Plant Molecular Biology 47: 475–490, 2001. © 2001 Kluwer Academic Publishers. Printed in the Netherlands.
475
Position effect of the excision frequency of the Antirrhinum transposon Tam3: implications for the degree of position-dependent methylation in the ends of the element Ken Kitamura, Shin-nosuke Hashida, Tetsuo Mikami and Yuji Kishima∗ Laboratory of Genetic Engineering, Faculty of Agriculture, Hokkaido University, Sapporo 060-8589, Japan (∗ author for correspondence; e-mail
[email protected]) Received 11 August 2000; accepted in revised form 18 May 2001
Key words: Antirrhinum majus, excision frequency, methylation, position effect, transposon Tam3
Abstract We identified eight independent Tam3 copies residing in the same Antirrhinum majus genome. All the copies showed excision at 15 ◦ C, but not at 25 ◦ C. Under conditions promoting excision, each copy appeared to transpose in the leaves and flower lobes with a nearly constant frequency, whereas individual transposition abilities varied widely: the most active copy had an excision frequency more than 100-fold greater than that of the least active one. Despite the different transposition abilities, the structures of the eight Tam3 copies were almost identical. These results made it clear that the transpositional ability of Tam3 is regulated by chromosomal position, but they do not imply position-dependent transposase activity. The position effect of the Tam3 transposition was found to be correlated to the methylation state of the copy’s end regions: DNA methylation in the Tam3 end regions tended to suppress the excision activity, and the degree of methylation was dependent on the chromosomal position. Our results also provide evidence of de novo methylation provoked by transposition of the endogenous element. We propose a mechanism of transpositional regulation of plant transposons that responds to the degree of methylation as determined by chromosomal position.
Introduction Cut-and-paste-type transposons (Class II elements) can transpose from one site to another in the genome. These transposons are ubiquitously distributed in most organisms. Among eukaryotes, plants and certain kinds of animals (including insects and nematodes) seem to provide favorable genomic environments for transposition of Class II elements, because especially large numbers of the active elements have been found in their genomes (McDonald, 1993). This is in contrast to vertebrates, in which the transposons are mostly inactive and have become fossils (Smit and Riggs, 1996). Among the active Class II transposons in eukaryotes, a limited number has been well studied: the P elements in Drosophila and Tc1 in Caenorhabditis elegans, and the Ac, Spm and Mu families of maize, are regarded as representative eukaryotic transposons
(Saedler and Gierl, 1996). Our knowledge of these transposons is mainly based on examination of specific copies linked to genes (Kidwell and Lisch, 1997), while copies unrelated to gene expression have not been extensively investigated. Detailed analyses of phenotypic changes induced by transposons have led to insight into the regulatory mechanisms involved in transposition (Fedoroff et al., 1995; Lozovskaya et al., 1995; Kidwell and Lisch, 1997). Some aspects of the regulatory systems of the transpositions have been elucidated: the germlinespecific transposition of P element due to specific splicing in the germ cells (Laski et al., 1986), transpositional repressors in P and Spm that result from aberrant transposase genes encoded in derivative elements (Rio, 1991; Cuypers et al., 1988), developmentally regulated transposition of Mu elements (Levy and Walbot, 1990), and correlations between repres-
476 sion of transposition and DNA methylation in maize transposons (Chandler and Walbot, 1986; Schwartz and Dennis, 1986; Banks et al., 1988). However, we generally do not known the transpositional behavior of all the copies of a transposon family, most of which are not inserted in expressed genes, within a particular genetic environment. It has been difficult to address the behavior of various copies of the same transposon and their transpositional regulation within a genome, because endogenous transposons mostly consist of heterogeneous copies (Döring and Starlinger, 1986; Kidwell, 1994); the majority of copies are usually non-autonomous copies with distinct structures, and autonomous copies are rarely present due to gap repair mechanisms (Engels et al., 1990; Gloor et al., 1991). Such heterogeneous copy organization of transposons is an obstacle to isolation and identification of active copies among the huge number of copies that are mostly immobilized. Even if we could isolate a number of copies and successfully detect differences of transpositional activity among them, differences in their structures would complicate the identification of factors modulating transpositional events. Tam3 is a member of the hAT family of transposons, which includes Ac in maize and hobo in Drosophila, based on the similarities among the transposase genes (Calvi et al., 1991; Hehl et al., 1991). The structures of the Tam3 copies are exceptionally homogeneous compared to those of other transposons (Kishima et al., 1997, 1999). Homogeneity in the Tam3 family is the result of arrest of gap repair at the end regions, which appear to form stable hairpin structures with quite low free energies (Yamashita et al., 1998, 1999). The structural homogeneity of the Tam3 copies is also supported by the fact that no movable non-autonomous Tam3 copy has ever been found in the Antirrhinum genome (Kishima et al., 1999). Analysis of flower variegation phenotypes has revealed that Tam3 transposition is sensitive to environmental temperature, and that the element excises at higher frequencies at low temperatures (around 15 ◦ C) than at high temperatures (around 25 ◦ C) (Harrison and Fincham, 1964; Carpenter et al., 1987) (Figure 1). Tam3 excision is also modulated by a suppressor gene called stabilizer (Harrison and Fincham, 1968; Carpenter et al., 1987). Such uniform copy organization and unique regulatory systems have allowed us to compare the transposition frequencies of different copies of Tam3 in the same genomic background.
Here we describe a position effect of the Tam3 somatic excision and its possible causes. We assessed 40 Tam3 copies isolated from a single Antirrhinum genome (Kishima et al., 1999), and identified eight copies capable of transposition in somatic tissues. The excision rates of the eight movable copies were quantitatively examined in the leaves and flower lobes of plants grown for defined periods at low temperature. The analyses revealed that the excision frequency varied widely among the eight copies, and the excision ability of each copy was stable in the two different tissues and in individual plants. All of the copies possessed an identical structure. Our data show that a major cause of the position effect on the Tam3 excision is variation of the degree of DNA methylation in the end regions.
Materials and methods Plant materials and DNA isolation The HAM5 line of Antirrhinum majus was derived from the nivrec ::Tam3/stabilizer− line, which was kindly provided by Dr C. Martin (John Innes Centre, Norwich, UK). The genomic library containing Tam3 clones which we used here was constructed from the genomic DNA of a HAM5 plant (Kishima et al., 1997). In order to investigate Tam3 excisions, the HAM5 plants were grown at 25 ◦ C for 2 months and then shifted to 15 ◦ C and grown continuously at this temperature. DNA samples of the leaves and flower lobes were periodically picked from the lowtemperature-grown plants every 4 weeks. The number of the spots on flower lobes, which reflects the excision frequency, gradually increased with time in the plants grown at 15 ◦ C (Carpenter et al., 1987). The 28-week samples were used for quantitative analysis of the excision activities of the eight movable Tam3 copies. To avoid inclusion of cells which were derived from a common precursor cell in which an early excision event had occurred, 15 plants were separated into three plots and DNA samples were collected from five plants in each plot. We used leaves 3–4 cm long, and lobes which came from flower buds about 2 cm long. We also used pooled leaf samples from plants grown for 10 months at the low temperature for the PCR analysis and the Southern blots. The HAM1 line (JI:7), which was kindly supplied by Dr R. Carpenter (John Innes Centre, Norwich, UK), was used as one of the controls. HAM8 (F1 Butterfly Blonde;
477
Figure 1. Changes of flower phenotype in HAM5 during the growth at 15 ◦ C. Left: the flower of a plant that was grown at 25 ◦ C shows white petals. Middle: the flower of a plant grown at 15 ◦ C for 28 weeks after rearing of the seedling for 2 months at 25 ◦ C shows variegated spots on the lobe. Right: the flower of a plant that was grown at 15 ◦ C for a total of 10 months shows more frequent variegations with stripes across the petals. Most of the Tam3 excision events at nivrec ::Tam3 result in the reversion (dominance) of the flower pigmentation, because the element is present upstream of the transcription start site. The rate of Tam3 excision occurring in this allele under the 15 ◦ C/10 months condition was estimated to be 21% of the total copy number of nivrec ::Tam3 (Figure 5), indicating that Tam3 was excised in roughly 40% of the cells in the flower lobe, if the excision occurred at equal frequency in all cells.
Takii) and HAM9 (Kousei white; Takii), which were originally commercial lines and have different genetic backgrounds, were used in the hybridization analysis shown in Figure 7. These three lines lack Tam3 sequences at the eight Tam3-inserted sites found in HAM5. The leaf and lobe DNAs were isolated according to the method of Martin et al. (1985).
reference genomic DNA from the HAM1 line, which lacks the Tam3 sequence at the sites where HAM5 contains it, we cloned the sequences flanked by the clones. Finally, the Tam3 sequences in the 12 clones from niv, S-6, S-11, S-18, S-19, S-22, S-29, S-34, S35, S-78, S-84 and S-99 were then considered to be candidates for movable copies.
Selection of candidates for movable Tam3 copies
PCR analysis of de novo excision products
In our previous study, 40 independent Tam3 clones were isolated from an Antirrhinum plant (the HAM5 line) carrying the nivrec ::Tam3 allele, which causes flower variegation (Kishima et al., 1999) (Figure 1). In this study, we performed selection for movable Tam3 copies located in single-copy regions, as summarized in Table 1. Ten clones (niv, S-11, S-19, S-22, S-29, S-34, S-35, S-78, S-84 and S-99) had complete Tam3 sequences, while two clones (S-6 and S-18) had partial Tam3 sequences due to interruption at the cloning sites. Of the 10 clones carrying complete Tam3 sequences, two clones, S-29 and S-78, were recovered by re-evaluation procedures (Table 1). For the two partial clones, the inverse-PCR (IPCR) method was applied to obtain the Tam3-flanking sequences on the side of these clones not isolated in the primary clone based on Ochman’s method (Ochman, 1988). Using
PCR was performed twice in this study: first to detect de novo excision products of the 12 candidates for movable copies, and second for quantitative analyses of the movable copies. For detection of the de novo excision products (Figure 2), PCR was done with KOD DASH (Toyobo), and 200–400 ng of genomic DNA was prepared from leaves of HAM5 plants grown at 15 ◦ C for 10 months. The primers listed in Table 2 were used for these analyses. The DNA templates and primers were denatured at 94 ◦ C for 30 s, annealed at a few degrees above the melting temperature calculated for each primer and extended at 72 ◦ C for 30 s for a total of 40 cycles. For quantitative assays of the excision products of the eight Tam3 copies (Figure 3), the PCR amplifications were performed using the same procedures described above, except for the number of cycles. The
478 Table 1. Characteristics of the isolated Tam3 copies. Tam3 at locus
State of the Tam3 sequence
Mobility
5 -end sequencea
3 -end sequenceb
Identityc (%)
niv S-6d S-11 S-18d S-19 S-22 S-29e S-34 S-35 S-78f S-84 S-99
complete completed by IPCR complete completed by IPCR complete complete complete complete complete complete complete complete
detected detected detected detected failed detected detected failed failed detected failed detected
TAAAGATGTGAA TAAAGATGTGAA TAAAGATGTGAA TAAAGATGTGAA TAAAGATGTGAA TAAAGATGTGAA TAAAGATGTGAA TAAAGATGCCAA unidentified TAAAGATGTGAA TAAAGATGCGAA TAAAGATGTGAA
TTCACATCTTTA TTCACATCTTTA TTCACATCTTTA TTCACATCTTTA TTGCCATCTTTA TTCACATCTTTA TTCACATCTTTA TTGGCATCTTTA TTCACATCGTGA TTCACATCTTTA TTCGCATCTTTA TTCACATCTTTA
– 100 100 99.99 95 100 100 88 96 100 86 100
a 12 nucleotides corresponding to the 5 TIR sequence in the active copy. b 12 nucleotides corresponding to the 3 TIR sequence in the active copy. Underlined nucleotide is different from
the TIR sequence. c Sequence identity was calculated between each Tam3 sequence and Tam3:niv. d S-6 and S-18 were inititally isolated as partial clones, and then the complete sequences with the sequences of the flanking regions were obtained by IPCR. e In previous experiments, we could not detect differences between HAM5 and other lines in Southern blots probed with the Tam3:S-29 flanking sequence. f S-78 was initially discarded during the proccesses for the selection of plaques.
above PCR conditions, templates and primers were adjusted as necessary to achieve uniform amplification conditions using the pal locus primers for amplifying a Tam3-unlinked region (Figure 3, top panel) or wildtype DNA (HAM1) template which lacked Tam3 at all the target sites (Figure 3, lane 1). The PCR conditions and primer combinations are detailed in Table 2.
All the Tam3 sequences were cloned into pBluescript SK (Stratagene). Double-stranded DNA samples inserted into the vector were sequenced using a d-Rhodamine Terminator Cycle Sequencing Ready Reaction-Sequencing Kit (Applied Biosystems) and an ABI377 Automated DNA Sequencer (Applied Biosystems).
plified using a PCR DIG Probe Synthesis Kit (Roche) and corresponded to a ca. 300 bp flanking region of Tam3, as listed in Table 2. Southern hybridization was carried out at 60 ◦ C according to the protocol of the DIG labeling and detection system (Roche). To estimate excision rates, we measured the intensity of the bands corresponding to Tam3-excised and -unexcised states in lane 3 in each panel of Figure 4 using a scanning densitometer (Scanning Imager; Molecular Dynamics). The measured values were used to calculate excision rates with the following formula, which expresses the relative number of excised copies per total copy number at each inserted site: excision rate (%) = (B/A + B) × 100, where A is the scanned intensity of the band containing Tam3 and B is the scanned intensity of the band lacking Tam3. Figure 5 summarizes the excision rate of each copy.
Southern blotting to detect somatic excisions
Southern blotting to detect methylation
To detect somatic excision of the eight copies, 15 µg of three genomic DNAs (HAM1 or HAM5 grown at 25 ◦ C and HAM5 grown for 10 months at 15 ◦ C) were digested with EcoRI, electrophoresed on 1% agarose gels, blotted onto nylon membranes (Roche; nylon membranes, positively charged). Each probe was am-
Methylation on both sides of the four Tam3 sequences from the S-6, S-22, S-78 and S-99 loci was assayed by Southern blotting. Genomic DNA (15 µg) from HAM5 (grown for 10 months at 15 ◦ C) was digested with C-methylation-sensitive enzymes (HpaII or EcoRII) and/or –insensitive enzymes (MboI or
Sequencing of the movable Tam3 copies
479
Figure 2. Evaluation of the Tam3 transposition activity of the 12 candidates. To detect de novo excision products, primers were designed in both flanking regions of each copy (Table 2). All of the primer combinations could amplify bands about 300 bp in length when HAM1 genomic DNA, which lacks a Tam3 copy at each site, was used as a template (top panel). When the template DNA isolated from the HAM5 plants which were grown at 25 ◦ C for 2 months was used for the PCR reactions, no bands with a length of around 300 bp were amplified, indicating that all the Tam3 copies were stable in this genomic condition (middle panel). The plants were then placed in a 15 ◦ C chamber, and 10 months later DNA was prepared and used for PCR reactions. Under these conditions, de novo excision products were obtained from eight Tam3 copies from the niv, S-6, S-11, S-18, S-22, S-29, S-78 and S-99 loci. The leftmost lane shows a control Tam3-unlinked band amplified from the pal locus. The PCR reaction conditions employed are listed in Table 2. The primer dimers were also amplified during the reaction, as indicated by arrows.
MspI, partially insensitive; HinfI or BstNI, partially insensitive). The same amount of λ DNA was monitored to confirm complete digestion with these enzymes (data not shown). The PCR-amplified-flanking sequences shown in Figures 6 and 7 were prepared and used as DIG-labeled probes. We also examined the methylation of the regions proximal to Tam3:S-6 with BstNI, MboI and Sau3AI (methylation-sensitive), and used the PCR-amplified flanking sequences of Tam3:S-6 as probes. Southern hybridizations was carried out using procedures similar to those described above. Accession numbers of the nucleotide sequences Nucleotide sequences of Tam3 copies will appear in DDBJ, GenBank and EMBL Nucleotide Sequence Databases under the accession numbers: AB038403 (S-19), AB038404 (S-34), AB040047 (S-35), AB038405 (S-84) and AB038406 (S-CHS, Tam3:niv).
Results Selection of the movable copies Twelve candidate movable Tam3 copies were selected from 40 independent clones which were prepared from
a particular plant of the HAM5 line. The candidate Tam3 copies were located in single-copy regions and were unique to the HAM5 line. The excision abilities of the 12 candidates were examined by PCR, which is the most sensitive method among the currently available techniques for detecting transposition at the molecular level (Table 1). Partial nucleotide sequences of both flanking sequences of the 12 copies were determined in order to design PCR primers. When HAM1 DNA, which lacks Tam3 copies at the equivalent positions in the genome, was used as a template, all primer combinations tested could amplify ca. 300 bp genomic fragments (Figure 2, top panel). We then examined the ability of the 12 copies to be excised in the HAM5 line; when we used template DNA isolated from leaves of the HAM5 plants grown for 2 months at 25 ◦ C, none of the PCR reactions could detect de novo excision products (Figure 2, middle panel). Since Tam3 has been thought to transpose more frequently at lower temperatures (Carpenter et al., 1987), the same plants were transferred to a 15 ◦ C growth chamber and grown for 10 months, which conditions were considered likely to be sufficient for detection of somatic excision. Plants of the HAM5 line carry Tam3 inserted at the nivea (niv) locus, which encodes chalcone synthase. This nivearecurrens::Tam3 (nivrec ::Tam) allele gives rise to an unstable flower pigmentation phenotype due to somatic excision of Tam3 (Sommer et al., 1985). When
480 insertion sites by PCR (Figure 2, bottom panel). Thus, the Tam3 copies included in the niv, S-6, S-11, S-18, S-22, S-29, S-78 and S-99 clones were judged to be excisable, and therefore mobile (Table 1). No excision products were detected for the other four copies, which were consequently judged to be stable or having a very weak ability to transpose. Furthermore, no excision of these four copies was detected in DNAs from shoots, flower lobes or floral meristems in the HAM5 plants (data not shown). Given the sensitivity of the PCR method, it is very unlikely that these Tam3 copies excised somatically. PCR analysis of the excisions
Figure 3. PCR comparisons of de novo excision activities among the different samples at each of the eight copies. Fifteen HAM5 plants which were grown at 15 ◦ C for 28 weeks after 2 months of growth at 25 ◦ C were subjected to the analysis. These plants were divided into three plots to avoid experimental bias. The numbers, 1–3, labeling the panels indicate the plot of the plants. DNA was prepared from collected lobes or leaves in each plot, and PCR conditions for analyzing the Tam3 insertion sites are summarized in Table 2. The PCR products were electrophoresed in 1.5% agarose gels to evaluate the relative amounts of excision activities. The top panel (pal) shows that there was almost equal PCR amplification of the Tam3-unlinked pal locus in all six samples. The leftmost lane of each panel is a control amplification using the HAM 1 genomic DNA (wt) lacking Tam3 at the target sites. The pal amplifications were performed by means of 30 PCR cycles, while the number of PCR cycles used for other amplifications were based on the ability of the primer combination to amplify the control sample (wt) (Table 2).
the HAM5 plants are exposed to low temperature, they showed striking color changes in the flowers due to an increased frequency of somatic excision of Tam3 at the niv locus (Sommer et al., 1985) (Figure 1). Using DNA extracted from these plants grown at low temperature, excision products were detected at eight Tam3
The PCR method might not be adequate for precise quantitative comparisons among the copies, because PCR amplification is dependent on the sequence of the target genome sites, and PCR band intensities might reflect the end-joining efficiencies after the excisions instead of the excision activities of the copies. However, we think that the comparison of the PCR band intensities in the different template DNAs at the same site with the same primers should reflect transposition frequencies, and to test this we performed the following analysis. DNA samples from plants grown for 28 weeks at 15 ◦ C after the rearing of seedlings at 25 ◦ C for the first 2 months were collected from the leaves and flower lobes of three independent plots, and PCR templates were prepared from the tissues of five different plants per plot. As a standard for PCR band intensities, a fragment of the pallida gene (pal) encoding the dihydroflavonol 4-reductase gene (Coen et al., 1986) was amplified to ensure that equivalent amounts of all the template DNAs were used (Figure 3, top panel). Furthermore, the primer concentrations for each Tam3 insertion site were adjusted with HAM1 genomic DNA as a control PCR template so that all the amplified bands at the target sites were amplified to equal intensities (Figure 3, the first lane of each panel). A given insertion site of Tam3 showed a similar amplification degree of the bands of DNA from different plant parts and from different individuals (Figure 3). Considering that a Tam3 insertion prevented PCR amplification, as shown in Figure 2, this indicated that a copy at the same site transposed at a nearly constant frequency in the leaves and flower lobes. Thus, the Tam3 excision rate at a given site was expected to be more or less stable for excision either in the leaves and lobes.
481 Table 2. Summary of the PCR conditions used in this study.a Target site
Primer combination
Annealing temp. (◦ C)
Cyclesb
Amplified band size (bp)
pallidac nivea S-6 S-11 S-18 S-19 S-22 S-29 S-34 S-35
TGCGATTGACACTTGCCGC + CGCATTTTCTTGTCCCTTGGC CCTATTGGGCAAAATTAGGTACC + AACCTCCTCAACAGTCACCATTT GATTAGGCTTTTCTGGGTTGTTGG + CGTGAACAGCATTCTGGTTCACAAACGTGG CGACACGTGAGTACCAGTGAG + ACTTTCACACCAAACGCTATGTGTCAATTG AACTGCGATGGCAGTGCATGCTTGGGTAAG + GAATGTGGCGGCTCTTTGTATGG TCATTAGGGGGGGTTTTCC + TTCTCTCGGTTCTCCCTTC GAATTAATGCATGGTTACTCATGAG + CTAGCTGCAGGTGCTTTAATAGAC GTCAAAGGAACCATCACATCTTATTTC + GGACCACTCTAATACGAGTGCC TGAGTGAGCTAGTTTGACTCTCATG + CCTCGTAGCTCTCTATCTTTTCTCG CGACGCATTATGTAACCAATTTTGTCACATGCCC + TTGTTTCCGATTGCCCTGCCCTGGTCT AAAACTCCAACAAATTTCTGCAAATAAC + GATCATGAACCAATTTCAAAACTCTCC GGCTTTCCTGGGTGTGGTAAAATGGGTAGATG + GGGATAGTTTAAGAAATCGTCAACCACCC GCACACTATGGACTTTTGGA + CGCATATACTAACAAACGC CGAGTACATGGCCCCTTCTC + GATCCAACTATAACCGCTGCT CAAACAGGTTCAGCTCTCC + GTATCTACACCAATAACTGCG AAAATATGTCATCTTGGTCACTGGTTGC + GTGTACTTACTGCATAGCGTTCCTT CTCCAACATTGACACACGCCTCC + AACAGCACATACACACAGTACACTTAC CCGCACCAGCACCGCCTTTG + TGTACCCTGTACACTGAATGCCAGAC ACACGTGTCACCGACAAATTATTCG + TCAACTTCCTATTCTCTAGTCTCTAGG TTATATGCACCAGATCTATGATAG + CGTAGAACCCAATTCCAATAGTA GTCAAAGGAACCATCACATCTTATTTC + GTGCTGGTCTTTGCGGTAATTTTG CTTGTTCGTGGATTGGTTGGTGGTCGCCTG + GTTGTAGCATAGTGTAGTTAG GCAATAGATACAACAATAGCAGG + GATCATGAACCAATTTCAAAACTCTCC AACTTCCTCCTACGATATTGCTC + CCCTTTAATTGAGTGGTCATCTCTC ACAGTGGACTATGTCTCCTAGTATAC + AATTCGCGGCCGCT
55 55 55 55 63 59 55 52 59 59
30 30 40 35 33
319 320 302 299 324 303 327 330 268 263
52
30
S-78 S-84 S-99 3 fla. nivd 5 fla. S-6e 3 fla. S-6d,e 3 fla. S-11d 3 fla. S-18d 5 fla. S-22d,e 5 fla. S-22e 5 fla. S-29d 5 fla. S-78d,e 5 fla. S-78e 5 fla. S-99d,e 5 fla. S-99e
35 38
59 55 55 52 50 55 55 55 50 55 50 51 55 46
466 235
30
261 637 354 857 428 410 365 225 257 463 351 291 204
a The same conditions were employed throughout the analyses except for the primers, the annealing temperatures and the PCR cycles (denaturation at 94 ◦ C for 30 s, annealing for 30 s, polymerase reaction at 72 ◦ C for 30 s). b The numbers indicate the cycles used for the PCR analysis presented in Figure 3. All the PCR amplifications in Figure 2 were
performed with 40 cycles. To prepare PCR probes, 35 cycles were used in every sample. c The target site for pallida does not contain a Tam3 sequence. d The Tam3-flanking PCR products were employed as flanking probes for the detection of de novo excision products in Figure 4. e The Tam3-flanking PCR products were employed as flanking probes for the methylation analyses in Figures 6 and 7.
Southern blot analysis of the excisions Despite the similar amplification patterns for a given copy, the PCR profiles displayed varying intensities among the eight copies (Figure 3). For the accurate evaluation of the excision frequency, we detected the presence of the excision products by Southern hybridization, which can directly show the products of excision events and the frequency of such events. As shown in the above PCR analysis, each Tam3 copy had stable excision activity in the leaves and lobes of different plots (Figure 3). Therefore, it was considered that the excision frequency of each copy would be constant even with further growth at 15 ◦ C. DNA was extracted from the leaves of the plants grown for 10 months at 15 ◦ C. In addition, to weaken the effect of clonal excision events that occurred
in each plant, the DNAs from the 15 plants were pooled. Figure 4 shows the hybridization patterns of the EcoRI-digested DNAs. As expected, all the flanking probes failed to detect de novo excision products in the genomic DNA from HAM5 plants grown at 25 ◦ C. However, the genomic DNA from plants grown at 15 ◦ C generated additional bands which coincided with bands lacking the Tam3 sequence in the control line. Such fragments should represent de novo excision products. Notably, the S-78 locus gave rise to a remarkably strong excision product that was stronger than expected based on the PCR results (Figure 4, S78). Also, in agreement with our PCR analysis, the S-6 locus was exceptional in that it generated only a very faint excision fragment in the Southern blot in the 15 ◦ C sample (Figure 4, S-6).
482
Figure 4. Southern blotting analysis to detect de novo excision products of the eight copies. The DNA samples were all digested with EcoRI. Lanes: 1, leaf genomic DNA of HAM1; 2, leaf genomic DNA of HAM5 plants at 25 ◦ C; 3, leaf genomic DNA of HAM5 plants after 10 months at 15 ◦ C. The eight probes were prepared by means of PCR (Table 2), and probes from one side of the flanking sequences (the probe that gave better hybridization results) were used for detection of the excised products. All the excision products detected in the third lanes had sizes that corresponded to the size obtained by subtracting the 3.6 kb of Tam3 from the sizes of the larger bands containing Tam3. It was difficult to detect any excision fragment in the blot of S-6 DNA.
S-78::Tam3 allele. On the other hand, Tam3:S-6 had an excision rate less than 1/100 of that of Tam3:S-78. In the remaining six copies, the excision rates ranged from 21% to 11%. These values were consistent with germinal reversion frequencies at marked loci due to Tam3 excisions (Martin et al., 1989). Structural comparison of the Tam3 copies
Figure 5. Summary of the excision rates of the eight copies. Each histogram shows the excision rate expressed as the ratio of the band intensity of the excision product to the intensities of the bands containing Tam3 plus the excision product. The band intensity was measured by scanning the X-ray film of the blot with a densitometer. The details are described in Materials and methods. The percentage reflects the ratio of the Tam3-excised copies to the total copy number.
Using a densitometer, we estimated the intensities of the bands corresponding to Tam3 and the excision products, and expressed the intensity of the excision product band as a proportion of the total hybridization for each locus. The excision rates of the eight copies are summarized in Figure 5. The ratios reflect the differences in the intensities of the fragments observed in the PCR analysis (Figure 3). The ratio at S-78 showed that the element had been excised in about half of the total DNA population, implying that most of the cells lacked Tam3 in one of the homozygous
The eight movable copies resided in the same genome, but nonetheless their excision activities varied. The ability of each copy to be excised was consistent between the leaf and flower lobe tissues of individual plants. This implies that the different abilities of individual Tam3 copies to be excised might reflect divergence of the Tam3 structure. To assess this, we determined the full-length sequences of the eight Tam3 copies. All the copies possess an identical sequence for the putative transposase gene. We failed to find any copies with deletions in the ORF, and indeed no non-autonomous Tam3 has ever been found as yet. The copies at the seven loci (niv, S-6, S-11, S-22, S-29, S-78 and S-99) shared an identical structure. Relative to this sequence, we found only one sequence alteration, a deletion of T at 209 bp from the 5 end of Tam3:S-18. It is unlikely that this deletion in Tam3:S18 resulted in a large change of the excision ability. The sequence uniformity of the different Tam3 copies implies that the differences in excision abilities among the eight copies must have arisen from cause(s) other than the structure. We also determined the structures of the stable copies of Tam3 (as judged by PCR analysis in Fig-
483 ure 2). The sequences of these stable copies showed more than 85% of identity with the intact Tam3, Tam3:niv (Table 1). An apparent difference between them was found in the terminal inverted repeat (TIR) sequences; we found that all 4 stable copies had altered sequences compared to the TIR sequence (TAAAGATGTGAA) of the movable copies (Table 1). In S-35, the 3 end had an end sequence different from the TIR, and we failed to identify the 5 end due to extensive alteration of the end region. Tam3 seems to be similar to other transposons whose TIRs are indispensable for the transposition, and thus these four copies would be immobilized in the genome. Methylation of the Tam3 end regions Methylation of the end regions in maize Ac/Ds has been reported to inhibit binding of the transposase (Kunze et al., 1988; Kunze and Starlinger, 1989), although repression of transposition by methylation of the transposon ends has not been clearly confirmed in vivo. Our experimental system is suitable for examining whether or not methylation at the ends is a critical factor for transposition, because the eight Tam3 copies reside in the same genetic environment and the transposase can work in trans so that it is not necessary to consider the effect of methylation-linked transposase expression. It has been shown by using artificial Tam3 deletions that excision requires only 1000 bp from each of the end regions (Haring et al., 1989). Here we investigated methylation states, focusing on the end regions of the Tam3 copies inserted in the S-6, S-22, S-78 and S-99 loci, because these insertions showed very different excision frequencies (see Figures 4 and 5). PCR fragments amplified from both flanking regions of the copies were used as probes (see maps in Figure 6). All the probes gave rise to a single band or a few bands, among which we could distinguish a band containing Tam3 (Figure 6, lane 1 in each panel). Hence we performed hybridization analysis in order to examine the methylation states in the end regions of Tam3 by comparison of digestions with methylation-sensitive and -insensitive enzymes. Leaf DNA from the plants grown at 15 ◦ C for 10 months was first digested with one of the methylation-insensitive enzymes, MboI or HinfI, and then a secondary digestion was performed with two isoschizomer enzymes. One pair of isoschizomer enzymes, HpaII and MspI, recognize the same restriction site but show different sensitivities to methylation: HpaII fails to cut when either of the Cs in CCGG
is 5m C, while MspI is sensitive to 5m CCGG, but insensitive to C5m CGG. The Tam3 sequence contains 16 HpaII/MspI sites: some of the sites are clustered in the end regions, with the outermost sites located 33 bp and 31 bp from the 5 and 3 ends, respectively (see maps in Figure 6). To examine the 3 end of Tam3:S22, we used the other pair of isoschizomers, EcoRII and BstNI, which recognize CCWGG, because this region carries a number of HpaII/MspI sites due to high GC content. EcoRII is sensitive to 5m C at either position of CC, but BstNI is only partially sensitive in the case of 5m C5m CWGG. The outermost sites of EcoRII/BstNI are present at 116 bp and 50 bp from the 5 and 3 ends of Tam3, respectively. The hybridization patterns in Figure 6 reveal the methylation states of the end regions in the four copies, and the results are summarized in Table 3. When the 5 -flanking probe of Tam3:S-6 was used, an extensive and heavily methylated state was detected: the MboI + HpaII and MboI + MspI digests generated a 2.0 kb band analogous to that produced by the digestion with MboI alone (Figure 6A). This implies that the HpaII/MspI sites in the 5 -end region of Tam3:S6 were considerably protected by C-methylation. The 3 -end region was also protected by C-methylation, but not as heavily as the 5 end, since the HpaII/MspI sites were cut, resulting in bands of around 0.83 kb. The 3 end of Tam3:S-99 was slightly methylated, as shown by the presence of a 0.95 kb fragment (Figure 6D). Similarly, a slightly methylated state was detected in the 3 end of Tam3:S-22, as shown by the appearance of a faint band at 1.3 kb in the HinfI + EcoRII digest (Figure 6B). In addition to the internal region of Tam3:S-22, the 3 -flanking region was considerably methylated, because both the 250 and 340 bp fragments were incompletely digested with EcoRII. The 5 -end regions of Tam3:S-22 and :S-99 did not appear to contain such methylations, since the hybridized bands corresponded to the minimum distances between the flanking MboI sites and the outermost HpaII/MspI clusters of Tam3 (Figure 6B, D). We could not detect methylation at either of the ends of Tam3:S-78 (Figure 6C). Methylation at a level too low to be detected by Southern blotting might have been present within the outermost HpaII/MspI clusters of Tam3:S-78. Suppression of the Tam3 transposition was clearly correlated with methylation in the end regions, since inactive Tam3:S-6 was heavily methylated, and Tam3:S-22 and :S-99, whose 3 ends were slightly methylated, showed relatively weak excision activi-
484
485
Figure 6. Continued. Table 3. Summary of the methylation status in both the Tam3-end regions shown in Figure 6. Tam 3 locus
5 -end HapII clustera
3 -end HapII or EcoRII clustersb
S-6 S-22 S-78 S-99
heavy undetectable undetectable undetectable
modest light undetectable light
a This cluster corresponds to three HpaII sites at the 5 end. b This cluster corresponds to four HpaII sites at the 3 end, but in S-22 two
of the EcoRII sites were examined instead of HpaII sites.
486 ties. Tam3:S-78, of which the end regions were even less methylated, showed a particularly high excision rate (about 50%). The above results led us to predict that methylation in the end regions of Tam3:S-6 is well maintained whereas, in contrast, Tam3:S-78 is kept in a hypomethylated state. The other two copies carrying partially methylated ends may give rise to ectopic methylation state. Methylation in the flanking regions of Tam3:S-6 We next examined whether the methylation state of Tam3:S-6 is associated with that of the flanking sequences. Firstly, we surveyed the insertion regions in several Antirrhinum lines which lack Tam3 at this site (Figure 7A). Southern blotting with the 3 -flanking probe revealed that the Sau3AI (methylation-sensitive) and MboI (methylation-insensitive) digests generated the same patterns with a 1.1 kb fragment in all the three lines, indicating that the Sau3AI/MboI sites at both the extremes could be digested with Sau3AI. Thus, the flanking regions of Tam3:S-6 should be in unmethylated states in several Antirrhinum lines. Even when Tam3 was inserted, the Tam3:S-6-flanking regions in HAM5 were hypomethylated: the 5 - and 3 -flanking probes gave rise to identical band patterns in the BstNI (methylation-insensitive) + MboI digest (left lane) and the BstNI + Sau3AI digest (right lane) in the respective blots (Figure 7B). Actually, the region surrounding Tam3:S-6 contains a high AT-content (62%). These results indicate that de novo methylation occurred in Tam3:S-6, and this state has been maintained while the surrounding sequences have remained hypomethylated.
Discussion Position effect of Tam3 transposition We identified eight movable Tam3 copies present in the HAM5 genome, and examined their abilities to be excised from the insertion sites. The somatic excision abilities varied widely among the eight copies; the frequency of Tam3 excision from S-78 was estimated to be more than 100-fold greater than that from S-6, as shown by Southern blotting (Figures 4 and 5). Each of these Tam3 copies, however, showed a stable excision activity in the leaf and lobe, and the detected activities were similar among individual plants grown at 15 ◦ C (Figure 3). The varying excision activities among the eight Tam3 copies were not due to
Figure 7. Methylation state of the flanking regions of Tam3:S-6. Southern hybridization was conducted to determine the methylation state in the flanking regions of Tam3:S-6, whose end regions were methylated. A. Genomic DNAs from three Antirrhinum lines, HAM1 (lanes 1, 2), HAM8 (lanes 3, 4) and HAM9 (lanes 5, 6), were digested with MboI (lanes 1, 3, 5) or Sau3AI (lanes 2, 4, 6) and hybridized with the 3 -flanking probe (Table 2). All bands detected corresponded to a 1.1 kb Sau3AI/MboI segment which does not contain Tam3. B. The blotted DNA samples were as follows; left: DNA from the 15 ◦ C-grown HAM5 plants digested with BstNI + MboI; right: DNA from the 15 ◦ C-grown HAM5 plants digested with BstNI + Sau3AI. Sau3AI is a methylation-sensitive enzyme and an isoschizomer of MboI. The map shows the restriction sites of these enzymes around Tam3:S-6. Two BstNI sites are present at each of the Tam3 ends. The map shows the extremes of these four sites, because BstNI is methylation-resistant. The Tam3:S-6 flanking probes were the same as those employed in Figure 6A, and are shown in Table 2. The restriction sites of the enzymes are symbolized by (BstNI) and (Sau3AI/MboI).
changes in expression of the Tam3 transposase gene or its post-transcriptional regulation, because all the movable copies reside in the same genome. Structural alterations were rarely detected among these copies. If some other factor was involved in the variation of the excision activity, it might have been a tissue-
487 specific excision activity. As shown in Figure 1, in the 28 weeks/15 ◦ C conditions, the lobe has many small spots, indicating independent Tam3:niv excision events, while such spots did not yet occur in the tube, indicating an inactive Tam3 there. This suppression appears to be specific to the tube, because an extension of the period at 15 ◦ C led to stripes across the tube, which might have occurred in the early stage of the flower cell lineages, as seen in the 10 months/15 ◦ C flowers (Figure 1). Taken together, the above results suggest that although there might be a few exceptional events, the excision activities of individual Tam3 copies were basically stable under the conditions examined and dependent on chromosomal position. After documenting the position effect of the Tam3 transposition, we next explored factors involved in the phenomenon. Previously, Martin et al. (1989) reported that methylation was associated with inactivation of Tam3 copies. The present study provides evidence that the Tam3 transposition is controlled in a positiondependent manner to which methylation substantially contributes. Several groups have reported position effects on transposon behavior. However, none of these studies were equivalent to the one reported here. Examples have also been documented for Drosophila transposons P and Mos1 (O’Kane and Gehring, 1987; Garza et al., 1991) where transposase gene expression in autonomous elements was affected by chromosomal position. The position effect described by Alleman and Kermicle (1993) was a distinctive phenomenon in which a single Ds element showed uniform rates of excision from variable sites within the maize R gene, although the phenotypes that resulted from the excisions varied depending on the position within the gene. Some other examples were more or less analogous to those described here. Different genomic locations have been reported to have a small effect on P transposition in Drosophila, although structure is a more important determinant of transposition frequency (Berg and Spradling, 1991); this might be due to Drosophila having a little methylase activity. Bancroft and Dean (1993) and Smith et al. (1996) observed alteration of the transposition activities of the Ds elements in different lines of transgenic Arabidopsis; because the Ds elements were present in different lines, the position effect observed might have involved changes in transposase activity. Lisch et al. (1995) suggested a position effect on the excision frequency of a minimal Mu element line in maize. Their study showed that changes in the chromosomal position of
an autonomous element, MuDR-1, caused changes in its duplication frequency and in the somatic excision of a reporter Mu element. Characteristics of Tam3 which facilitate analysis of the properties of plant transposons We have taken advantage of two characteristics of Tam3, extremely uniform structure of the movable copies (Kishima et al., 1999) and low-temperaturedependent transposition (Harrison and Fincham, 1964; Carpenter et al., 1987). These features facilitated comparison of the activities of the different copies. Our system also eliminates artefacts due to any negative factors that arise during transposase production, because the copies analyzed in this system share a common supply of transposase; at least eight autonomous copies were identified in the same cells. If different copies do not respond identically to the transposase, the differences should be due to the genomic environment around each copy. For many transposons the onset of the transposition can not be readily controlled. Control of the timing of transposition is necessary for precise quantitative analysis of the somatic excision frequency, because large clonal single excision events bias assays of excision frequency if they occur at an early stage of plant development. In this respect, the low-temperaturedependent transposition of Tam3 greatly enhances the ability to measure excision frequency precisely. Methylation at the ends of Tam3 causes repression of the transposition Two mechanisms have been proposed for the transpositional regulation by methylation: one is that Cmethylation linked to the transposase gene results in a decline in the transpositional activity (Schwartz and Dennis, 1986; Chandler and Walbot, 1986; Bennetzen, 1987; Chomet et al., 1987; Kunze et al., 1987; Banks et al., 1988; Kunze et al., 1988; Martin et al., 1989; Brown and Sundaresan, 1992; Martienssen and Baron, 1994; Brutnell and Dellaporta, 1994; Schlä ppi et al., 1994; Peterson and Yoder, 1995); the second possible mechanism is that methylation at the transposase binding sites in the end regions inhibits transposition (Kunze and Starlinger, 1989; Dennis and Brettell, 1990; Wang et al., 1996; Wang and Kunze, 1998). The former mechanism, in which methylation causes repression of the transposase gene expression, is widely observed in plant transposons (Fedoroff and Chandler, 1994), whereas the effect of methylation at
488 transposase-binding sites on transpositional activities has received relatively little attention. In vitro binding assays have shown that the Ac transposase specifically binds to AAACGG, of which multiple motifs are present in both the ends of Ac (Kunze and Starlinger, 1989). C-methylation of this sequence almost completely prevents binding of the transposase in vitro (Kunze and Starlinger, 1989). On the other hand, recent analyses of in vivo Cmethylation patterns of active Ac9 and Ds-cy elements showed that these elements possess heavily methylated sites in one or both ends (Wang et al., 1996; Wang and Kunze, 1998). Based on those results, the authors proposed a model for chromatid selectivity of Ac/Ds, i.e. a hemimethylated daughter element which is newly synthesized from a fully methylated element is selected for transposition (Wang et al., 1996; Wang and Kunze, 1998). Our results showed that the ends in the Tam3 copies showing less transposition activity were considerably more methylated than the ends of active ones, as observed in IS10, where the hemimethylated form is at least 1000 times more active than a fully methylated element (Roberts et al., 1985). We have not ruled out a mechanism like that proposed for Ac9 and Ds-cy, although the interpretation of the present outcome is much simpler than those of the observations from Ac9 and Ds-cy, since our study was based on the comparisons of the excision frequencies and methylation patterns among identical copies present in different positions. Recently, we found that the methylation state at the Tam3 ends changes depending on temperature (Hashida, Mikami and Kishima, unpublished results). The low-temperature transposition of Tam3 appears to be related to hypomethylation of the ends, suggesting that the methylation state of the Tam3 ends strongly influences the activity of the element. Other unpublished data (Kitamura, Mikami and Kishima) showed that the N-terminal half of the Tam3 transposase peptide has an activity to bind to unmethylated Tam3 end sequences. Position-dependent degree of methylation of Tam3 The genomic region around Tam3:S-6 carrying the hypermethylated ends is in a less methylated state in several Antirrhinum lines (Figure 7). The methylation of Tam3:S-6 is thus thought to occur as de novo methylation. This is definite evidence for de novo methylation following insertion of an endogenous transposable element. In plants, de novo methylation is known to occur
preferentially when DNA segments containing repeat motifs, inverted repeats and/or high GC-content sequence are introduced into heterologous plants (Meyer and Heidmann, 1994; Lohuis et al., 1995; Stam et al., 1998; Luff et al., 1999). The Tam3 end regions harbor all of those structural features; there are seven quite stable hairpin loops (−125 to −63 kJ/mol) with an average GC content of 65% within 150 bp from both ends (Yamashita et al., 1999). These common structural features might be targeted and readily recognized by de novo methylation-related enzymes, and subsequently maintained by hemimethylation-related enzymes (Reik et al., 1999). Plant genes possess various levels of methylation stability; many ectopic or temporal changes of gene expression have been shown to be related to methylation, while an epimutated allele in Linaria vulgaris, which was first described 250 years ago, is attributable to heritably stable methylation (Cubas et al., 1999). The degree of methylation of the eight Tam3 copies was also found to be different. Relative to the high level of methylation in Tam3:S-6, the other copies had various levels of methylation. This suggests that chromosomal position determines the degree of methylation of Tam3. In mammals, the functions of de novo methylation and methylation maintenance are clearly separated: Dnmt3a and Dnmt3b are genes essential for de novo methylation (Okano et al., 1999), while Dnmt1 functions in the maintenance of parental methylation imprinting (Li et al., 1992). It will be of interest to clarify whether the degree of methylation in Tam3 is dependent on the de novo methylation efficiency or on the stability of methylation maintenance. Chromatin structure might also be involved in determining the degree of methylation, because the ddm1 mutant of Arabidopsis, which has a decreased level of methylation, encodes a protein homologous to a chromatin remodeling protein family, SWI2/SNF2, (Jeddeloh et al., 1999). The position effect of Tam3 might be directly linked to the chromatin structure surrounding the elements, because the higher excision ability of Tam3:S-78 might be a consequence of enhanced accessibility of the Tam3 transposase and/or other host protein(s). Further elucidation of the modulation of the Tam3 activity will provide insights into not only novel regulatory systems for the transposition, but also the above-mentioned aspects of the function of methylation and chromatin structure in plant genomes.
489 Acknowledgments We are especially grateful Dr C. Martin (John Innes Centre, Norwich, UK) for valuable comments on the manuscript. We thank Mr T. Yoshii for technical assistance, Prof. Y. Sano and Dr T. Kubo (Hokkaido University, Faculty of Agriculture) for providing a sequencing machine and technical advice, and Drs C. Martin and R. Carpenter (John Innes Centre, Norwich, UK) for gifts of the Antirrhinum seeds. A part of this work was done at the Research Center for Molecular Genetics, Hokkaido University. References Alleman, M. and Kermicle, J.L. 1993. Somatic variegation and germinal mutability reflect the position of transposable element Dissociation within the maize R gene. Genetics 135: 189–203. Bancroft, I. and Dean, C. 1993. Factor affecting the excision frequency of the maize transposable element Ds in Arabidopsis thaliana. Mol. Gen. Genet. 240: 65–72. Banks, J.A., Masson, P. and Fedoroff, N. 1988. Molecular mechanisms in the developmental regulation of the maize SuppressorMutator transposable element. Genes Dev. 2: 1364–1380. Bennetzen, J.L. 1987. Covalent DNA modification and the regulation of Mutator element transposition in maize. Mol. Gen. Genet. 208: 45–51. Berg, C. A. and Spradling, A.C. 1991. Studies on the rate and sitespecificity of P element transposition. Genetics 127: 515–524. Brown, J. and Sundaresan, V. 1992. Genetic study of the loss and restoration of Mutator transposon activity in maize: evidence against dominant-negative regulator associated with loss of activity. Genetics 130: 889–898. Brutnell, T.P. and Dellaporta, S.L. 1994. Somatic inactivation and reactivation of Ac associated with changes in cytosine methylation and transposase expression. Genetics 138: 213–225. Calvi, B.R., Hong, T.J., Findley, S.D. and Gelbart, W.M. 1991. Evidence for a common evolutionary origin of inverted repeat transposons in Drosophila and plants: hobo, Activator, and Tam3. Cell 66: 465–471. Carpenter, R., Martin, C. and Coen, E. 1987. Comparison of genetic behaviour of the transposable element Tam3 at two unlinked pigment loci in Antirrhinum majus. Mol. Gen. Genet. 207: 82–89. Chandler, V.L., and Walbot, V. 1986. DNA modification of a maize transposable element correlates with loss of activity. Proc. Natl. Acad. Sci. USA 83: 1767–1771. Chomet, P.S., Wessler, S. and Dellaporta, S.L. 1987. Inactivation of the maize transposable element Activator (Ac) is associated with its DNA modification. EMBO J. 6: 295–302. Coen, E.S., Carpenter, R. and Martin, C. 1986. Transposable elements generate novel spatial patterns of gene expression in Antirrhinum majus. Cell 47: 285–296. Cubas, P., Vincent, C. and Coen, E. 1999. An epigenetic mutation responsible for natural variation in floral symmetry. Nature 401: 157–161. Cuypers, H., Dash, S., Peterson, P.A., Saedler, H., and Gierl, A. 1988. The defective En-1102 element encodes a product reducing the mutability of the En/Spm transposable element system of Zea mays. EMBO J. 7: 2953–2960.
Dennis, E.S. and Brettell, R.I. 1990. DNA methylation of maize transposable elements is correlated with activity. Phil. Trans. R. Soc. Lond. B Biol. Sci. 326: 217–229. Doring, H.P. and Starlinger, P. 1986. Molecular genetics of transposable elements in plants. Annu. Rev. Genet. 20: 175–200. Engels, W.R., Johnson-Schlitz, D.M., Eggleston, W.B. and Sved, J. 1990. High-frequency P element loss in Drosophila is homologdependent. Cell 62: 515–525. Fedoroff, N.V. and Chandler, V. 1994. Inactivation of maize transposable elements. In: J. Paszkowski (Ed.) Homologous Recombination and Gene Silencing in Plants, Kluwer Academic Publishers, Dordrecht, Netherlands, pp. 349–385. Fedroff, N., and Schlappi, M. and Raina, R. 1995. Epigenetic regulation of the maize Spm transposon. Bioessays 17: 291–297. Garza, D., Medhora, M., Koga, A. and Hartl, D.L. 1991. Introduction of the transposable element mariner into the germline of Drosophila melanogaster. Genetics 128: 303–310. Gloor, G.B., Nassif, N.A., Johnson-Schlitz, D.M., Preston, C.R. and Engels, W.R. 1991. Targeted gene replacement in Drosophila via P element-induced gap repair. Science 253: 1110–1117. Haring, M., Gao, H.G., Volbeda,T., Rommens, T. H.J., Nijkamp, J. and Hille, J. 1989. A comparative study of Tam3 and Ac transposition in transgenic tobacco and petunia plants. Plant Mol. Biol. 13: 189–201. Harrison, B.J. and Fincham, J.R.S. 1964. Instability at the pal locus in Antirrhinum majus. I. Effects of environment on frequencies of somatic and germinal mutation. Heredity 19: 237–258. Harrison, B.J. and Fincham, J.R.S. 1968. Instability at the pal locus in Antirrhinum majus. III. A gene controlling mutation frequency. Heredity 23: 67–72. Hehl, H., Nacken, W.K.F., Krause, A., Saedler, H. and Sommer, H. 1991. Structural analysis of Tam3, a transposable element from Antirrhinum majus, reveals homologies to the Ac element from maize. Plant Mol. Biol. 16: 369–371. Jeddelho, J.A., Stokes, T.L. and Richards, E.J. 1999. Maintenance of genomic methylation requires a SWI2/SNF2-like protein. Nature Genet. 22: 94–97. Kidwell, M.G. 1994. The evolutionary history of the P family of transposable elements. J. Hered. 85: 339–346. Kidwell, M.G. and Lisch, D. 1997. Transposable elements as sources of variation in animals and plants. Proc. Natl. Acad. Sci. USA 94: 7704–7711. Kishima, Y., Yamashita,S., Martin, C. and Mikami, T. 1999. Structural conservation of the transposon Tam3 family in Antirrhinum majus and estimation of the number of copies able to transpose. Plant Mol. Biol. 39: 299–308. Kishima, Y., Yamashita, S. and Mikami, T. 1997. Immobilized copies with a nearly intact structure of the transposon Tam3 in Antirrhinum majus: implications for the cis-element related to the transposition. Theor. Appl. Genet. 95: 1246–1251. Kunze, R. and Starlinger, P. 1989. The putative transposase of transposable element Ac from Zea mays L. interacts with subterminal sequences of Ac. EMBO J. 8: 3177–3185. Kunze, R., Starlinger, P. and Schwartz, D. 1988. DNA methylation of the maize transposable element Ac interferes with its transcription. Mol Gen Genet 214: 325–327. Kunze, R., Stochaj, U., Laufs, J. and Starlinger, P. 1987. Transcription of transposable element Activator (Ac) of Zea mays L. EMBO J. 6: 1555–1563. Laski, F.A., Rio, D.C. and Rubin, G.M. 1986. Tissue specificity of Drosophila P element transposition is regulated at the level of mRNA splicing. Cell 44: 7–19.
490 Levy, A.A., and Walbot, V. 1990. Regulation of the timing of transposable element excision during maize development. Science 248: 1534–1537. Li, E., Bestor, T.H. and Jaenisch, R. 1992. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69: 915–926. Lisch, D., Chomet, P. and Freeling, M. 1995. Genetic characterization of the Mutator system in maize: behavior and regulation of Mu transposons in a minimal line. Genetics 139: 1777–1796. Lohuis, M., Müller, A., Heidmann, I., Niedenhof I. and Meyer, P. 1995. A repetitive DNA fragment carrying a hot spot for de novo methylation enhances expression variegation in tobacco and petunia. Plant J. 8: 919–932. Lozovskaya, E.R., Hartl, D.L. and Petrov, D.A. 1995. Genomic regulation of transposable elements in Drosophila. Curr. Opin. Genet. Dev. 5: 768–773. Luff, B., Pawlowski, L. and Bender, J. 1999. An inverted repeat triggers cytosine methylation of identical sequences in Arabidopsis. Mol. Cell 4: 505–511. Martin, C., Carpenter, R., Sommer, H., Saedler, H. and Coen, E. 1985. Molecular analysis of instability in flower pigmentation of Antirrhinum majus following isolation of the pallida locus by transposon tagging. EMBO J. 4: 1625–1630. Martin, C., Prescott, A., Lister, C. and MacKay, S. 1989. Activity of the transposon Tam3 in Antirrhinum and tobacco: possible role of DNA methylation. EMBO J. 8: 997–1004. Martienssen, R. and Baron, A. 1994. Coordinate suppression of mutations caused by Robertson’s Mutator transposons in maize. Genetics 136: 1157–1170. Meyer, P. and Heidmann, I. 1994. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specifc recognition of foreign DNA in transgenic plants. Mol. Gen. Genet. 243: 390–399. McDonald, J.F. 1993. Evolution and consequences of transposable elements. Curr. Opin. Genet. Dev. 3: 855–864. Ochman, H. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120: 621–623. O’Kane, C.J. and Gehring, W.J. 1987. Detection in situ of genomic regulatory elements in Drosophila. Proc. Natl. Acad. Sci. USA 84: 9123–9127. Okano, M., Bell, W.D., Haber, D.A. and Li, E. 1999. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99: 247–257. Peterson, P.W. and Yoder, J.I. 1995. Amplification of Ac in tomato is correlated with high Ac transposition activity. Genome 38: 265– 276.
Reik, W., Kelsey, G. and Walter, J. 1999. Dissecting de novo methylation. Nature Genet. 23: 380–382. Rio, D.C. 1991. Regulation of Drosophila P element transposition. Trends Genet. 7: 282–287. Roberts, D., Hoopes, B.C., McClure, W.R. and Kleckner, N. 1985. IS10 transposition is regulated by DNA adenine methylation. Cell 43: 117–130. Saedler, H. and Gierl, A. 1996. Transposable Elements. Current Topics in Microbiology and Immunology 204. Springer-Verlag, Berlin/Heidelberg. Schläppi, M., Raina, R. and Fedoroff, N. 1994. Epigenetic regulation of the maize Spm transposable element: novel activation of a methylated promoter by TnpA. Cell 77: 427–437. Schwartz, D. and Dennis, E. 1986. Transposase activity of the Ac controlling element in maize is regulated by its degree of methylation. Mol. Gen. Genet. 205: 476–482. Smit, A.F. and Riggs, A.D. 1996. Tiggers and DNA transposon fossils in the human genome. Proc. Natl. Acad. Sci. USA 93: 1443–1448. Smith, D., Yanai, Y., Liu, Y.G., Ishiguro, S., Okada, K., Shibata, D., Whittler, R.F. and Fedoroff, N. 1994. Characterization and mapping of Ds-GUS-T-DNA lines for targeted insertional mutagenesis. Plant J. 10: 721–732. Sommer, H., Carpenter, R., Harrison, B.J. and Saedler, H. 1985. The transposable element Tam3 of Antirrhinum majus generates a novel type of sequence alterations upon excision. Mol. Gen. Genet. 199: 225–231. Stam, M., Viterbo, A., Mol, J.N.M. and Kooter, J.M. 1998. Position-dependent methylation and transcriptional silencing of transgenes in inverted T-DNA repeats: implications for posttranscriptional silencing of homologous host genes in plants. Mol. Cell Biol. 18: 6165–6177. Wang, L., Heinlein, M. and Kunze, R. 1996. Methylation pattern of Activator transposase binding sites in maize endosperm. Plant Cell 4: 747–758. Wang, L. and Kunze, R. 1998. Transposase binding site methylation in the epigenetically inactivated Ac derivative Ds-cy. Plant J. 13: 577–582. Yamashita, S., Mikami, T. and Kishima, Y. 1998. Tam3 in Antirrhinum majus is an exceptional transposon resistant to alteration by abortive gap repair: identification of nested transposons. Mol. Gen. Genet. 259: 468–474. Yamashita, S., Shimizu-Takano, T., Kitamura, K., Mikami, T. and Kishima, Y. 1999. Resistance to gap repair of the transposon Tam3 in Antirrhinum majus: a role of the end regions. Genetics 153: 1899–1908.
