Presence and fate of coliphages and enteric viruses

Presence and fate of coliphages and enteric viruses in three wastewater treatment plants effluents and activated sludge from Tunisia Sihem Jebri, Juan Jofre, Insaf Barkallah, Mouldi Saidi & Fatma Hmaied

Environmental Science and Pollution Research ISSN 0944-1344 Volume 19 Number 6 Environ Sci Pollut Res (2012) 19:2195-2201 DOI 10.1007/s11356-011-0722-y

1 23

Your article is protected by copyright and all rights are held exclusively by SpringerVerlag. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your work, please use the accepted author’s version for posting to your own website or your institution’s repository. You may further deposit the accepted author’s version on a funder’s repository at a funder’s request, provided it is not made publicly available until 12 months after publication.

1 23

Author's personal copy Environ Sci Pollut Res (2012) 19:2195–2201 DOI 10.1007/s11356-011-0722-y

RESEARCH ARTICLE

Presence and fate of coliphages and enteric viruses in three wastewater treatment plants effluents and activated sludge from Tunisia Sihem Jebri & Juan Jofre & Insaf Barkallah & Mouldi Saidi & Fatma Hmaied

Received: 27 October 2011 / Accepted: 25 December 2011 / Published online: 20 January 2012 # Springer-Verlag 2012

Abstract Purpose The role of water in the transmission of infectious diseases is well defined; it may act as a reservoir of different types of pathogens. Enteric viruses can survive and persist for a long time in water, maintaining infectivity in many instances. This suggests the need to include virus detection in the evaluation of the microbiological quality of waters. Methods In this study, enteric viruses (enteroviruses and hepatitis A virus (HAV)) were investigated by RT-PCR and coliphages (known as indicators of viral contamination) were enumerated with the double-layer technique agar in effluents and sewage sludge from three Tunisian wastewater treatment plants. Results and discussion The molecular detection of enteric viruses revealed 7.7% of positive activated sludge samples for enteroviruses. None of the samples was positive for HAV. Molecular virus detection threshold was estimated to be 103 PFU/100 ml. All samples contained high concentrations of coliphages except those of dry sludge. Reductions in the concentrations of bacteriophages attained by the Responsible editor: Philippe Garrigues S. Jebri : I. Barkallah : M. Saidi : F. Hmaied Unité de Microbiologie et de Biologie Moléculaire, CNSTN, Technopôle de Sidi Thabet, 2020 Sidi Thabet, Tunisia J. Jofre Department of Microbiology, Barcelona University, Diagonal 645, 08028 Barcelona, Spain F. Hmaied (*) Laboratoire de Microbiologie et Biologie Moléculaire, CNSTN, Pôle technologique, 2020 Sidi Thabet, Tunisia e-mail: [email protected]

wastewater treatment plants are of the order of magnitude as reductions described elsewhere. Peak concentrations in raw wastewater were associated with winter rains and suspended materials rate in analysed samples. Our data which is the first in North Africa showed that similar trends of coliphages distribution to other studies in other countries. Conclusion No clear correlation between studied enteric viruses and coliphages concentration was proved. Coliphages abundance in collected samples should raise concerns about human enteric viruses transmission as these residues are reused in agricultural fields. Keywords Total coliphages . Enteroviruses . Hepatitis A virus . Wastewater . Sludge . Tunisia

1 Introduction Water reuse in Mediterranean countries became a common strategy to palliate lack of water resources used especially in agriculture. Wastewater treatment plants residues contain a large amount of microorganisms that are pathogenic for humans (viruses, bacteria and parasites). Tunisia is an endemic area for hepatitis A virus and enteric viruses causing gastroenteritis; 58% of 15-years-old children in 1999 in Tunis and 60% of school children 5 to 20 years of age in 2005 in Sousse were positive for anti-hepatitis A virus (HAV) IgG (Gharbi-Khelifi et al. 2006), but primary infection with HAV in Tunisia is progressively shifting to older ages, which is probably due to the improvement of sanitary conditions (Rezig et al. 2008). From 2003 to 2005, 43.7% of samples collected from Tunisian children with acute diarrhoea were enteric viruses positive (Sdiri-Louizi et al. 2008). These studies and other ones raise concerns about contamination of agricultural products and ground water in the district of Tunis as no

Author's personal copy 2196

rigorous survey of viral quality of wastewater treatment plant (WWTP) reused residues like treated water and activated sludge had been attempted before. In fact, the quality of treated water and activated sludge is monitored by searching for and quantifying only bacterial indicators of faecal contamination. On the other, the application of bacteriophages as tracers for enteric viruses presence in water due to their viral nature and their similar size and structure to pathogenic viruses has been extensively investigated and reviewed (IAWPRC 1991; Grabow 2001; Lucena and Jofre 2010; Havelaar 1987). Also, bacteriophages had been included recently in some water quality regulations in USA (USEPA 2006) Canada (Anonymous 2001) and Australia (Queensland Government 2005). Somatic coliphages (IAWPRC 1991), F-specific RNA bacteriophages (IAWPRC 1991) and bacteriophages infecting Bacteroides (IAWPRC 1991) are the groups of bacteriophages proposed and thoroughly investigated as surrogate indicators of viruses in water. Moreover, for some purposes as for example for following virus removal in water treatments, some authors have suggested the suitability of the total coliphages group (Harwood et al. 2005; Costán-Longares et al. 2008). Their numbers are either the addition of the numbers of somatic and F-specific counted by the standardised methods (ISO 1995, 2000 and USEPA 2000) or by counting phages with strains such as C5000 (Harwood et al. 2005) or CB390 (Guzmán et al. 2008). To the best of our knowledge, no data are available either in Tunisia or in North Africa on the prevalence of the groups of bacteriophages frequently used as viral indicators. The aim of this study was to evaluate the viral contamination of three WWTP residues in Tunis, and studying the parallel between fates of bacteriophages and viral contamination.

2 Materials and methods 2.1 Wastewater treatment plants Samples from three municipal WWTP in the North of Tunis were tested periodically from January to August 2009. Treatment is based on activated sludge process in all plants. The WWTP1 is a low-charge plant; its influents are a mix of domestic sewage and industrial wastes; and sludge is treated in situ by heat desiccation, then it is spread in beds at ambient temperature for further agricultural reuse in nearby lands. The WWTP2 is a medium-charge plant, the origin of its treated influents is domestic, sludge is treated ex situ in another treatment plant, and effluents are released in the river that irrigates surrounding fields. The third WWTP3 is associated to a slaughterhouse; effluents are released in the general system of sewage collection.

Environ Sci Pollut Res (2012) 19:2195–2201

2.2 Sampling procedure Samples of raw water, treated water and activated sludge were collected from the three plants. Those of dry sludge for agricultural amendment were collected from the WWTP1. They were taken in sterilized sampling bottles and transported to the laboratory within 2 h; analyses were performed within 24 h. Precautions were taken to ensure that sampling procedure did not have carryover contamination from sample to sample. Chemical oxygen demand, biological oxygen demand and pH effluents measures were done by laboratories of WWTP1 and WWTP2. Forty-eight samples were collected from January to August 2009. Suspended solids concentration was measured by filtration (Whatman 934 AH filters). 2.3 Bacteriophages detection and counting Phages were extracted from sludge samples using the beef extract elution technique described by Guzmán et al. (2007). Double-layer agar technique was used to detect and enumerate bacteriophages. ΦX174 was enumerated according to ISO10705-2 (ISO 2000) and MS2 according to ISO 10705-1 (ISO 1995). Total coliphages were enumerated on host strain CB390 (Guzmán et al. 2008) with the media prescribed in recommended in ISO10705-1 standard. Positive controls were ΦX174 and MS2 reference phages. Results are expressed in plaque-forming units (PFU)/100 ml. 2.4 Viruses detection 2.4.1 Viruses extraction Recovery of viral particles was performed as described by the USEPA protocol. Briefly, 0.05 M AlCl3 was added to 100 ml of well-mixed samples to a final concentration 0.0005 M. pH was adjusted to 3.5. After centrifugation, pellet was suspended in 100 ml of buffered (pH 8) 10% beef extract (LP029B; Oxoid). Polyethylene glycol precipitation were performed as described by Lewis and Metcalf (1988) by adding 50% (w/v phosphate solution pH 7.2) polyethylene glycol (PEG 6000; Sigma) to the resuspended pellet. After rigorous agitation, the mixture was kept at 4°C overnight and then centrifuged at 8,000×g for 90 min at 4°C. The pellet, suspended in 5 ml of phosphate buffer (pH 7.2) was finally decontaminated by filtration through 0.22-μm nitrocellulose filters. 2.4.2 RNA extraction Viral RNA was extracted from 1 ml of viral suspension by using (Tri-reagent; Sigma) then suspended in 60 ml of double distilled water.

Author's personal copy Environ Sci Pollut Res (2012) 19:2195–2201

2197

2.4.3 RT-PCR amplification

2.7 Data analysis

For HAV, reverse transcription was carried out in a volume of 25 μl including 10 μl of RNA, 0.1 mM of dNTP (Invitrogen), 50 U of MMLV (Invitrogen), 25 pmol of reverse primer HAV2 (5′-GGAAATGTCTCAGGTACTTTCTTTGC TAAAACTGGATCC-3′) (Cohen et al. 1987; Arnal et al. 1998), 10 U of RNaseOUT (Invitrogen) and 5× buffer (Invitrogen). The mixture was incubated for 45 min at 42°C. PCR was carried out using 5 μl of cDNA. The PCR mixture, contained 1 U of Taq DNA polymerase (Go Taq, Promega), 0.2 mM of dNTP (Invitrogen), 2 mM of MgCl2, 1 μmol of each primer; forward primer HAV1 (5′GTTTGCTCCTCTTTATCATGCTATGGATGTTACTA CAC-3′) and HAV2 (Cohen et al. 1987; Arnal et al. 1998) and 5× buffer (Invitrogen). The mix was subjected to 30 cycles; 30 s at 94°C, 90 s at 55°C and 90 s at 72°C. A final extension was carried out at 72°C for 5 min. For enteroviruses (EV), reverse transcription was performed with 20 μl of a mixture containing 10 μl of viral RNA, 0.2 mM of dNTP (Invitrogen), 50 U of Moloney Murine Leukaemia Virus (MMLV, Invitrogen), 40 pmol of reverse primer 007 (5′-ATTGTCACCATAAGCAGCCA-3′) (Lizuka et al. 1987; Zoll et al. 1992), 10 U of RNase Out (Invitrogen), and 5× buffer (Invitrogen). The mixture was incubated for 30 min at 42°C. PCR amplification was performed in a mixture containing: 1.25 U of Taq DNA polymerase (Go Taq, Promega), 0.2 mM of dNTP (Invitrogen), 2 mM of MgCl2, 40 pmol of each primer; forward primer 006 (5′-TCCTCCGGCCCCTGAATGCG3′) and 007 (Lizuka et al. 1987; Zoll et al. 1992), 5× reaction buffer (Invitrogen) and 2 μl of cDNA. Cycling conditions consisted of 30 cycles of 94°C for 30 s, 42°C for 1 min and 72°C for 2 min. A final extension was carried out at 72°C for 10 min.

Data treatment and statistical analyses were carried out by using the Statgraphics statistical analysis software package (Statgraphics Plus 5.1; StatPoint, Inc.).

2.5 Detection of amplified products Amplified products (6 μl) were visualized by electrophoresis on a 2% agarose gel in Tris–Borate–EDTA buffer followed by staining with ethidium bromide. 2.6 RT-PCR reaction threshold An artificial contamination of 100 ml wastewater samples sterilized by autoclaving, to keep the environmental matrix and inhibitors, was carried out to determine the detection limit of reverse transcription polymerase chain reaction (RT-PCR). Serial dilutions of 106, 105, 104, 103, 102, 101 PFU/100 ml of Echovirus 13 and HAV (HM-175) were carried out. Viral and genome extraction, RT-PCR and electrophoresis were performed as described above.

3 Results and discussion 3.1 Bacteriophages in wastewater treatment plants residues In a preliminary investigation to determine the method for counting total coliphages with strain CB390, the number of phages ΦX174 and MS2 recovered by TGYB, TGYA and ssTGYA, (ISO1995) was slightly higher than those recovered by MSB, MSA and ssMSA, (ISO 2000; Fig. 1). Even when differences were not significant (ANOVA, P>0.05) the media recommended in ISO 10705-1 gave higher values. Therefore the media used to follow count coliphages in this research were TGYB, TGYA and ssTGYA. Physico-chemical parameters measured on effluents were in compliance with Tunisian Standards for effluents discharge in environmental waters (NT. 106.002; 1989); BOD5 values were ranging from 11 mg O2/ l to 20 mg O2/l, COD values were ranging from 28 mg O2/l to 72 mg O2/l, pH varied from 7.62 to 7.93. All samples contained high amounts of coliphages except those of dry sludge. The values of coliphages in raw sewage (influents to the WWTP) ranged from 5.0 to 7.4 log10 PFU/ 100 ml and averaged (geometric mean) between 6.3 log10 PFU/100 ml for WWTP1 to 5.6 log10 PFU/100 ml for WWTP2 (Fig. 2). These values are comparable to those reported for raw municipal sewage (Contreras-Coll et al. 2002; Mandilara et al. 2006; Blanch et al. 2006) and slaughterhouse wastewater (Blanch et al. 2006) in the Northern side of the Mediterranean. Peak concentration (7.4 log10 PFU/100 ml) was registered in January that corresponds to the winter storm season in Tunis. Increase in numbers during rainy days is probably due to influents transit time in WWTP which became shorter and the resuspension of sediments of the sewers. Similar trends of bacteriophages abundance in relationship to rainy periods were reported by other studies (Skraber et al. 2002). The secondary effluents contained lower bacteriophage concentrations. Average (geometric means) ranged from 3.6 to 4.8 log10 PFU/100 ml for WWTP1 and WWTP2, respectively (Fig. 2). Log10 reductions for the three plants were 1.2, 2.0 and 1.1, respectively. These reductions are coincident, though in the low range, with results reported elsewhere (Mandilara et al. 2006; Lucena et al. 2004; Harwood et al. 2005). For samples collected from the same WWTP, activated sludge contained the higher concentration of bacteriophages (Fig. 2). Average values (geometric means) are of the same order of magnitude that those similar to those



Fig. 1 Recovered bacteriophages by MSA (ISO 10705-2) and TGYA (ISO 10705-1) media

reported elsewhere when the extraction methods used was the same (Guzmán et al. 2007). This concentration of bacteriophages in the sludge is likely due to viruses adsorption to suspended materials in wastewater and their concentration Fig. 2 Coliphage concentrations expressed as geometric means of log10 PFU/100 ml in the WWTP samples

during the treatment process like found elsewhere in other studies (Ohgaki et al. 1986). In our study, a positive correlation (r00.84) was observed between suspended materials rate and bacteriophages concentration in collected influents (Fig. 3).

Author's personal copy Environ Sci Pollut Res (2012) 19:2195–2201

2199

Fig. 3 Suspended solids concentrations and Log-transformed number of bacteriophages in collected influents

Other works showed that viruses in water are often embedded in or otherwise associated with suspended solids which may partially shield virus against disinfectant action (Katratanakul and Ohgaki 1989). Our results showed that reused wastewater in nearby lands of WWTP1 and WWTP2 contained high amounts of bacteriophages considered as faecal and viral contamination indicators; this must raise concerns about effluents treatment in these two WWTP and viral transmission to the population by food. WWTP effluents were in conformity with Tunisian regulations regarding coliforms presence (Salma Helel, personnel communication). However, they still contained large amounts

of coliphages, which are more representative of enteric viruses than coliforms. Sludge treatment process by desiccation seems to be efficient to eliminate faecal microorganisms, since no bacteriophages were detected in 10 g or dried sludge. 3.2 Enteric viruses presence In the present study, we opted for molecular detection of enteric viruses. In fact, in recent years, the PCR method had been used to detect enteric viruses in environmental samples because it's known as one of the most sensitive methods for viral monitoring. Besides, cell culture which is a reference

Fig. 4 Agarose gel (2%) and ethidium bromide staining of RT-PCR products, a EV, b HAV; L DNA ladder 100 pb; 1 negative control; 2 positive control; 3 0 PFU/100 ml; 4, 5, 6, 7, 8, 9 101 to 106 PFU/100 ml


technique can't be applied for all viruses. Results showed that detection threshold for EV and HAV was estimated at 103 PFU/100 ml, lower concentrations were not detectable (Fig. 4). This low detection limit might be due to contents of beef extract used in viral extraction method which are suspected to have some inhibitory effect on PCR detection for virus, especially after reconcentration. Moreover, natural waters contain dissolved compounds such as humic and fulvic acids that may inhibit the PCR (Tsai and Olson 1992). Also, some viruses could be retained by the nitrocellulose filters used to purify the viral suspension before PCR performance. In this study, the frequency of enterovirus contamination using RT-PCR was estimated at 7.7% of activated sludge samples. Sdiri et al. (2006) used the same viral extraction technique and found that 50% of wastewater samples collected in Monastir were positive for enteroviruses by RT-PCR. In the same region, Hassine et al. (2010) found that 35.7% of collected wastewater samples were positive for enteroviruses and 10.8% were HAV positive. HAV were not detected in any of our collected samples. Since the RT-PCR method used in this investigation detects only viral concentrations higher than 103 PFU/100 ml, this assay cannot provide precise information about lower concentrations in collected samples. Others studies found a HAV contamination in the final effluent from wastewater treatment plants in the Mediterranean using RTPCR, demonstrating a potential source for seafood contamination (Divizia et al. 1998). In another study, Gantzer et al. (1998), tested three types of treated wastewater for coliphages and enteroviruses presence, they found that the percentages of samples testing positive for the enterovirus genome were ranging between 100% and 56%. They reported also that there was a significant correlation between the concentration of somatic coliphages and the presence of the enterovirus genome by RT-PCR and infectious enteroviruses detected by cell culture. Some of other more sensitive methods (such as real time PCR) required the use of equipment not available for us. In this study, no correlation between total coliphages presence and enteric viruses contamination was established. The very high numbers of zeros found for human viruses frustrates the statistical comparisons of the two sets of data.

4 Conclusion In conclusion, high amounts of total coliphages were detected in collected samples except those of dry sludge. These amounts, which are comparable to amounts described elsewhere, allow following up the wastewater treatment processes in the region. No clear correlation between studied enteric viruses and coliphages concentration was proved, probably because of the very low number of samples in which viruses were detected. In fact, molecular detection of EV and HAV by


classic RT-PCR seems not suitable for environmental water since it contains numerous inhibitors, except if precautions are taken to optimize the procedure to circumvent the inhibitory effect of the environmental matrix and to recover suspended material-adsorbed viruses. Acknowledgements This research was supported by Centre National des Sciences et Technologies Nucléaires, thanks to the “Office National de l’Assainissement and to Habib HANDOURA”.

References Anonymous (2001) Loi sur la qualité de l'environnement: règlement sur la qualité de l'eau potable c. Q-2, r.18.1.1. Gazette Officielle du Québec 24:3561 Arnal C, Grance JM, Gantzer G, Schwartzbrod L, Deloice R, Billaudel S (1998) Persistence of infectious hepatitis A virus and its genome in artificial seawater. Zentralblatt fur Hygiene und Umweltmedizin 201:279–284 Blanch A, Belanche-Muñoz L, Bonjoch X, Ebdon J, Gantzer C, Lucena F, Ottoson J, Kourtis C, Iversen A, Kühn I, Mocé L, Muniesa M, Schwartzbrod J, Skraber S, Papageorgiou GT, Taylor H, Wallis J, Jofre J (2006) Integrated analysis of established and novel microbial and chemical methods for microbial source tyracking. Appl Environ Microbiol 72:5915–5926 Cohen J, Ticehurst J, Purcell R, Buckler-White A, Baroudy B (1987) Complete nucleotide sequence of wild-type hepatitis A virus: comparison with different strains of hepatitis A virus and other picornaviruses. J Virol 61(1):50–59 Contreras-Coll N, Lucena F, Mooijman K, Havelaar A, Pierzo V, Boqué M, Gawler A, Höller C, Lambiri M, Mirolo G, Moreno B, Niemi M, Sommer R, Valentin B, Wiedenmann A, Young V, Jofre J (2002) Occurrence and levels of indicator bacteriophages in bathing waters through Europe. Water Res 36:4963–4974 Costán-Longares A, Montemayor M, Payán A, Mendez J, Jofre J, Mujeriego R, Lucena F (2008) Microbial indicators and pathogens: removal, relatioships and predictive capabilities in water reclamation facilities. Water Res 42:4439–4448 Divizia M, Ruscio V, Degener AM, Pana A (1998) Hepatitis A virus detection in wastewater by PCR and hybridization. New Microbiol 21:161–167 Gantzer C, Maul A, Audic JM, Schwartzbrod L (1998) Detection of infectious enteroviruses, enterovirus genomes, somatic coliphages, and Bacteroides fragilis phages in treated wastewater. Appl Environ Microbiol 64(11):4307–4312 Gharbi-Khelifi H, Ferre V, Sdiri K, Berthome M, Fki L, Harrath R, Billaudel S, Aouni M (2006) Hepatitis A in Tunisia: phylogenetic analysis of hepatitis A virus from 2001 to 2004. J Virol Methods 138(1-2):109–116 Queensland Government (2005) Water recycling guidelines. Queensland State EPA, Brisbane Grabow WOK (2001) Bacteriophages: update on application as models for viruses in water. Water SA 27:251–268 Guzmán C, Jofre J, Blanch AR, Lucena F (2007) Development of a feasible method to extract somatic coliphages from sludge, soil and treated biowaste. J Virol Methods 144:41–48 Guzmán C, Mocé-Llivina L, Lucena F, Jofre J (2008) Evaluation of Escherichia coli host strain CB390 for simultaneous detection of somatic and F-specific coliphages. Appl Environ Microbiol 74 (2):531–534 Harwood VJ, Levine AD, Scott TM, Chivukula V, Lukasik J, Farrah SR, Rose JB (2005) Validity of the indicator organism paradigm

Author's personal copy Environ Sci Pollut Res (2012) 19:2195–2201 for pathogen reduction in reclaimed water and public health protection. Appl Environ Microbiol 71:3163–3170 Hassine M, Sdiri K, Riabi S, Beji A, Aouni Z, Aouni M (2010) Detection of enteric viruses in wastewater of Monastir region by RT-PCR method. La Tunisie Médicale 88(2):70–75 Havelaar AH (1987) Bacteriophages as model organisms in water treatment. Microbiol Sci 4:362–364 IAWPRC Study group on health related water microbiology (1991) Bacteriophages as model viruses in water quality control. Water Res 25:529–545 ISO (1995) ISO 10705-1: water quality. Detection and enumeration of bacteriophages. Part 1. Enumeration of F-specific RNA bacteriophages. International Organization for Standardization, Geneva ISO (2000) ISO 10705-2: water quality. Detection and enumeration of bacteriophages. Part 2. Enumeration of somatic coliphages. International Organization for Standardization, Geneva Katratanakul A, Ohgaki S (1989) Indigenous coliphages and RNAFspecific coliphages associated with suspended solids in the activated sludge process. Water Sci Technol 21:73–78 Lewis GD, Metcalf TG (1988) Polyethylene glycol precipitation for recovery of pathogenic viruses, including hepatitis A virus and human rotavirus, from oyster, water, and sediment samples. Appl Environ Microbiol 54(8):1983–1988 Lizuka N, Kuge S, Nomoto A (1987) Complete nucleotide sequence of the genome of coxsakievirus B1. Virology 151:64–73 Lucena F, Jofre J (2010) Potential use of bacteriophages as indicators of water quality and wastewater treatment processes. ASM Press, Washington Lucena F, Duran AE, Morón A, Calderón E, Campos C, Gantzer C, Skraber S, Jofre J (2004) Reduction of bacterial indicators and bacteriophages infecting faecal bacteria in primary and secondary wastewater treatments. J Appl Microbiol 97:1069–1076 Mandilara GD, Smeti EM, Mavridou AT, Lambiri MP, Vatopoulos AC, Rigas FP (2006) Correlation between bacterial indicators and

2201 bacteriophages in sewage and sludge. FEMS Microbiol Lett 263:119–126 Ohgaki S, Ketratanakul A, Suddevgrai S, Prasertsom U, Suthienkul O (1986) Adsorption of coliphages to particles. Water Sci Technol 18:267–275 Rezig D, Ouneissa R, Mhiri L, Mejri S, Haddad-Boubaker S, Ben Alaya N, Triki H (2008) Seroprevalences of hepatitis A and E infections in Tunisia. Pathol Biol 56(3):148–153 Sdiri K, Khelifi H, Belghith K, Aouni M (2006) Comparaison de la culture cellulaire et de la RT–PCR pour la détection des entérovirus dans les eaux usées et les coquillages en Tunisie. Pathol Biol 54(5):280–284 Sdiri-Louizi K, Gharbi-Khélifi H, De Rougemont A, Chouchane S, Sakly N, Ambert-Balay K, Hassine M, Guédiche MN, Aouni M, Pothier P (2008) Acute infantile gastroenteritis associated with human enteric viruses in Tunisia. J Clin Microbiol 46(4):1349– 1355 Skraber S, Gantzer C, Maul A, Schwartzbrod L (2002) Fates of bacteriophages and bacterial indicators in the Moselle river (France). Water Res 36:3629–3637 Tsai YL, Olson BH (1992) Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction. Appl Environ Microbiol 58:2292–2295 USEPA (2000) Method 1602. Male-specific (F+) and somatic coliphage in water by single agar layer procedure. EPA 821.R-00-010. Environmental Protection Agency, Washington USEPA (2006) National Primary Drinking Water Regulations: Ground Water Rule; Final Rule; 40 CFR Parts 9, 141 and 142. Federal Register, Environmental Protection Agency, Washington DC. 71 (216):65574–65660 Zoll G, Melchers W, Kopecka H, Jambroes H, Jambroes G, Poel HV, Galama J (1992) General primer mediated polymerase chain reaction for detection of enteroviruses: application for diagnostic routine and persistent infections. J Clin Microbiol 30:160–165