. [18] M. Ashok, C. Turner, T.G. Wilson, Insect juvenile hormone resistance gene homology with the bHLH-PAS family of transcriptional regulators, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 2761–2766. [19] K. Miura, M. Oda, S. Makita, Y. Chinzei, Characterization of the Drosophila Methoprene-tolerant gene product. Juvenile hormone binding and liganddependent gene regulation, FEBS J. 272 (2005) 1169–1178. [20] R.A. Butler, M.L. Kelley, W.H. Powell, M.E. Hahn, R.J. Van Beneden, An aryl hydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evidence that invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-pdioxin and beta-naphthoflavone binding, Gene 278 (2001) 223–234. [21] J.A. Powell Coffman, C.A. Bradfield, W.B. Wood, Caenorhabditis elegans orthologs of the aryl hydrocarbon receptor and its heterodimerization partner the aryl hydrocarbon receptor nuclear translocator, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 2844–2849. [22] M. Sonnenfeld, M. Ward, G. Nystrom, J. Mosher, S. Stahl, S. Crews, The Drosophila tango gene encodes a bHLH-PAS protein that is orthologous to mammalian Arnt and controls CNS midline and tracheal development, Development 124 (1997) 4571–4582.

[23] R.B. Emmons, D. Duncan, P.A. Estes, P. Kiefel, J.T. Mosher, M. Sonnenfeld, M.P. Ward, I. Duncan, S.T. Crews, The spineless-aristapedia and tango bHLH-PAS proteins interact to control antennal and tarsal development in Drosophila, Development 126 (1999) 3937–3945. [24] D.M. Duncan, E.A. Burgess, I. Duncan, Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor, Genes Dev. 12 (1998) 1290–1303. [25] J.C. Shen, W.M. Rideout, P.A. Jones, High frequency mutagenesis by a DNA methyltransferase, Cell 71 (1992) 1073–1080. [26] M. Backlund, M. Ingelman Sundberg, Different structural requirements of the ligand binding domain of the aryl hydrocarbon receptor for high- and low-affinity ligand binding and receptor activation, Mol. Pharmacol. 65 (2004) 416–425. [27] L. Jiang, S.T. Crews, Transcriptional specificity of Drosophila dysfusion and the control of tracheal fusion cell gene expression, J. Biol. Chem. 282 (2007) 28659–28668. [28] K.M. Burbach, A. Poland, C.A. Bradfield, Cloning of the Ah-receptor cDNA reveals a distinctive ligand-activated transcription factor, Proc. Natl. Acad. Sci. U. S. A. 89 (1992) 8185–8189. [29] M. Ema, K. Sogawa, N. Watanabe, Y. Chujoh, N. Matsushita, O. Gotoh, Y. Funae, Y. Fujii Kuriyama, cDNA cloning and structure of mouse putative Ah receptor, Biochem. Biophys. Res. Commun. 184 (1992) 246–253. [30] M. Ema, N. Ohe, M. Suzuki, J. Mimura, K. Sogawa, S. Ikawa, Y. Fujii Kuriyama, Dioxin binding activities of polymorphic forms of mouse and human arylhydrocarbon receptors, J. Biol. Chem. 269 (1994) 27337–27343. [31] S.I. Karchner, D.G. Franks, S.W. Kennedy, M.E. Hahn, The molecular basis for differential dioxin sensitivity in birds: role of the aryl hydrocarbon receptor, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 6252–6257. [32] I.A. Murray, R.K. Reen, N. Leathery, P. Ramadoss, L. Bonati, F.J. Gonzalez, J.M. Peters, G.H. Perdew, Evidence that ligand binding is a key determinant of Ah receptormediated transcriptional activity, Arch. Biochem. Biophys. 442 (2005) 59–71. [33] K. Goryo, A. Suzuki, C.A. Del Carpio, K. Siizaki, E. Kuriyama, Y. Mikami, K. Kinoshita, K. Yasumoto, A. Rannug, A. Miyamoto, Y. Fujii Kuriyama, K. Sogawa, Identification of amino acid residues in the Ah receptor involved in ligand binding, Biochem. Biophys. Res. Commun. 354 (2007) 396–402. [34] M.N. Jacobs, M. Dickins, D.F. Lewis, Homology modelling of the nuclear receptors: human oestrogen receptorbeta (hERbeta), the human pregnane-X-receptor (PXR), the Ah receptor (AhR) and the constitutive androstane receptor (CAR) ligand binding domains from the human oestrogen receptor alpha (hERalpha) crystal structure, and the human peroxisome proliferator activated receptor alpha (PPARalpha) ligand binding domain from the human PPARgamma crystal structure, J. Steroid. Biochem. Mol. Biol. 84 (2003) 117–132. [35] M. Procopio, A. Lahm, A. Tramontano, L. Bonati, D. Pitea, A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor, Eur. J. Biochem. 269 (2002) 13–18. [36] J. McGuire, K. Okamoto, M.L. Whitelaw, H. Tanaka, L. Poellinger, Definition of a dioxin receptor mutant that is a constitutive activator of transcription: delineation of overlapping repression and ligand binding functions within the PAS domain, J. Biol. Chem. 276 (2001) 41841–41849.

Glossary AhR: aryl hydrocarbon receptor bHLH-PAS: basic helix–loop–helix-Period–Arnt–Sim CYP1A1: Cytochrome P450 1A1 TCDD: 2,3,7,8-tetrachlorodibenzo-p-dioxin PAHs: polycyclic aromatic hydrocarbons HAHs: halogenated aromatic hydrocarbons ARNT: aryl hydrocarbon receptor nuclear translocator PYP: photoactive yellow protein Met: Methoprene-tolerant FBS: fetal bovine serum DMSO: dimethyl sulphoxide PCR: polymerase chain reaction EDTA: ethylenediaminetetraacetic acid PMSF: phenylmethylsulfonyl fluoride PVDF: polyvinylidene fluoride HRP: horseradish peroxidase ECL: enhanced chemiluminescence YFP: yellow fluorescence protein