Predicting Recurrence of C. difficile Colitis Using ... - Springer Link

J Gastrointest Surg (2013) 17:118–125 DOI 10.1007/s11605-012-2056-6

2012 SSAT PLENARY PRESENTATION

Predicting Recurrence of C. difficile Colitis Using Bacterial Virulence Factors: Binary Toxin Is the Key David B. Stewart & Arthur Berg & John Hegarty

Received: 20 April 2012 / Accepted: 11 October 2012 / Published online: 20 October 2012 # 2012 The Society for Surgery of the Alimentary Tract

Abstract Background Recurrent Clostridium difficile colitis is common, yet the ability to predict recurrence is poorly developed. Methods Patients ≥18 years of age treated at our institution for C. difficile of any severity were consecutively enrolled. C. difficile colitis was defined as symptoms of colitis with a positive PCR stool test. Each bacterial isolate was studied for virulence factors: tcdC mutations via PCR; the presence of genes for toxins A, B, and binary toxin using restriction fragment length polymorphism; and identification of ribotype 027 by PCR. Chi-squared tests, t tests, and logistic and linear regression were used to determine which virulence factors predicted recurrence. Results Sixty-nine patients (male, 57 %) were studied, with a mean age of 64±13 years. Twenty-one (30 %) patients were initially diagnosed as outpatients. There was no difference (p>0.05) between virulence factors among inpatients and outpatients. The presence of a binary toxin gene was the single virulence factor independently associated with recurrence (p00.02). The combination of a tcdC mutation with binary toxin gene resulted in the highest odds of recurrence (OR, 5.3; 95 % CI, 3.52–6.09). Conclusion Binary toxin gene is a predictor of recurrent infection. Its presence may require longer antibiotic regimens in an effort to lower already elevated recurrence rates. Keywords Clostridium difficile . Recurrence . Binary toxin . Virulence

Introduction The recent state of Clostridium difficile infection (CDI) is characterized by both conceptual upheaval and frequent shifts in the collective understanding of its pathophysiology.1 This flux is attributable to rapid changes in disease patterns toward a higher incidence and prevalence of C. difficile colitis (CDC),2,3 coupled with more frequent occurrences of fulminant CDC which,4,5 contrary to past disease behavior, now This manuscript was presented at the SSAT Plenary Session III at the May 2012 Digestive Disease Week Meeting in San Diego, CA, USA. D. B. Stewart (*) : A. Berg : J. Hegarty Department of Surgery, Penn State College of Medicine, 500 University Drive, H137, Hershey, PA 17033, USA e-mail: [email protected]

more regularly requires surgical intervention as a stopgap to failing medical therapy. While death from CDC is an uncommon sequela, a commonplace adverse outcome involves recurrent CDC (RCDC). It is estimated that a minimum of 20– 30 % of CDC patients will develop at least one recurrent episode, with an incidence that approaches 50–65 % subsequent to the first recurrence.6,7 RCDC often requires extended periods of treatment, which exposes patients to lengthy and expensive courses of antibiotics which may ultimately prove inadequate toward eradicating the infection.8 Several patient-related and environmental risk factors for both primary and recurrent C. difficile infection have been suggested, such as the absence of proper hand-washing among health care providers9 as well as the injudicious use of broad spectrum antibiotics.10 More recently, the Food and Drug Administration released a warning11 that the use of proton-pump inhibitors may promote CDI, which may prove to have implications for RCDC as well. Despite these and other associations, the ability to actually predict CDC disease course, including recurrence of infection, from clinical factors alone remains merely provisional.

J Gastrointest Surg (2013) 17:118–125

By comparison to purely clinical research, much less information is available to explain how bacterial genetics and toxin profiles might influence the clinical progression of CDC, including the ontogeny of recurrent infections. In particular, whether there is a difference in recurrence rates as influenced by the presence of the relatively recently discovered binary toxin is completely unknown. While there is currently a heightened interest in the molecular biology of C. difficile, the determinative influences of alleged bacterial virulence factors compared to more commonly appealed to clinical factors, and the interplay between bacterial and patient characteristics, is at present an underdeveloped schema. In terms of correlating bacterial factors with RCDC, there is almost no previous research to guide clinical decisions. The aim of the present study was to characterize how C. difficile virulence factors studied from non-duplicated patient-derived stool samples correlated with the incidence of RCDC.

119

exposure to a Wood’s lamp. These isolates were then subcultured on CDC anaerobe 5 % sheep blood agar. Isolated colonies were then biochemically identified using RapID ANA II panels (Remel, Lenexa, KS). Positive C. difficile isolates were tested for susceptibility to metronidazole and vancomycin by the Etest method (bioMérieux, Durham, NC). Etest strips were positioned directly on the agar surface and were incubated at 37 °C for 48 h. The minimum inhibitory concentration (MIC) (in micrograms per milliliter) for metronidazole and vancomycin was measured at the ellipse of inhibited growth. Isolates were then stored and suspended in trypticase soy broth (BBL Becton Dickinson, Franklin Lakes, NJ) containing 15 % glycerol at −80 °C. DNA Extraction Bacterial genomic DNA was purified from washed bacterial cell pellets obtained from plate cultures following a 48-h period of anaerobic growth at 37 °C. DNA was extracted using the UltraClean Microbial DNA isolation kit (MO-BIO, Carlsbad, CA) and was checked for concentration and purity with a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE).

Materials and Methods This study was performed solely at the authors’ institution and with the Institutional Review Board (IRB) approval. The study is linked to an IRB-approved C. difficile tissue bank of one of the authors (DS), which collects C. difficilepositive clinical stool samples from inpatients and outpatients 18 years of age or older who consent to the use of their specimen for scientific research. Bacterial Isolates All C. difficile isolates were cultured and cryopreserved from patient-derived stool samples which were sent to our institution’s clinical microbiology laboratory for testing. The presence of the C. difficile gene for toxin A (tcdA) was confirmed through the use of a loopmediated isothermal DNA amplification technique, as part of each patient’s clinical evaluation for CDC. Reference C. difficile strains representing ribotypes 021 and 078 (both NAP7 and NAP8 variants) were kindly provided by Dr. Brandi Limbago (Centers for Disease Control and Prevention, Atlanta, GA, USA) in order to verify identification of C. difficile for all PCRs subsequently performed. Isolation of C. difficile C. difficile-positive stool samples were shocked in 95 % alcohol for 30 min followed by culture using CDC anaerobe and phenylethyl alcohol anaerobe agars (Remel, Lenexa, KS) containing 5 % sheep blood, under anaerobic conditions (85 % N2, 10 % CO2, 5 % H2) using an Anoxomat system. Presumptive C. difficile isolates were identified by their characteristic malodor, characteristic colony morphology, and by chartreuse fluorescence under

Detection of Binary Toxin Gene Primers Tim6, Struppi6, cdtBpos, and cdtBrev (Table 1) were used for multiplex amplification of the binary toxin gene (CDT) as well as the C. difficile-specific gene cdd3. Cycle conditions consisted of 35 cycles of denaturation for 30 s at 94 °C, annealing for 45 s at 50 °C, with extension for 1 min at 72 °C, followed by a final extension cycle for 5 min at 72 ° C. PCR products were separated by electrophoresis on 1.5 % Tris–acetate–EDTA (TAE) agarose gels and were assessed following ethidium bromide staining. Toxinotyping Isolates were toxinotyped for the major toxins using primers A3C, A4N, B1C, and B2N (Table 1) as described by Rupnik,12 with modified cycling conditions. The first 3 kb of the toxin B gene (B1) and 3 kb of the C-terminal region of the toxin A gene (A3) were amplified by PCR using cycle conditions consisting of 40 cycles of denaturation for 5 s at 95 °C, annealing for 5 s at 48 °C, and with extension for 3 min at 72 °C, followed by a final extension cycle for 7 min at 72 °C. Toxin fragments B3 and A1 were confirmed on 1 % TAE agarose gels at 6 V/cm for 1 h and were then subsequently digested by restriction enzymes HincII, AccI, and EcoRI at 37 °C for 3 h. Restriction patterns defining the toxinotypes were determined by final electrophoresis on 1.5 % TAE agarose gels at 8 V/cm for 2 h followed by ethidium bromide staining. PCR Ribotyping Genetic variations between isolates were further characterized by 16S–23S rRNA intergenic spacer PCR performed using the method outlined by Stubbs.13 PCR products were separated on 2.5 % MetaPhor agarose

120


Table 1 Primers used for PCR testing of C. difficile isolates Primer

5′–3′ sequence

Target

Size(s) (bp)

Reference

Tim6 Struppi6 cdtBpos cdtBrev tcdC1 tcdC2 16S 23S A3C A4N B1C B2N

TCCAATATAATAAATTAGCATTCCA GGCTATTACACGTAATCCAGATA CTTAATGCAAGTAAATACTGAG AACGGATCTCTTGCTTCAGTC GCACCTCATCACCATCTTC TGGTTCAAAATGAAAGACGAC CTGGGGTGAAGTCGTAACAAGG GCGCCCTTTGTAGCTTGACC TATTGATAGCACCTGATTTATATACAAG TTATCAAACATATATTTTAGCCATATATC AGAAAATTTTATGAGTTTAGTTAATAGAAA CAGATAATGTAGGAAGTAAGTCTATAG

cdd3

622

Stubbs et al.26

cdtB

510

tcdC

196–250

Spigaglia and Mastrantonio14

16S (1,445–1,466; 3′ end) 23S (20 to 1; 5′ end) A3 fragment of tcdA

200–700

Stubbs et al.13

3,100

Rupnik et al.12

B1 fragment of tcdB

3,100

gels (Lonza, Allendale, NJ) at 150 V in 0.5× chilled Tris– borate–EDTA (TBE) buffer for 4 h followed by ethidium bromide staining. Ribotypes were determined by comparison of gel electrophoresis banding patterns to reference strains. tcdC Deletions Large deletions in the negative regulator of toxin production (tcdC) protein were identified as described by Spigaglia and Mastrantoni,14 with slight modifications. Primers tcdC1 and tcdC2 (Table 1) were used to amplify a 250-bp region of the tcdC gene. PCR was carried out in 20μL reactions containing HotStar Plus master mix (Qiagen, Valencia, CA) containing 1.5 mM MgCl2, 10 pmol of primers, and 1 ng genomic DNA. The DNA template was denatured at 95 °C for 5 min, and DNA was amplified for 35 cycles consisting of denaturation for 30 s at 94 °C, annealing for 30 s at 52 °C, and extension for 30 s at 72 °C. Reactions were terminated following a final extension step for 4 min at 72 °C. tcdC deletions were identified by electrophoresis on 2.5 % TBE agarose gels at 7.5 V/cm for 3 h and visualized by ethidium bromide staining. Clinical Data Each patient enrolled in the tissue bank also provided consent for review of their medical record. For all patients, age, gender, ethnicity, and the presence of comorbidities were recorded. A Charlson Comorbidity Scale (CCS)15 score was calculated for both inpatients and outpatients, as was a measurement of the severity of each Table 2 Infectious Disease Society of America criteria to categorize severity of C. difficile infection

patient’s CDC using the guidelines from the Infectious Diseases Society of America (IDSA) criteria16 as listed in Table 2. Clinical data collected included whether or not hospital admission was required at any time during the treatment of CDC, whether hospital admission was for CDC, whether hospital admission was to an unmonitored setting versus an intensive care unit (ICU), and whether inpatients required transfer to the ICU after initial admission for the treatment of CDC. Whether the patient was using proton-pump inhibitors (PPI) prior to their CDC diagnosis was also recorded. Recurrent CDC was defined as two consecutive positive C. difficile stool studies no closer than 21 days apart. Outcomes of interest were the development of at least one episode of RCDC, the number of episodes of RCDC for patients with recurrent infections, and the need for hospital admission during the treatment of any episode of RCDC. Chi-squared tests, t tests, analysis of variance (ANOVA), and logistic and linear regression were used to evaluate the relationship between bacterial and patient factors and outcomes of interest.

Results Summary information is provided for study subjects in Table 3, stratified based on those patients who did and did not experience RCDC. A total of 69 non-duplicate isolates

Episode

Severity

Clinical definition

Initial

Mild or moderate Severe Severe (complicated) Same as above Same as above

WBC 0.05) between patients with and without RCDC based on age, gender, ethnicity, or CCS. Based on IDSA classification for severity of CDI, those patients experiencing at least one recurrence of CDC had a higher proportion of patients with severe and severe (complicated) CDC compared to patients without RCDC, though these differences were not statistically significant. There was no difference (p00.12) in the incidence of PPI therapy between patients with and without recurrences. Patients who did not experience RCDC had a higher incidence of systemic hypertension (p00.03) and diabetes (p00.04) while having a lower incidence of coronary artery disease (p00.04) compared to patients with RCDC. Of the 69 study patients, 48 (70 %) received inpatient care during their first episode of CDC. Of these 48 patients, 20 (42 %) Table 4 Bacterial virulence factors and correlation with recurrent C. difficile colitis

RCDC (n028)

Virulence factor

Toxin A Toxin B Binary toxin gene (CDT) tcdC mutation Ribotype 027

Incidence within study population (n069) 61 66 42 39 26

(88 (96 (61 (56 (38

%) %) %) %) %)

Association with recurrence (p value)

Association with need for admission for first CDC episode (p value)

Association with admission for RCDC (p value)

0.56 0.73 0.02 0.18 0.32

0.92 0.96 0.04 0.07 0.13

0.78 0.60 0.02 0.04 0.02

122 Table 5 Analysis of variance comparing the choice of antibiotics during the index episode of CDC (p00.23)


Antibiotic regimen during index CDC episode

Oral metronidazole Oral metronidazole with non-CDC antibiotics Intravenous metronidazole Oral vancomycin Oral or intravenous metronidazole with oral vancomycin Oral vancomycin with non-CDC antibiotics

Table 4 presents the results of a univariate analysis of bacterial virulence factors correlated with the occurrence of at least one episode of RCDC. The majority of C. difficile isolates harbored at least one virulence factor, with 63 % harboring at least two virulence factors and with 48 % having three or more virulence traits. Out of all bacterial virulence factors, only the presence of the binary toxin gene (CDT) predicted a recurrent episode of CDC (p00.02). Neither ribotype 027 (p00.32), mutations of the tcdC gene (p00.18) nor the presence of genes for toxins A (p00.56) and B (p00.73) was associated with RCDC. The presence of the CDT gene (p00.04) was the only bacterial virulence factor associated with hospital admission for CDC treatment during the index episode of CDC. The presence of the CDT gene was found in 100 % of the PCR ribotype 027 strains (n026) as well as in 100 % of the PCR ribotype 078 strains (n07), being absent in ribotypes 001 (n03), 014 (n01), 017 (n 01), and in several previously unreported strains (HMC 11–17). A total of 28/69 (40 %) patients developed at least one episode of RCDC. Among the RCDC patient group, the mean number of recurrences was 2.0±1.8 (range, 1–6). Of these RCDC patients, the presence of the CDT gene (p0 0.02) and the presence of a tcdC mutation (p00.04) or PCR ribotype 027 (p00.02) were each associated with need for admission to the hospital specifically for the treatment of RCDC. Based on multivariable logistic regression, the combination of tcdA and tcdB with the presence of the binary toxin gene resulted in a higher odds of RCDC (odds ratio (OR), 3.1; 95 % confidence interval (CI), 2.97–3.33), with a mean number of RCDC episodes of 1.4±1.2. The combination of a tcdC mutation with the presence of the binary toxin gene resulted in the highest odds of RCDC (OR, 5.3; 95 % CI, 3.52–6.09) and was associated with the highest mean number of recurrent episodes of infection (mean, 2.7±0.6). Among the entire study population, the mean MIC for vancomycin was 0.65±0.75 μgmL−1 while the mean MIC for metronidazole was 0.2 ± 0.2 μg mL−1. There was no difference in MICs between those with RCDC and those without recurrent infection (vancomycin: p0

CDC without recurrence (n041)

Patients who developed RCDC (n028)

22 (54 %)

16 (57 %)

5 (12 %) 9 (22 %) 3 (7 %) 1 (2.5 %)

4 (14 %) 3 (11 %) 4 (14 %) 1 (3.5 %)

1 (2.5 %)

0

0.87; metronidazole: p00.94) nor was there a difference in MICs for patients treated as inpatients (p00.99) and outpatients (p00.53) for their index episode of CDC. Based on ANOVA, there was no statistically significant difference (p00.23) in the use metronidazole, vancomycin, or the use of dual-agent therapy with both antibiotics between the RCDC and no RCDC groups (Table 5).

Discussion Binary toxin was only recently discovered, being first described by Popoff in a 1988 description of a female patient with CDC.17 Further interest in the toxin has only developed in the past several years, and due to this latent attention, there is a smaller body of literature describing the structure, biology, and function of this toxin. While toxins A and B are members of a toxin family known as the large clostridial toxins,18 which collectively have a molecular mass of 250 to 308 kDa and which are encoded by genes within the pathogenicity locus (PaLoc),19 CDT is encoded by a region remote to the PaLoc and is a member of the iota-like subclass of the clostridial binary toxin family.20 Unlike toxins A and B, whose mechanism of action involves transferring a glucose moiety from UDP-glucose to a family of small GTPases such as Rho, Rac, and CDC42,21 binary toxin acts as an actin-ADP-ribosylating toxin, transferring an ADP moiety from NADP/NADPH to G-actin, thus preventing its normal polymerization into F-actin which leads to the disruption of the cytoskeleton, cellular dehydration, and cell death.22,23 CDT consists of two components, CDTa and CDTb, the former being an enzymatically active unit and the latter being an inert transporter that aids the active component in crossing the cellular membrane.24 There has been no scientific inquiry as to how binary toxin might promote recurrent disease, as the association between CDT and recurrence is a novel concept. There are several previously described characteristics attributed to CDT which, due to a paucity of clinically oriented research with this toxin, are not firmly established


as typical for CDT and which are challenged by the present study. While it is often cited that the prevalence of the CDT gene ranges between 6 and 12.5 %25,26 in the present study, the prevalence was much higher, being identified in 61 % of isolates. It is possible that there are regional variations in the prevalence of both ribotype and toxinotype among C. difficile isolates, and if this was the case, then accurate measurement of the prevalence of virulence factors would require a multi-institutional effort with geographically diverse sources of bacteria to provide an accurate assessment. The same phenomenon would also apply regarding the preponderance of ribotype 027, frequently referenced as the “hypervirulent” form of C. difficile. While previous reports3,4 have described this type of C. difficile as an epidemical strain, suggesting that its emergence in an institution precedes outbreaks of particularly fulminant forms of infection, in the present study, 38 % of the isolates were of this ribotype. It is noteworthy that none of the 027 patients in this study required colectomy or died from CDC and that this ribotype was not a univariate predictor of recurrent infection. This suggests that, in some institutions, ostensibly notorious ribotypes such as 027 are actually quite common causes of CDC as opposed to representing a periodically encountered variant and that disease behavior may not be accurately, mechanistically viewed from the sole vantage point of allegedly epidemical ribotypes. Other studies have reached similar conclusions, where predicting virulence has not been successful with such factors as tcdC mutations or ribotype.27 The fact that, in the present study, the so-called virulence factors were not associated with fulminant colitis would suggest that their mere presence is perhaps necessary but not sufficient to produce severe forms of CDC. Though previously published data on CDC have often considered recurrence to be characteristic of virulent infections, surgeons may wish to distinguish between virulence, defined as severe forms of colitis, and recurrence as reflecting an infection that is difficult to eradicate. This difference in parlance is important to recognize in order to avoid ambiguities between the surgical, infectious disease and molecular biological literature on CDC. Much concern has recently been expressed regarding the possible etiologic role of PPI therapy in the development of CDC.28 Though the provocating effect of PPI therapy toward development of CDC has not been a universal observation,29 the issue of whether PPIs promote recurrent CDC is even less clear. A recent case-control study by Kim and colleagues identified PPI therapy as the only clinical factor associated with RCDC, without providing any information regarding bacterial toxin typing or genetic factors.30 In contradistinction, the present study demonstrated no significant difference in rates of RCDC based on the presence of PPI therapy. Though it is commonly assumed that acid suppression is the principal manner through which this class

123

of medications promotes CDC,31 there is almost no information available regarding the direct effect that PPIs may have on either the colon or C. difficile. This is in keeping with the burgeoning yet seminal area of current interest in C. difficile research focused on identifying those environmental factors affecting bacterial behavior within the large intestine. As an example of the importance of environmental cues on the behavior of C. difficile, preliminary evidence32 has suggested that antibiotics may have direct effects promoting growth and the production of toxins in C. difficile apart from disturbances to the microbiome caused by these antibiotics. Further research on the effects of PPIs, antibiotics, and other medications on the colon, commensal bacteria and C. difficile is necessary to understand the risks these medications may pose.

Conclusion The presence of the binary toxin gene in C. difficile is an independent predictor of recurrent CDI, which is a finding that has not been previously reported. The combination of the binary toxin gene and mutations in the tcdC gene is associated with 430 % higher odds of recurrent CDI. C. difficile isolates which produce binary toxin may require longer antibiotic regimens in an effort to lower already elevated recurrence rates within the general CDC patient population.

References 1. Bartlett JG, Perl TM. The new Clostridium difficile—what does it mean? N Engl J Med 2008;353(23):2503-05. 2. Dallal RM, Harbrecht BG, Boujoukas AJ, et al. Fulminant Clostridium difficile: an underappreciated and increasing cause of death and complications. Ann Surg 2002;235(3):363-372. 3. Pepin J, Valiquette L, Alary ME, et al. Clostridium difficile-associated diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of disease severity. CMAJ 2004;171(5):466-472. 4. Warny M, Pepin J, Fang A, et al. Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe. Lancet 2005;366:1079-84. 5. McDonald LC, Killgore GE, Thompson A, et al. An epidemic, toxin gene-variant strain of Clostridium difficile. N Engl J Med 2005;353:2433-41. 6. McFarland LV, Surawicz CM, Rubin M, et al. Recurrent Clostridium difficile disease: epidemiology and clinical characteristics. Infect Control Hosp Epidemiol 1999;20:43-50. 7. McFarland LV, Elmer GW, Surawicz CM. Breaking the cycle: treatment strategies for 163 cases of recurrent Clostridium difficile disease. Am J Gastroenterol 2002;97(7):1699-75. 8. McFarland LV, Surawicz CM, Rubin M, Fekety R, et al. Recurrent Clostridium difficile disease: epidemiology and clinical characteristics. Infect Control Hosp Epidemiol 1999;43-50. 9. Jabbar U, Leischner J, Kasper D, Gerber R, et al. Effectiveness of alcohol-based hand rubs for removal of Clostridium difficile spores from hands. Infect Control Hosp Epidemol 2010;31(6):565-70.

124 10. Stevens V, Dumyati G, Fine LS, Fisher SG, van Wijngaarden E. Cumulative antibiotic exposures over time and the risk of Clostridium difficile infection. Clin Infect Dis 2011;53(1):42-8. 11. FDA U.S. Food and Drug Administration. Accessed on 4/2/2012; http://www.fda.gov/Safety/MedWatch/SafetyInformation/ SafetyAlertsforHumanMedicalProducts/ucm290838.htm 12. Rupnik M, Avesani V, Janc M, von Eichel-Streiber C, Delmée M. A novel toxinotyping scheme and correlation of toxinotypes with serogroups of Clostridium difficile isolates. J Clin Microbiol 1998;36(8):2240-7. 13. Stubbs SL, Brazier JS, O’Neill GL, Duerden BI. PCR targeted to the 16S-23S rRNA gene intergenic spacer region of Clostridium difficile and construction of a library consisting of 116 different PCR ribotypes. J Clin Microbiol 1999;37:461-63. 14. Spigaglia P, Mastrantonio P. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 2002;40(9):3470-5. 15. Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method of classifying prognostic comorbidity in longitudinal studies: development and validation. J Chronic Dis 1987;40:373-83. 16. Cohen SH, Gerding DN, Johnson S, et al. Clinical practice guidelines for Clostridium difficile infection in adults: 2010 update by the Society for Healthcare Epidemiology of America (SHEA) and the Infectious Diseases Society of America (IDSA). Infect Control Hosp Epidemiol 2010;31:431-55. 17. Popoff MR, Rubin E, Gill DM, Boquet P. Actin-specific ADPribosyltransferase produced by a Clostridium difficile strain. Infect Immun 1988;56:2299-306. 18. Thelestram M, Chaves-Olarte E. Cytotoxic effects of the Clostridium difficile toxins. Cur Top Microbiol Immunol 2000;250:85-96. 19. Rupnik M, Grabnar M, Geric B. Binary toxin producing Clostridium difficile strains. Anaerobe 2003;9:289-294. 20. Barth H, Aktories K, Popoff MR, Stiles BG, et al. Binary bacterial toxins: biochemistry, biology, and applications of common Clostridium and Bacillus mechanism of ADP ribosylating toxins. FEBS J 2006;273:4579-4593. 21. Sundriyal A, Roberts AK, Ling R, McGlashan J, et al. Expression, purification and cell cytotoxicity of actin-modifying binary toxin from Clostridium difficile. Protein Expr Purif 2010;74:42-48. 22. Vandekerckhove J, Schering B, Barmann M, et al. Clostridium perfringens iota toxin ADP ribosylates skeletal muscle actin in Arg-177. FEBS Lett 1987(225):48-52. 23. Reuner KH, Presek P, Boschek CB, et al. Botulinum C2 toxin ADP-ribosylates actin and disorganizes the microfilament network in intact cells. Eur J Cell Biol 1987;43:134-140. 24. Davies AH, Roberts AK, Shone CC, Acharya KR. Super toxins from a super bug: structure and function of Clostridium difficile toxins. Biochem KJ 2011;436:517-526. 25. Geric B, Johnson S, Gerding DN, Grabnar M et al. Frequency of binary toxin genes among Clostridium difficile strains that do not produce large clostridial toxins. J Clin Microbiol 2003;41:5227-32. 26. Stubbs S, Rupnik M, Gilbert M, Brazier J, et al. Production of actin specific ADP-ribosyltransferase (binary toxin) by strains of Clostridium difficile. FEMS Microbiol Lett 2000;186:307-312. 27. Goldenberg AD, French GL. Lack of association of tcdC type and binary toxin status with disease severity and outcome in toxigenic Clostridium difficile. J Infect 2011;62(5):355-362. 28. McCarthy DM. Adverse effects of proton pump inhibitor drugs: clues and conclusions. Curr Opin Gastroenterol 2010;26:624-631. 29. Naggie S, Miller BA, Zuzak KB, et al. A case-control study of community-associated Clostridium difficile infection: no role for proton pump inhibitors. Am J Med 2011;124(3):276.e1-276.e7.

J Gastrointest Surg (2013) 17:118–125 30. Kim YG, Graham DY, Jang BI. Proton pump inhibitor use and recurrent Clostridium difficile-associated disease. J Clin Gastroenterol 2012;46(5):397-400. 31. Dial S, Delaney JA, Barkun AN, et al. Use of gastric acidsuppressive agents and the risk of community-acquired Clostridium difficile-associated disease. JAMA 2005;294:298995. 32. Dupuy B, Govind R, Antunes A, Matamouros S. Clostridium difficile toxin synthesis is negatively regulated by TcdC. J Med Microbiol 2008;57:685-689.

Discussant Dr. Sekar Dharmarajan (St. Louis, MO): Thank you Mr. Chairman. While the surgical literature is replete with studies that correlate clinical patient factors with morbidity, need for surgery, and mortality from C. difficile infection, Dr. Stewart and colleagues have taken the novel and thought-provoking approach of characterizing bacterial virulence factors and correlating these with morbidity from C. difficile in the form of recurrent infection. I have three broad areas of comments/ questions. The first surrounds the definition of recurrent C. difficile colitis. The authors define recurrent C. difficile infection as two consecutive positive C. difficile stool samples no closer than 21 days apart. Without a negative intervening sample, how do we know this is recurrent C. difficile infection as opposed to persistent C. difficile infection, as we know that C. difficile is notoriously difficult to eradicate? Specifically, do you have any data on how far apart temporally the positive stool samples were in the patients with recurrent C. difficile? More interestingly, do you have any data on the bacteriology of the recurrent C. difficile isolates to see how they are compared to the original isolate? The second area is with regard to the broader generalizability or applicability of the study. As the authors state in their manuscript, the prevalence of the binary toxin gene in this study was five- to tenfold higher than that previously reported in the literature. Similarly, ribotype 027, which has been found in previous studies to be hypervirulent, was not associated with any morbidity or mortality in the present study. Is it possible that, while binary toxin is the key to predicting recurrent infection at Hershey, these factors may differ institution to institution? Finally, the last area is with regard to patient or host factors that certainly must contribute to morbidity and mortality from C. difficile infection. While the present study found no clinical factors that predicted recurrent infection, I wonder if the authors have plans or could comment on studying the interaction of patient genotypes at genetic loci that may render susceptibility to infection with bacterial virulence factors on morbidity from C. difficile. Similarly, as the authors comment in their manuscript, the host microbiome has become an increasingly important area of research in determining outcomes from a variety of disease processes, and I wonder if the authors had any comment on their plans to study this. Thank you for the opportunity to review your extremely wellwritten manuscript. Selection Bias: There is no patient with fulminant C. difficile colitis as defined by need for surgery or death.

Closing Discussant Dr. David B. Stewart: I would like to thank the SSAT for the opportunity to present our research, and I would also like to express my gratitude to Dr. Dharmarajan for being willing to serve as a discussant for our presentation.

J Gastrointest Surg (2013) 17:118–125 Dr. Dharmarajan’s first point is perhaps the most critical issue which he raised as a discussant. There are no consensus-based definitions, for all research endeavors on the topic, which define recurrent C. difficile colitis (RCDC) in any scientifically meaningful manner. This lack of standardization would potentially allow for an inflated estimate of RCDC, if the time interval between two consecutive CDC episodes was diminished to a great enough degree. In fact, in reviewing the literature which deals with recurrent C. difficile, the reader will encounter both heterogeneity in the definition of recurrence as well as a degree of arbitrariness which includes extremely short time intervals (