tide YY is stimulated by nutritive factors, in particular, the presence of fat in the ..... The cDNA includes an open reading frame of 285 base- pairs encoding a ...
THEJOURNALOF BIOLOGICAL CHEMISTRY
Val. 262, No. 27, Issue of September 25, pp. 12984-12988.1987 Printed in U.S.A.
0 1987 by The American Society for Biochemistry and Molecular Biology, Inc.
Peptide YY STRUCTURE OF THE PRECURSOR AND EXPRESSIONINEXOCRINE
PANCREAS* (Received for publication, May 11, 1987)
Andrew B. LeiterSQ,Amy ToderS, HubertJ. Wolfell, I. L. TaylorII, Sharon Cooperman**, Gail Mandel**, and Richard H. Goodman** From the $Division of Gastroenterology, the (Department of Pathology, and the **Divisionof Molecular Medicine,New England Medical Center, Boston, Massachusetts 02111 and the 11Division of Gastroenterology, Duke University Medical Center, Durham, North Carolina 27710
Peptide YY is a 36-residue gastrointestinal hormone reagent that would detect peptide YY-producing cells specifwhich inhibits both pancreatic and gastric secretion. ically, we initiated studies to clone the cDNA encoding the YY peptide YY precursor. We have isolated a cDNAencodingthepeptide precursorby screening a rat intestinal Xgtll cDNA Isolation of cDNAs encoding hormones such as peptide YY library with an antiserum directed against the porcine that are synthesized at low levels by isolated cells scattered hormone. The nucleotide sequence of the cDNA en- throughout the gastrointestinal tract has been problematic. codes a98-residue protein (molecularweight, 11, 121) In the present study we have isolated a cDNA encoding the which has an amino acid sequence identical to thatof precursor of rat peptide YY by screening a cDNA expression porcine peptide YY. Rat peptide YY is preceded im- library cloned in bacteriophage Xgtll. Northern blot analyses mediately by a signal sequence and followed by cleava and in situ hybridizations using a peptide YY probe demonage-amidation sequence Gly-Lys-Arg plus 3 1 additional amino acids. Thus the peptide YY precursor is strate that thepeptide YY gene is more actively expressed in similar in structure to that of two related peptides, the exocrine pancreas than previously realized. pancreatic polypeptide and neuropeptideY. RNA blot MATERIALS ANDMETHODS hybridizationsreveal that the peptide YY gene is much more actively expressed in pancreas than previously Antiserum, Peptides-Characterization of the antiserum raised realized. In situ hybridizations localized peptide YY against bovine peptide YY has been described previously (9). This cells exclusively to the exocrine pancreas. The abun- antiserum exhibitsminimal cross-reactivity with neuropeptide Y and dance of peptide YY in one of its target organs, the no cross-reactivity with pancreatic polypeptide or othergut peptides. pancreas, suggests a paracrine mechanism for peptidePrior to uae the antiserum was preadsorbed for several hours with a lysate of Escherichia coli strain Y1090. Synthetic porcine peptide YY YY in regulating pancreatic enzyme secretion. was obtained from Peninsula Laboratories.
Peptide YY is a 36-residue peptide synthesized primarily in isolated mucosal endocrine cells scattered in the colon and the ileum (1, 2). Peptide YY is also found in lesser amounts in other tissues including pancreas, jejunum, stomach (antrum), heart, pituitary, and duodenum (2, 3). Release of peptide YY is stimulated by nutritive factors, in particular, the presence of fat in the ileum and colon (4).Its actions include inhibition of gastric emptying and intestinal motility, inhibition of pancreatic exocrine secretion, inhibition of gastric acid and pepsin secretion, and reduction in mesenteric blood flow (2, 5, 6). Peptide YY may therefore mediate the long postulated pancreatone and enterogastrone activities of the colonic and ileal mucosa (7). The structure of peptide YY is similar to two other peptides, pancreatic polypeptide and neuropeptide Y (8).This similarity has limited the usefulness of immunochemical techniques to study peptide YY synthesis and localization. To obtain a * This work was supported by National Institutes of Health Grant DK37673 and Grant P30AM39428 from the Center for Gastroenterology Research on Absorptive and Secretory Processes. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18U.S.C. Section 1734 solelyto indicate this fact. 5 Recipient of the AGA/William H. Rorer Industry ScholarAward. To whom correspondence should be addressed Division of Gastroenterology, Box 233, New England Medical Center, 750 Washington St., Boston, MA 02111.
Construction of a Rat Intestinal cDNA Expression Library-Polyadenylated RNA was prepared (10) from neonatal rat intestine. Following first strand synthesis using avian myeloblastosis virus reverse transcriptase (Life Sciences), second strand cDNA synthesis was accomplished with RNase H and the large fragment of DNA polymerase I (11). The cDNA was treated with EcoRI methylase and ligated to EcoRI linkers. The cDNAs were ligated into theEcoRI site of bacteriophage Xgtll DNA arms andpackaged into phage particles as described previously (12). Approximately 3 X lo7 recombinant bacteriophage were generated from 1pg of cDNA. Immunoscreening of the Rat Intestinal Expression Library-An aliquot of the amplified intestinal cDNA library was used to infect E. coli strain Y1090 and plated at a density of 30,000 plaques/plate. Following growth and lysis a t 42 "Cfor 4-5 h, the plates were overlaid with nitrocellulose filters (Schleicher & Schuell, BA85) precoated with 10 mM isopropylthiogalactoside and were incubated for 2.5 h a t 37 "C to induce synthesis of &galactosidase fusion proteins. After overnight incubation with a 1:450 dilution of peptide YY antiserum, the filters were washed as previously described (13) and incubated for 4 h with a 1:800 dilution of the IgG fraction of goat anti-rabbit I& conjugated to alkaline phosphatase (Miles Scientific). Bound alkaline phosphatase activity was detected with fast red TR using naphthol AS-MX phosphate as a substrate (13). Immunopositive bacteriophage were plaque-purified by sequential low density plating. In control. experiments, antiserum was preadsorbed by an 18-h incubation with a 200-fold excess of synthetic peptide YY (1.25 pgof peptide YYfpl of antiserum). Plaqw Hybridization Screening of a Rat Genomic Library-A 30base synthetic oligonucleotide [5'-GCAGCATTGCGACCATAACGGGCCAAGGCC-3'1 corresponding to sequence at the 5' end of the peptide YY cDNA was utilized to screen a rat genomic library (14). Hybridizations with the 5' end-labeled oligonucleotide (300,000 cpm/ml) were performed at 50 "C in 6 X SSC (1 X SSC = 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) containing 5 X Denhardt's solution (0.02% Ficoll, 0.02% bovine serum albumin, 0.02% polyvi-
12984
12985
3
B
19
CGAGCTCGCTGTGAGATAGCTAGATGCACCACAATGCTCTCCTCCTX
109 79 ATG GTG GCG GTA CGC AGG CCT TGG CCC GTT ATG GTC (;wL ATG CTG CTT GTC CTG CTC GCC Mot V a l Ala Val Arg Arg Pro Trp Pro V a l Met Val N a Met Leu Leu Val Leu Leu Ala sipn*l D.phid.""""""""""""""""-
,""""""""""""""-
169
139
Pcc CTG GGA GCG CTG GTG GAC GCC TAC CCC GCT AAA CCA GAG GCT CCG GGC G M GAT GCC Cys Leu G l y Ala Leu Val U p Ala Tyr Pro Ala Lyo Pro G l u Ala Pro Gly Glu Asp Ala
""""""""""""""",
)""""""""""""
199 229 TCC CCG GAG GAG CTG AGC CGC TAC TAT GCT TCC CTG CGC CM: TAC CTC M C CTG GTC ACC P r o Glu G l u Leu Ser Ar9 Tyr T y r Ma Ser Leu Arg His Tyr Leu Asn Leu V a l Thr ***hi& W""""""""""""""""""
Sar
"""""_"""~
259 28s CAG CGG TAT GGG AAh AGA G M G T C CCC GCA GCT CTG TTC TCC AAA CTG C K TTC ACA Arg Gln Arg Tyr G l u Val Pro Ala Ala Leu Phe Ser Lys Leu Leu Phe Thr CGG
I
" " " " " " "
,"""""""""""""
319 350 TTC AGG TCT CGG CCA GAA GGT GTG GAC CAG TGG "CIC Asp Asp Ser G l u Asn Leu Pro Phe Arg Ser Arg Pro Glu G l y Val Asp Gln Trp END c %rN.r). eo.:^"""""""""""- I GAC GAC AGC GAG M T CTC CCC
"""_"""~
389 G C C C I U G G C C T C C C G T G M ; A T G ~ T ~ T ~ C C ~ ~ ~ T ~ A T G ~ G G T ~ ~ ~ ~ ~ G T G T C
468 TCAGACACCCAGGCTGGAGGGCTGTGTGTG~CATGTCCCCGKCTCA~~CAT-TXGCACA
reoLy A ) FIG. 1. Structure of peptide YY precursor deduced from the cDNA. A, schematic representation of the peptide YY precursor and cDNA. Domains of the mRNA are enclosed in boxes; 3'UT, 3"untranslated region; Ert. Pept., COOH-terminalextension peptide. Restrictionmap of cDNA is shown beneath the huuy black bar. Sequencing strategy is indicated by arrows. Dashed arrow denotes a 3'4abeled fragment, light arrows indicate 5'labeled fragments and sequences determined by chain termination.The portions of the precursor structure deduced from genomic sequences are indicated by the uerticalfystriped bar above the cDNA. B , nucleotide sequences of the peptide YY cDNA and genomic subclone. Numbers above the text denote the nucleotide position. The deduced amino acid sequence is shown below the nucleotide sequences. The polyadenylation recognition signal AATAAA is double underlined. nylpyrrolidone). Filters were washed in 2 X SSC, 0.1% SDS at 42 'C and in 0.2 X SSC, 0.1% SDS' at 37 "C,and hybridization was detected by autoradiography. Positive clones were rescreened at higher stringency ( 6 5 "C, 5 X SSC) with the peptide YY cDNA labeled by priming with random hexanucleotides. DNA Sequencing-DNA was subcloned into the vector pGEM3 (Promega Biotech) and was sequenced by the chemical method (15) or by the chain termination method as adapted for double-stranded circular DNA (16). Preparation of Total Cellular RNA-Rat tissues were immediately removed from animals and eitherfrozen in liquid nitrogen or homogenized immediately (pancreas). RNA was prepared by previously described techniques (10). Total cellular RNA was quantitated by the absorbance at 260 nm and by the UV fluorescence intensity of the ribosomal subunits on native agarose gels stained with ethidium bromide. Northern Blot Analyses-Qual amounts of up to 30 pg of total
' The abbreviation used is: SDS, sodium riodecyl sulfate.
cellular RNA were loaded onto 1.2% agarose gels containing 6.5% formaldehyde. Following electrophoresis at 250 V, the RNAwas transferred by capillary blotting to nylon membranes (Zeta probe, Bio-Rad). Antisense RNA hybridization probes were constructed by cloning a 291-basepair StuI restriction fragment (see Fig. L4) into the S m I site of pGEM3. Radiolabeled antisense transcripts were generated from plasmid linearized with BamHI using T7 RNA polymerase (Promega Biotec) and [cu-~*P]UTP.Hybridization was carried out for 24 h at 68 'C in solution containing 50% formamide, 0.75 M NaCl, 0.15 M Tris-C1, pH 8,0.005 M EDTA, 0.05 M sodium phosphate, pH 6.5, 1%SDS, heparin 500 pg/ml, and probe, 10' cpm/ml. Blots were washed as described previously (17). For several of the blots, an end-labeled synthetic 20-mer [5'-CACGCGAGGCCTTGGGGGTCT-3'1 complementary to the 3"untranslated region of the peptide YY cDNA was used as probe. In these cases, hybridization was carried out for 24 h at 55 "C in solution containing 6 X SSC, 1 X Denhardt's solution, 1% SDS, 200 pg/ml denatured DNA from salmon testis, and probe, 750,000cpm/ml. The blots probed with the oligonucleotidewere washed for 2 h at room temperature in 6 X SSC, 1%SDS.
350
Rat Peptide YY Precursor
12986
4
FIG. 2. Analysis of peptide YY mRNA.A, localization of peptide YY mRNA by Northern blot hybridizations. An equal amount of total cellular RNA (30 pg) from each tissue was electrophoresed on a 1.2%denaturing formaldehyde-agarosegel and transferred by blotting to a nylon membrane. The membrane was probed with the 291nucleotide antisense RNA probe (see text); lane 1, colon; lane 2, rectum; lane 3, pancreas; lanes 4 and 5, prolonged autoradiographic exposure of the same blot; lane 4, pancreas; lane 5, antrum. B, comparison of pancreatic and intestinal peptide YY mRNA by ribonuclease protection. Thirty pgof RNA was hybridized to lo7 cpm probe (P)which consisted of RNA sequences complementary to a 175-nucleotide StuI-DdeI restriction fragment (see Fig. IA)and 28 nucleotides of vector. The hybrids were digested with ribonucleases A and T1 (see Ref. 20). Lune 1, undigested probe; lane 2, yeast tRNA; lane 3, ileum; lane 4, pancreas. Arrow denotes protected 175-base fragment. RiborucclecrPeProtection Studies-Thirty pg of RNA was hybridized overnight at 45 "Cwith 10' cpm of an antisense RNA probe consisting of sequences complementary to a 175 nucleotide StuI-DdeIrestriction fragment (see Fig. IA)and 28 nucleotides of the vector pCEM3. The hybrids were digested with 12 pg of ribonuclease A (Sigma) and 20 units of ribonuclease T1 (Behring Diagnostics) for 30 min at 37 'C, and fragments protected from digestion were analyzed by electrophoresis on 6% urea-acrylamide gels. Specific conditions for hybridizations anddigestions have been described earlier (18). In Situ Hybridization Histochemistry-Rat pancreata were immediately removed and immersion-fixed in cold 4% paraformaldehyde containing phosphate-buffered saline. Ten-micron cryostat sections were hybridized to either a 291-base peptide YY antisense RNA probe or a rat somatostatin antisense RNA labeled with a-35S-UTP (19). Remaining details of fixation and hybridizations were as we have previously described (19). Hybridization was detected autoradiographically followed an 8-day exposure to the photographic emulsion. RESULTS
Fifteen bacteriophage plaques, of 750,000 screened, were recognizedby the peptide YY antiserum. To confirm the identities of the immunopositivebacteriophage, plaques were rescreened with antiserum preadsorbed with a large excessof synthetic porcine peptide YY. Immunoreactivity of two of the 15 original recombinants was lost using the preadsorbed serum, suggesting that these two bacteriophages synthesized fusion proteins containing peptide YY-likeepitopes. The cDNA inserts, approximately 650 nucleotides in length, were excised fromthe bacteriophage DNA and were subclonedinto the plasmid pGEM-3 for further study. The sequencing strategy used to characterize the cDNAs is illustrated in Fig. lA. The nucleotide sequence and corresponding amino acid sequence are depicted in Fig. 1B. Neither of the two cDNAs contained sequences that included the initiator methionine codon. To determine the sequences at the amino terminus of the precursor we screened
a rat genomic library with a 5"directed synthetic oligonucleotide [5'GCAGCATTGCGACCATAACGGGCCAAGGCC3'1. The nucleotide sequence of the genomic clone revealed an in-frame methionine codon 8 bases upstream from the 5' end of the cDNA. If this AUG codon is the translational start site, the peptide YY precursor would have a signal peptide28 amino acids in length. The cDNA includes an open reading frame of285 basepairs encoding a protein of11,122 daltons. At the amino terminus of the precursor is a regionrich in hydrophobic residues characteristic of a signal sequence. Following the signal peptide is a 36-residue sequenceidentical to theamino acid sequenceof porcine peptide YY (1).Immediately following peptide YY in the precursor is the sequence, Gly-Lys-Arg. The glycine residue presumably servesas an amide donor for the hormone and the dibasic residues probably represent a cleavage site for a trypsin-like endoprotease. The cDNA encodes an additional 31 amino acids at the carboxyl terminus of the precursor before termination codon is reached. A polyadenylation signal, AATAAA, is contained within the 3'untranslated region. The cloned cDNA was used to generate antisense RNA probes for Northern blot analyses of peptide YY mRNA in different tissues. As shown in Fig. 2A, the probe hybridizesto a single predominant RNA species approximately 800 nucleotides long. Peptide YY-specific RNA is most highly enriched in rat pancreas with high levels alsopresent in the colon (Fig. 2A) and ileum (not shown). The relative levels of this message are lower by about an order of magnitude in both the rectum and thegastric antrum (Fig. 2A). Because the pancreas contains substantial amounts of pancreatic polypeptide mRNA which might possibly cross-hybridize with the peptide YY probe, we analyzed RNA from pancreas and ileumby ribonuclease-protection assays. As shown in Fig. 2B, the RNA from both pancreas and ileum protects a probe fragment of the predicted size forauthentic peptide YY mRNA (175 bases). The existence of peptide YY mRNA in pancreas is also supported by Northern blot analyses utilizing an end-labeled synthetic oligonucleotide complementary to the peptide YY 3'4ntranslated region (nucleotides 347-367). We observed hybridization (not shown) to an approximately 800-base mRNA inpancreas despite the complete dissimilarity of the probe to any sequences in rat pancreatic polypeptide (20). Prior immunohistochemical studies (2) have localized peptide YY to the periphery of the pancreatic islets in a distribution similar to pancreatic polypeptide (21). We utilized in situ hybridization to identify the precise site of peptide YY mRNA production in the pancreas. Specific hybridizationwas observed exclusivelyin the exocrine pancreas over both individual cells (Fig. 3A) and larger clusters of 10-20 cells (Fig. 38) but not over islets (Fig. 3C). Messenger RNA for other hormones such as somatostatin was clearly evident in islet tissue, as expected (Fig.30). Peptide YY cells were identified in both the ventral and dorsal pancreas. No hybridization over cells was observed with either a sense strand RNA probe or when an excess of unlabeled antisense RNA was added to the antisense probe. DISCUSSION
In the present study, we describe the structure of a cDNA encoding the precursor of rat peptide YY. The translational start point within the precursor has been tentatively identified from genomic sequences. The assignment of the initiator AUG was made on the basis of its being the first in-frame methionine codon. The resultant signal peptide is of comparable
Rat Peptide YY Precursor
FIG. 3. Localizationof peptide YY cells in pancreaa by in situ hybridization. Ten-micron sections of rat pancreas were hybridized to %-labeled antisense RNA probes for either peptide YY or ratsomatostatin as described under "Materials and Methods." Hybridization is indicated by silver grains over cells (arrows). Individual cells and groups of 2-3 cells ( a ) and clusters of cells ( b ) in the exocrine pancreas hybridize to the probe. Peptide YY mRNA was not detected in islets (c) despite the ability to detectother islet hormones (somatostatin) in the same tissue ( d ) . No hybridization over cells was observed with either a sensestrand RNA probe or when an excess of unlabeled antisense RNA was added to the antisense probe. Sections were counterstained with either hematoxylin and eosin ( a and c ) or methyl green ( b and d ) .
length and composition to other signal sequences in the pancreatic polypeptide family. Near the amino terminus of the precursor (positions 5 and 6) are two basic amino acid residues, followedby a hydrophobic core as is frequently observed in signal sequences (22). The predicted cleavage site for the leader sequence followsthe alanine residue preceding peptide YY.This site fulfills the criteria of providing a small neutral side chain at the -1 position as well as being separated from the hydrophobic core of the signal peptide by a strong helix-disrupting Gly at position -5. The remainder of the precursor contains sequences representing peptide YY,followed by the sequence Gly-Lys-Arg, and 31 additional amino acids at thecarboxyl terminus. The amino acid sequence of rat peptide YY,predicted from the cDNA, is identical to that of porcine peptide YY.This conservation of sequence suggests that peptide YY serves an essential biological function. It is unknown whether the 31residue carboxyl-terminal peptide undergoes further proteolytic cleavages. Pulse-chase studies have demonstrated that the carboxyl-terminal peptide of pancreatic polypeptide is cleaved at a single arginine residue. Similarly located arginine residues are present within the carboxyl-terminal peptide of the peptide YY precursor. As shown in Fig. 4, the peptide YY precursor is similar to the precursors of other members of the "pancreatic polypeptide family." These precursors are characterized by a signal peptide 28 or 29 amino acids long, followed by a hormone-
coding region containing a Gly-Lys-Arg amidation-cleavage sequence. In addition, each precursor has a carboxyl-terminal extension peptide of 27 to 31 residues (23-26). The sequences of the rat peptide YY and pancreatic polypeptide precursors share 15 outof 36 amino acids.However, the carboxyl-terminal flanking peptides are identical in only two out of 30 positions. The different degrees of amino acid sequence conservation between different domains of the precursors of rat peptide YY and pancreatic polypeptide may reflect localization of these coding regionson separate exons on their respective genes. We have previously shown that the coding regions of the human prepropancreatic polypeptide gene are divided into functional domains with intron-exon junctions occurring very close to the translational initiation site and post-translational cleavage sites (17). The tissue-localizationof peptide YY is poorly understood, in partdue to limitations in the specificity and thesensitivity of antisera used for immunohistochemical and radioimmunoassay studies. We have used Northern blotting to identify the sites of peptide YY mRNA synthesis. Peptide YY mRNA appears to be most enriched in the pancreas, indicating that expression of the peptide YY genein this tissue is much higher than had been previously realized by immunochemical techniques (2,3). The relative discrepancies between our own data and peptide measurements previously reported may result from difficulties in extracting peptides from sources rich in proteolytic enzymes suchas pancreas. We also have iden-
12988 SIGNAL PEPTIDE
C TERMINAL
PEPTIDE
A&raowk&mnt-We wish to acknowledge the skillful technical assistance of H. Mobtaker. REFERENCES
Rat PYY Oly-Lyr-kg
HumanPP
1. 'hbrnoto, K. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 25142.5 18 2. Lmdberg, J. M., Tatemoto, K., Terenius, L., Hellstrom, P. M., Mutt, V., Hokfelt, T., and Hamberger, B. (1982) Proc. Not1 A d . &i. U. S.A. 79,4471-4475 3. MiyachipY., Waka, J., Miyoshi, A., Fujita, S., Mizuchi, A., and l'atamo- K.(1986) Endocrinology 118,2163-2168 4. Adrian, T.E,*Ferri, G.-L., Bacarese-Hamilton, A. J., Fuessl, H. S., M a k , J. W., and Bloom, S. R. (1985) Gastroenterology89,
1070-1077 5. Pappa& T. N., Debas, H. T., and Taylor, I. L. {1986) J. Qin. I n v a t . 77.49-53 b Pappas*T,N., Debas, H. T., Goto, Y., and Taytor, I. L. (1985) A a J. *W1248, G118-Gl23 7. T.,and Lim, R. (1930) Proc. s'crc. h p . R i d . Med. 27, 1 h %&mob, K. f1982) Proc N d A d Sci. l% S. A. 79, 542%-
Rat PP
5489 9. Taylor, I. L. (1985) Gasmen@* S% 7331-737 10. Cathala, Q., Swouret, J., Mendez, West, 3.L,Karin, M., Martid, d. A., and Baxter, J. D. ( 1 m ) DNA 2,329-335 11.. &bier, U., and Hoffman, J. (1983) & n e(Ami.) 35,263-269 12. Young, R A., and Davis, R. W. (1983) P m M Acud. Sci U. A. 8 4 1194-1198 13. k h a n , FL M.,Wu, P., Jacksan, 1. M. D., Wo& W., Cooperman, S,Mandel, G., and Gocdmaa, R M. (1986)&&ace231,159-
a,
Human NPY
€3.
Glylyr-Arg
FIG. 4. Structural organizationof ptecursoirrd'peptitb YY and related peptides. Protein coding regions are shown as boxes. Abbrevi&ions are: rPYY, rat peptide n;hPP, human panmatic polypeptide; hNPY, human neumpeptide Y; rPP, mt pancreatic polypeptide.
s.
361 14. Bentan, W. D,,and Davis, R. (1W7) S c k m 196,13C"2 15. Maim, A, and Gilbert, W. (1977) Proc. Nad.A d Sei. U.S. A. rb,rn-564 I&. @hen*E. Y., and Seeburg, P. (1985) DNA 4,165-170 17, Wir, A., Mmtminy, M. R., Jamieson, E., and Goodman, R. H. (19%) J. Bid. &m. 260,13013-13017 18. Blina, K, W a b , D., and Maniatis, T. (1983) Cell 34,865-872
ti'fied the colon and ileum as ma&r sites of peptide YY mRNA synthesis, in agreement with previous peptide C%X&&Wand 1% Haflat, H-,Chiiders, H., Montminy, M. R., Lechan, R. M., immunohistochemicai studiek To diminate the p&bility Chdman, R H., and Wolfe, H. J. (1986) Histochem. J . 18, that the peptide YY antisense probe was C ~ = ~ # M % % ~ W J m a with mRNA -@fig prmfie~tkfmlypepkkh, .giaate&h W. V W M H. ~,Nata, K., and Okamoto, H. (1986) J. Bid. Chem. RNA was I U I ~ by I ~ rnud~%&e ~ m c t i o n S # X & ~ Thm ;&%X, a564159 Loo, S., Hirsch, H. J., Schutzengel, D., and experiments demanstmted khat h e mncreas cent&as authm- $9, Bwgstmm, B,H.., Gabbag, K . H.(1977) J. Clin. Endocrinol. Metub. 44,795-798 tic peptide YY mRNA. Peptide YY tells appear to be 'most 22. Von Heijne, G. (1W)E m J. Bwchem. 133,17-21 prominent in the exocrine pancreas, &$tinct . h mthe hkt 23, t i t e r , A. B., Keutmann, H. T.,and Goodman, R. H. (19W d. PP cells. It is likely that the previoos lornfimtioh d peptide Bid C h m 259,14702-14705 YY cells in the periphery of the pancreatic islets b due r t ~ 2.4.h d , E.,'Schwa&, T. W., Nords, K. E., and Fiil, N. P. (1%) &%?BOJ. 5, 'X@-912 cross-reactivity with rat pancreatic poiypeptidh The abun25, Tabuchi, T , PUVB Y-amada, T . (1985) Proc. Ndtl A d . Sci. U. S. dance .of peptide YY mRNA in one of its tisnes, &e A. 82,1b$%1539 pancreas, may indioate a paracrine mechanism for pepkide 26. Minth, C. D.,Blmm, S.R., Pdak, .J. M., and Dixon, J. E. (1984) PIW.Ned A d . si. U. S. A. 81,4573-458'1 YY in regulating pancreatic en*gmesecretion.
