Possibility of Bean yellow mosaic virus detection in Gladiolus plants by ...

Journal of Plant Diseases and Protection, 118 (1), 2–6, 2011, ISSN 1861-3829. © Eugen Ulmer KG, Stuttgart

Possibility of Bean yellow mosaic virus detection in Gladiolus plants by different methods Ganesh S. Duraisamy*, Radovan Pokorný & Ludmila Holková Department of Crop Science, Breeding and Plant Medicine, Faculty of Agronomy, Mendel University, Brno, Czech Republic * Corresponding author: [email protected] Received 16 August 2010, accepted 17 December 2010

Abstract Serological and molecular methods were compared for the detection of Bean yellow mosaic virus (BYMV) in gladiolus plants. Plants showing mosaic symptoms were tested for the presence of BYMV using either DAS-ELISA, one step RT-PCR, real time (rt)-RT-PCR or IC-rt-RT-PCR. DAS-ELISA and one step RT-PCR were able to detect the virus in leaf samples, but not in corms or cormlets, while rt-RT-PCR and IC-rt-RT-PCR detected the virus in both leaves and corms or cormlets. Thus rt-RT-PCR and IC-rt-RT-PCR are proposed for the reliable diagnosis of BYMV in different tissues of gladiolus plants, particularly when virus-free stocks are required. Key words: BYMV, diagnosis, ELISA, IC-rt-RT-PCR, immunocapture-RT-PCR, rt-RT-PCR

1

Introduction

Virus diseases are a major source of economic loss in the production of ornamental plants. In gladioli, the virus survives in infected corms or cormlets (small daughter corms), spreads by vegetative propagation, and is transmitted by vectors. Under natural climatic conditions gladiolus plants can be infected by several viruses, including Arabis mosaic virus (ArMV), Bean yellow mosaic virus (BYMV), Broad bean wilt virus (BBWV), Tomato spotted wilt virus (TSWV), Soybean mosaic virus (SMV), Strawberry latent ring spot virus (SLRSV), Tobacco rattle virus (TRV), Tobacco mosaic virus (TMV), Tobacco ring spot virus (TRSV), Tobacco necrosis virus (TNV), Tobacco black ring virus (TBRV), Cucumber mosaic virus (CMV) and Tomato ringspot virus (ToRSV). BYMV is the most prevalent virus in gladioli, and can be associated with mosaic symptoms on leaves, colour-breaking in flowers, and reduced vigour (Bridgmon & Walker 1952; Fry 1953; Park et al. 1998; Zaidi et al. 1993). BYMV is a member of the Potyvirus genus (Shukla et al. 1994), which causes severe diseases in many leguminous and ornamental plants (Sasaya et al. 1998; Sutic et al. 1999). The virus is made up of 750 nm long flexuous particles, induces characteristic cylindrical inclusions in host cells, and is transmitted by aphids in a non persistent manner (Edwardsons & Christie 1986; Milne 1988). The virus is readily detected in leaf tissues of gladiolus plants (Zettler & Abo el-nil 1977), but cannot be readily detected by enzyme-linked immunosorbent assay (ELISA) or the reverse transcription polymerase chain reaction (RT-PCR) in corm tissue (Vunsh et al. 1991). Virus detection in gladiolus corms can be problematical (Katoch et al. 2003), presumably because BYMV presence in corms or cormlets is below the detection limit of the above methods. Nonetheless, leaves with a high BYMV titer can grow from corms or cormlets in which the virus cannot be detected (Stein et al. 1979). RT-PCR provides a sensitive means of detecting RNA plant viruses (Takaichi et al. 1998; Tsuneyoshi et al. 1998; Dovas et al. 2001). Immunocapture with polyclonal antibodies followed by RT-PCR is also appropriate for Potyvirus detection (for example Ptácek et al. 2002). This method involves enriching viral particles by antibody or plastic affinity capture, whilst

PCR inhibitors are eliminated from the samples during the immunocapture stage of the test. In addition, the captured viral particles are only lysed to release the RNA at the reverse transcription step and in the presence of RT reagents, so that the integrity of the RNA template is maintained throughout the procedure and loss of RNA due to degradation and during purification protocols can be avoided. Detection of RNA sequences is accomplished by first synthesising cDNA from the RNA molecules using reverse transcriptase (Becker-André & Hahlbrock 1989; Doherty et al. 1989; Kawasaki et al. 1988), which is subsequently used as a template for the PCR. Because the concentration of BYMV in gladiolus corms and cormlets tissue is very low, virus detection in such tissues poses a greater challenge than in leaves. In this paper we report the reliable detection of BYMV in gladiolus corms and cormlets using real time RT-PCR (rt-RT-PCR) and immunocapture real time RT-PCR (IC-rt-RT-PCR), which can overcome the problems of BYMV detection in these tissues by ELISA and conventional one step RT-PCR.

2 Materials and methods 2.1 Plant material For analysis of BYMV, corms or cormlets from twelve gladiolus (Gladiolus sp.) plants infected by BYMV isolates were selected according to results of DAS-ELISA tests of gladiolus leaves (Duraisamy & Pokorný 2009), and grown in a greenhouse at MENDELU, Brno. Isolates are listed in Table 1.

2.2 DAS – ELISA Leaves and corms or cormlets were tested for BYMV by serological methods using double antibody sandwich (DAS)-ELISA, according to Clark & Adams (1977). The ELISA test was carried out according to the manufacturer’s instructions (DSMZ), including negative and positive controls. The reaction was considered positive for BYMV infections where absorbance was > 0.1, equivalent to at least triple the background mean of a virus-free sample.

2.3 RNA extraction 100 mg of leaves and corm tissues were ground in liquid nitrogen using a pestle and mortar and transferred to a microfuge tube. Total RNA was extracted using an RNeasy plant Mini Kit (Qiagen, Germany) following the manufacturer’s instructions. In rt-RT-PCRs and IC-rt-RT-PCRs, healthy plant material (Nicotiana benthamiana) and premix without nucleic acids were used as controls.

2.4 One step RT-PCR The one step RT-PCR was performed using a Qiagen one step RT-PCR kit (Qiagen, Germany) in a total volume of 25 µl conJ.Plant Dis.Protect. 1/2011

Duraisamy et al.: Virus detection in Gladiolus plants Table 1: List of BYMV isolates Sample number

Code number Locality (Duraisamy et al. 2009)

Name of the cultivars

1 2 3 4 5 6 7 8 9 10 11 12

J16BYV1 J34BYV1 J49BYV1 J50BYV1 J95BYV1 M65BYV1 M71BYV1 M78BYV1 M103BYV1 N4BYV1 N7BYV1 N14BYV1

Soumrak Jo Ann Gladiris Gladiris Bambino Drama Nova Lux Victor Borge Pr.Marg.Rose N4 N7 N14

Jestrábí field Jestrábí field Jestrábí field Jestrábí field Jestrábí field Market Market Market Market Nedvedice garden Nedvedice garden Nedvedice garden

taining 1 µl RNA (50 ng) extract, 5 µl 5x P buffer, 5 µl 5x Q buffer, 1 µl dNTPs (10 mM), 0.75 µl of each primer (20 µM) and 0.55 µl enzyme mix, made up to the final volume with RNase-free water. The primer pair used for the detection of BYMV (NIF-5’-GAGCGCATCGTTTCAATTCT-3’ and NIR-5’-AG CATGGGGCTATCCAACT-3’) was designed to amplify a portion of the NIb gene, based on GenBank accession AM884180.

PCR conditions. The PCR consisted of reverse transcription at 50°C for 30 min, an initial denaturation step at 94°C for 15 min, followed by 40 cycles of 95°C for 30 s, 54°C for 30 s, 72°C for 30 s and a final extension at 72°C for 10 min.

Analysis of amplified products. 25 µl aliquots of PCR products were analysed by electrophoresis through 2% TBE-agarose gels at 70 V for 45 min. The amplicon was visualised by ethidium bromide (2.5 µl 100 ml–1) staining. Fragments were sized using a 100 bp marker.

2.5 rt-RT-PCR First strand cDNA synthesis. To obtain cDNA for the RT-PCR,

5 µl of sample RNA (50 ng RNA) was reverse transcribed in a 25 µl reaction volume containing 2 µl 10x Buffer RT, 2 µl dNTP mix (5 mM), 1 µl NIR reverse primer (20 µM), 1 µl RNase inhibitor (10 units µl–1), 1 µl Sensicript RT enzyme (Sensiscript® kit, Qiagen, Germany) and RNase free water to complete the volume. The reaction mixture was incubated at 37°C for 60 min.

PCR with SYBR® green. The PCR mix was made up to a volume

of 25 µl containing 5 µl of cDNA template,12.5 µl Quanti Tect SYBR® green 2x PCR Master Mix, 0.25 µl uracil-N-glycosylase (0.5 units reaction–1), 0.4 µl of each forward and reverse primer (20 µM). The PCR consisted of a pre-incubation at 50°C for 2 min, a denaturation at 94°C for 15 min, then 40 cycles at 95°C for 30 s, 54°C for 30 s and 72°C for 30 s, and finally an extension at 72°C for 10 min. Amplification specificity was checked using a heat dissociation protocol (melting curves in the range 78.5–79°C). The peak of the melting curve was the same in all reactions, indicating the presence of one specific product. The same primers (NIF/R) were used for this reaction and PCR was carried out on a Bio-Rad IQ™5 Real-Time PCR device. The specific products were visualised J.Plant Dis.Protect. 1/2011

3

by electrophoresis through 2% agarose gels. Products were subsequently passed through a Qiagen PCR purification kit, sequenced with both primers NIF/R and compared with sequences detected in leaves (Duraisamy et al. 2009) in order to verify their BYMV specificity. Sequencing was provided by the department of Genomic.

IC-rt-RT-PCR. The immunocapture reaction was performed in ELISA plate wells (GAMA C eské Budejovice), previously coated for 2 h at 37°C with 50 µl of a BYMV polyclonal antibody (DSMZ, Germany), diluted 1:1000 in 0.05 M carbonate buffer (pH 9.6). BYMV-infected gladiolus leaves and corms or cormlets were ground 1:10 (w/v) in extraction buffer according to Clark & Adams (1977) and incubated at 4°C overnight. The tubes were washed three times by flooding with PBS-Tween (Nolasco et al. 1993). For synthesis of cDNA, the same ELISA plates were used and 25 µl of the following was added to each well: 2 µl 10x Buffer RT, 2 µl dNTP mix (5 mM), 1 µl NIR reverse primer (20 µM), 1 µl RNase inhibitor (10 units µl–1), 1 µl Sensicript RT enzyme (Sensiscript® kit, Qiagen, Germany) and RNase free water to complete the volume. The first strand cDNA was synthesised by incubating at 37°C for 60 min. This was subsequently amplified using a ready-to-go PCR bead (PCR with SYBR® green, Qiagen) with the following reagents: 5 µl of cDNA template, 12.5 µl 2x Quanti Tect SYBR® green, 0.25 µl uracil-N-glycosylase (0.5 units reaction–1), 0.4 µl of each forward and reverse primer (20 µM) and RNase free water to make up to 25 µl. The PCR consisted of a pre-incubation at 50°C for 2 min, a denaturation at 94°C for 15 min, then 40 cycles at 95°C for 30 s, 54°C for 30 s and 72°C for 30 s, and finally an extension at 72°C for 10 min. Amplification specificity was checked with a heat dissociation protocol (melting curves in the range 78.5–79°C). The peak of the melting curve was the same in all reactions, indicating the presence of one specific product. The NIF/R primers were used for this reaction. The specific products were visualised by agarose gel electophoresis as for the one step RT-PCR. 3

Results and discussion

Plant samples were analysed by ELISA using a polyclonal antibody for BYMV in order to determine their infection status. All leaf samples were positive for BYMV, but the test failed to detect the virus in corms or cormlets Stein et al. (1979, 1986, 1994) have shown that BYMV in gladioli, while being readily detected by ELISA in the leaves, cannot be detected in corms. Problems with detection of the virus in gladiolus corms and cormlets using ELISA has also been shown in several other studies (Nagel et al. 1983; Rosner et al. 1994; Bellardi & Vicchi 1995). Total RNA extracted from leaves, corms or cormlet tissue was analysed by several PCR methods. One step RT-PCR followed by gel electrophoresis revealed one specific amplification product of size approximately 100 bp in the leaf samples (Fig. 1). With RNA extracts from corm or cormlet tissue only very weak amplification was obtained (Fig. 2). Stein et al. (1986) reported that BYMV could not be detected by standard PCR methods in the majority of corm tissues, even after following various purification procedures. It has been suggested that this may be due to the presence of PCR inhibitors or very low concentration of BYMV in these tissues (Wong et al. 1987; Saiki et al. 1988; Fenby et al. 1995). Detection of BYMV RNA by rt-RT-PCR was accomplished after initial synthesis of cDNA by reverse transcriptase. The cDNA revealed amplification products of size approximately 100 bp in leaf, corm and cormlet samples (Fig. 3 and 4). Vunsh et al. (1990) also detected specific BYMV sequences in RNA extracts of infected plants by rt-RT-PCR, and later reported that BYMV could not be readily detected in corms of infected

4

Duraisamy et al.: Virus detection in Gladiolus plants

Fig. 1: Agarose gel electrophoresis of one step RT-PCR products of NIF/R from Jestrábí field, Market and Nedvedice leaves sample; Lane Mw – Molecular marker (100 bp), Lane 1–12: see Table 1, Lane K: Control (without nucleic acid).

Fig. 3: Agarose gel electrophoresis of rt-RT-PCR products of NIF/R from Jestrábí field, Market and Nedvedice leaves sample; Lane Mw – Molecular marker (100 bp), Lane 1-12: see Table 1. Lane K: Negative (Nicotiana benthamiana), Lane K1: Control (without nucleic acid).

plants by serological methods but could be partially detected in corms by using rt-RT-PCR accompanied by hybridisation with a BYMV specific probe (Vunsh et al. 1991). However, the present study was able to detect BYMV in corm and cormlets without the hybridisation step. According to Stein et al. (1986), BYMV could be detected in corms of infected gladioli by rt-RT-PCR after wounding the corms and keeping them for a certain period of time prior to testing; in addition, the reliability of detection was also affected by the size of the corms, although no such effect of size was found in the present study. Others have also described the usefulness of rt-RT-PCR for detecting Potyvirus. Agindotan et al. (2007) described the rt-RT-PCR assay as being highly sensitive, specific and suitable for large-scale diagnostic testing of plants, including direct tuber testing for Potato virus Y (PVY). Development of such an assay for BCMV (Bean common mosaic virus) would be a particular improvement, especially in seed extracts, where the

Fig. 2: Agarose gel electrophoresis of one step RT-PCR products of NIF/R from Jestrábí field, Market and Nedvedice corm or cormlets sample; Lane Mw – Molecular marker (100 bp), Lane 1-12: see Table 1, Lane K+: Positive (infected gladiolus leaf), Lane K: Control (without nucleic acid).

Fig. 4: Agarose gel electrophoresis of rt-RT-PCR products of NIF/R from Jestrábí field, Market and Nedvedice corms or cormlets sample; Lane Mw – Molecular marker (100 bp), Lane 1-12: see Table 1, Lane K: Negative (Nicotiana benthamiana), Lane K1: Control (without nucleic acid).

low titer of the virus makes it difficult to detect by less sensitive techniques (Robertson et al. 1991). In the present experiment, products of five isolates of rt-RT-PCR were sequenced with both primers NIF/R (Fig. 5) and corresponded to corresponding sequences of known viruses isolated from leaves (Duraisamy et al. 2009). Immunocapture reactions with the BYMV common antiserum followed by rt-RT-PCR yielded a distinct product of 100 bp with the NIF/R primer pair in both leaves and corm or cormlet samples (Figs. 6 and 7). No amplification products were seen in controls without nucleic acid or in healthy Nicotiana spp. plants. BYMV specific primers combined with a polyclonal antibody reportedly promoted the amplification of a specific product in pea by IC-RT-PCR (Guyatt et al. 1996; Nakamura et al. 1996), and the same technique can overcome the problem of very low virus titre situations, such as for Plum pox virus (PPV) in peach, apricot and plum (Varveri & Boutsika

M71BYV1-S1*

GAGGAGCGCATCGTTTCAATTCTGGAGTGGGACAGAGCTATTCAACCAGAACATAGACTT 224

M71BYV1-Co**

-----------------------GGAGTGGGACAGAGCTATTCAACCAGAACATAGACTT 33

J95BYV1-S1

GAGGAGCGCATCGTTTCAATTCTGGAGTGGGACAGAGCTATTCAACCAGAACATATATTT 298

J95BYV1-Co


N4BYV1-S1

GAGGAGCGCATCGTTTCAATTCTGGAGTGGGACAGAGCTATTCAACCGGAACATAGACTT 226

N4BYV1-Co


M71BYV1-S1

GAGGCAATATGCGCAGCAATGATTGAAGCATGGGGCTATCCAACTCTATTAAACCACATA 284

M71BYV1-Co

GAGGCAATATGCGCAGCAATGAT------------------------------------- 56

J95BYV1-S1

GAGGCAATATGCGCAGCAATGATTGAAGCATGGGGCTATCCAACTCTATTAAACCACATG 358

J95BYV1-Co

GAGGCAATATGCGCAGCAATGAT------------------------------------- 59

N4BYV1-S1

GAGGCAGTATGCGCAGCAATGATTGAAGCATGGGGCTATCCAACTCTATTAAACCACATA 286

N4BYV1-Co

GAGGCAATATGCGCAGCAATAAT------------------------------------- 60

************************ ************

****** ************* **

Fig. 5: Alignment of sequences isolated from leaves (Duraisamy et al. 2009) and corms/cormlets (see Table 1) of gladioli isolates. * sequences from leaves (sequencing was done from primers S1/S2 (Duraisamy et al. 2009); ** sequences from corm or cormlets (sequencing was done from primers NIF/R indicated by grey background). J.Plant Dis.Protect. 1/2011


5

Fig. 6: Agarose gel electrophoresis of ic-rt-RT-PCR products of NIF/R from Jestrábí field, Market and Nedvedice leaves sample; Lane Mw – Molecular marker (100 bp), Lane 1-12: see Table 1, Lane K+: Positive (infected gladiolus leaf), Lane K: Negative (Nicotiana benthamiana), Lane K1: Control (without nucleic acid).

Fig. 7: Agarose gel electrophoresis of ic-rt-RT-PCR products of NIF/R from Jestrábí field, Market and Nedvedice corm or cormlets sample; Lane Mw – Molecular marker (100 bp), Lane 1–12: see Table 1, Lane K+: Positive (infected gladiolus leaf), Lane K: Negative (Nicotiana benthamiana), Lane K1: Control (without nucleic acid).

Table 2: Comparison of rt-RT-PCR and ic-rt-RTPCR on the basis of the measured CT values at the same threshold position (Th)

diagnosing BYMV in leaves and corms or cormlets. In contrast to methods reviewed by Katoch et al. (2003), these assays provide a robust, sensitive procedure, which identifies a range of BYMV isolates obtained from leaves, corms and cormlets. The techniques could also be used for breeding and quarantine programs as well as for studies of the epidemiology and control of BYMV.

Sl No

1 2 3 4 5 6 7 8 9 10 11 12

Code number

J16BYV1 J34BYV1 J49BYV1 J50BYV1 J95BYV1 M65BYV1 M71BYV1 M78BYV1 M103BYV1 N4BYV1 N7BYV1 N14BYV1 K+ K– K1–

Corm or cormlets samples rt-RT-PCR Ic-rt-RT-PCR (CT values, Th 100) (CT values, Th100) 29.11 28.70 27.89 27.90 29.29 29.85 30.83 27.92 29.31 30.00 29.04 28.90 29.95 34.35 33.30

27.04 27.42 29.52 26.90 27.77 27.59 28.66 26.68 27.85 28.05 27.06 27.67 20.12 NT NT

1998). It has gained popularity as a detection method for plant viruses, as it often improves the sensitivity and specificity of the assay, reduces problems with PCR inhibitors in DNA extracted from samples rich in carbohydrates and provides a faster and cheaper method of preparing template for amplification (Wetzel et al. 1992; Geering et al. 2000; Sharman et al. 2000). According to our results, it can also overcome problems associated with contamination of negative controls during detection. This study confirms the possibility of detecting BYMV in leaves and corms or cormlets by various methods. DAS-ELISA and one step RT-PCR methods were both able to detect the virus in leaves but failed to do so in corms or cormlets, either because of low virus titer or because of the presence of inhibitor(s). rt-RT-PCR and IC-rt-RT-PCR did not have these problems, probably thanks to the dilution of RNA during the reverse transcription step of the RT-PCR. We also compared the sensitivity of these two methods (Table 2). Ct values were lower in IC-rt-RT-PCR compared with rt-RT-PCR in almost all isolates, showing that IC-rt-RT-PCR is more suitable for detecting virus in corms or cormlets. Corms selected for growing virus free gladiolus plants should therefore be screened for the presence of BYMV infection not only by ELISA or one step RT-PCR, but also by rt-RT-PCR or IC-rt-RT-PCR. ELISA and one step RT-PCR are reliable methods only for leaves, whereas rt-RT-PCR and IC-rt-RT-PCR are quick, reliable and sensitive techniques for J.Plant Dis.Protect. 1/2011

Acknowledgements This study was supported by the project No. MSM6215648905 “Biological and technological aspects of sustainability of controlled ecosystems and their adaptability to climate change“, from the Ministry of Education, Youth, and Sports of the Czech Republic and by the grant IGA 2008-DP6/AF from the Mendel University of Agriculture and Forestry, Brno, Czech Republic. The authors also thank to www.smartenglish.co.uk for linguistic advice in the preparation of this manuscript.

References Agindotan BO, Shiel PJ & Berger PH, 2007. Simultaneous detection of potato viruses, PLRV, PVA, PVX and PVY from dormant potato tubers by TaqMan(R) real-time RT-PCR. J Virol Methods 142, 1-9. Becker-André M & Hahlbrock K, 1989. Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel approach by a PCR aided transcript assay (PATTY). Nucleic Acid Res 17, 9437-9446. Bellardi MG & Vicchi V, 1995. Applicability of the ELISA technique for identifying Bean yellow mosaic potyvirus (BYMV) in gladiolus corms. Sementi – Elette 41, 19-21. Bridgmon GH & Walker JC, 1952. Gladiolus as a virus reservoir. Phytopathology 42, 65-70. Clark MF & Adams AN, 1977. Characteristics of the micro plate method of enzyme linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34, 475-483. Doherty PJ, Huesca-Contreras M, Dosch HM & Pan S, 1989. Rapid amplification of complementary DNA from small amounts of unfractionated RNA. Anal Biochem 177, 7-10. Dovas CI, Hatziloukas E, Salmon R, Barg E, Shiboleth Y & Katis NI, 2001. Comparison of methods for virus detection in Allium spp. J Phytopathol 149, 731-737. Duraisamy GS & Pokorný R, 2009. Survey of virus pathogens on gladiolus, iris and tulips in the Czech Republic. Acta univ agric et silvic Mendel Brun, LVII, 5, 79-86. Duraisamy GS, Pokorný R & Holkova L, 2009. Variability studies of BYMV isolates in the Czech Republic. Acta Virol 53, 277-280. Edwardsons JR & Christie RG, 1986. Viruses infecting forage legumes. Vol 2, Chap 14. Monograph 14. University of Florida, Gainesville, 724 pp. Fenby NS, Scott NW, Slater A & Elliott MC, 1995. PCR and non-isotopic labeling techniques for plant virus detection. Cell Mol Biol 41, 639-652.

6


Fry PR, 1953. Two virus diseases of gladiolus. New Zeal J Scie Technol 34, 460-464. Geering ADW, McMichael LA, Dietzgen RG & Thomas JE, 2000. Genetic diversity among Banana streak virus isolates from Australia. Phytopathology 90, 921-927. Guyatt KJ, Proll DF, Menssen A & Davidson AD, 1996. The complete nucleotide sequence of bean yellow mosaic potyvirus RNA. Arch Virol 141, 1231-1246. Katoch M, Abdin MZ, Ram R & Zaidi AA, 2003. An overview of diagnostics for viruses infecting gladiolus. Crop Protection 22, 153-153. Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte ON & McCormick FP, 1988. Diagnosis of chronic myeloid and acute lymphocytic leukaemias specific mRNA sequences amplified in vitro. Proc Natl Acad Sci USA 85, 5698-5702. Milne RG, 1988. The filamentous plant viruses. In: The plant viruses. Plenum Press, New York, 423 pp. Nagel V, Zettler FW & Hiebert E, 1983. Strains of bean yellow mosaic virus compared to bean yellow vein virus relation to gladiolus production in Florida. Phytopathology 73, 449-453. Nakamura S, Honkura R, Iwai T, Ugaki M & Ohashi Y, 1996. The complete nucleotide sequence of Bean yellow mosaic virus genomic RNA. Ann Phytopathol Soc Jpn 62, 473-477. Nolasco G, de Blas C, Torres V & Ponz F, 1993. A method combining immunocapture and PCR amplification in a microtiter plate for the routine diagnosis of plant viruses and subviral pathogens. J Virol Methods 45, 201-218. Park IS, Kim KW, Kyun H & Chang MU, 1998. The viruses in Gladiolus hybridus cultivated in Korea. 1. Bean yellow mosaic virus and Clover yellow vein virus. Korean J Plant Pathol 14, 74-82. Ptácek J, Škopek J, Dedic J & Matoušek J, 2002. Immunocapture RT-PCR probing of Potato virus Y isolates. Acta Virol 46, 63-68. Robertson NL, French R & Gray S, 1991. Use of group-specific primers and the polymerase chain reaction for the detection and identification of luteoviruses. J Gen Virol 72, 1473-1477. Rosner A, Stein A, Levy S & Lilien-Kipnis H, 1994. Evaluation of linked PCR-transcription amplification procedure for bean yellow mosaic virus detection in gladioli. J Virol Methods 47, 227-235. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB & Erlich HA, 1988. Primer – directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. Sasaya T, Nozu Y & Koganezawa H, 1998. Biological and serological comparisons of Bean yellow mosaic virus (BYMV) isolates in Japan. Ann Phytopathol Soc Jpn 64, 24-33.

Sharman M, Thomas JE & Dietzgen RG, 2000. Development of a multiplex immunocapture PCR with colourimetric detection for viruses of banana. J Virol Methods 89, 75-88. Shukla DD, Ward CW & Brunt AA, 1994. The Potyviridae. CABI, Wallingford, 528 pp. Stein A, Loebenstein G & Koenig R, 1979. Detection of cucumber mosaic virus and bean yellow mosaic virus in gladiolus by enzyme linked immunosorbent assay (ELISA). Plant Dis Rep 63, 185-188. Stein A, Salomon R, Cohen J & Loebenstein G, 1986. Detection and characterization of bean yellow mosaic virus in corms of Gladiolus grandiflorus. Ann Appl Biol 109,147-154. Stein A, Rosner A & Hammond J, 1994. Detection of bean yellow mosaic virus in gladioli corms. Acta Hortic 377, 209-220. Sutic DD, Ford IRE & Tosic MT, 1999. Handbook of plant virus diseases. CRC Press, New York, 584 pp. Takaichi M, Yamamoto M, Nagakubo K, Oeda K, 1998. Four garlic viruses identified by the reverse transcription-polymerase chain reaction and their regional distribution in northern Japan. Plant Dis 82, 694-698. Tsuneyoshi T, Matsumi T, Deng TC, Sako I & Sumi S, 1998. Differentiation of Allium carlaviruses isolated from different pars of the world based on the viral coat protein sequence. Arch Virol 143, 1093-1107. Varveri C & Boutsika AK, 1998. Application of immunocapture-PCR technique for plum pox potyvirus detection under field conditions in Greece and assays to simplify standard techniques. Acta Hortic 472, 475-481. Vunsh R, Rosner A & Stein A, 1990. The use of polymerase chain reaction (PCR) for the detection of bean yellow mosaic virus in gladiolus. Ann Appl Biol 117, 561-569. Vunsh R, Rosner A & Stein A, 1991. Detection of bean yellow mosaic virus in gladioli corms by the polymerase chain reaction. Ann Appl Biol 119, 289-294. Wetzel T, Candresse T, Macquaire G, Ravelonandro M & Dunez J, 1992. A highly sensitive immunocapture polymerase chain reaction method for Plum pox potyvirus detection. J Virol Methods 39, 27-37. Wong C, Dowling CE, Saiki RK, Higuchi RG, Erlich HA & Kazazian A, 1987. Characterization of β – thalassaemia mutation using direct genomic sequencing of amplified single copy DNA. Nature 330, 384-386. Zaidi AA, Ram R, Zaidi SNH & Mukherjee D, 1993. Diagnosis of viruses in some ornamental plants with special reference to serological methods: new developments. Indian Rev Life Sci 13, 157-174. Zettler FW & Abo El-Nil MM, 1977. Bean yellow mosaic virus infections on gladiolus in Florida. Plant Dis Rep 61, 243-247.

J.Plant Dis.Protect. 1/2011