Carlos Rodriguez$, Kelly A. Brayton$, Michael Brownstein$, and Jack E. Dixon$ll. From the $Department of .... Beckman SW55 Ti rotor. The RNA pellet was ...
THEJOURNAL OF BIOLOGICAL CHEMISTRY
Val. 264, No. 10, Issue of April 5, pp. 5988-5995, 1989 Printed in U.S.A .
Rat PreprocarboxypeptidaseH CLONING, CHARACTERIZATION, AND SEQUENCE OFTHE cDNA AND REGULATION OF THE mRNA BY CORTICOTROPIN-RELEASING FACTOR* (Received for publication, September 27, 1988)
Carlos Rodriguez$, Kelly A. Brayton$, Michael Brownstein$, and Jack E. Dixon$ll From the $Department of Biochemistry, Purdue University, West Lafayette, Indiana 47907 and the §Laboratory of Cell Biology, National Institute of Mental Health, National Institutes of Health, Bethesda, Maryland20892
Carboxypeptidase H is a putative post-translational processing enzyme which removes basic amino acid residues from intermediates during protein hormone biosynthesis. A 2.2-kilobase pair cDNA was shown to contain the complete amino acid sequence of rat carboxypeptidase H. The deduced amino acid sequence revealed that the enzyme was synthesized as preprocarboxypeptidase H, a precursor form of 476 amino acid residues. Preprocarboxypeptidase H contained a putative hydrophobic signal peptide and a short propeptide which contained 5 adjacent Arg residuesat its C terminus. Northern blot analysis identified a single carboxypeptidase H mRNA of -2.3 kilobases in brain, pituitary, and heart, as well as in mouse AtT2O cells. No carboxypeptidase H mRNA was detected in rat liver, spleen, kidney, lung, and mammary gland. Sequence analysis of cDNAs obtained from differentrat tissues suggested that a single mRNA encodes an identical carboxypeptidasein several tissues. Treatment of AtT2O cells with dexamethasone decreased the levels of both carboxypeptidase H and preproopiomelanocortin (POMC) mRNAs byapproximately 30%.Exposure of the dexamethasone-treated cells to corticotropinreleasing factor effected a 2- to 3-fold increase in the carboxypeptidase H and POMC mRNA levels relative to those of dexamethasone-treated cells exposed to control medium. This suggests that the mRNA levels of POMC and one of its putativepost-translational processing enzymes, carboxypeptidase H, are co-regulated by corticotropin-releasingfactorandsteroidhormones.
the peptide. Additional post-translational modifications can occur, including amidation of the C-terminal amino acid residue, sulfation, disulfide bond formation, and others (3,4). The importance of post-translational processing is underscored by noting that a single precursor can encode multiple copies of the same bioactive peptide (e.g. preproenkephalin ( 5 ) )or several biologically distinct peptides (e.g. POMC’ (6)). Therefore, the same protein precursor can give rise to different bioactive peptides depending on the specificity of processing. Little is known about the processing enzymes responsible for the activation of biologically active peptides. Several endogenous trypsin-like endoproteases have been purified or isolated (7-17), but no amino acid composition data nor sequence information have been reported. The only posttranslational processing enzyme involved in peptide hormone biosynthesis whose complete primary structure is known is peptidyl glycine a-amidating monooxygenase. Peptidyl glycine a-amidating monooxygenase, which is synthesized as a preproprecursor (18), effects the oc-amidation of the C terminus of bioactive peptides (19, 20). Amidation is required for the biological activity of several bioactive peptides, including neuropeptide Y, vasopressin, gastrin, and CRF(3). Carboxypeptidase H,2 also previously named “enkephalin convertase” (21) or “carboxypeptidase E” (22), is thought to be responsible for the in uiuo removal of basic amino acid residues from the C terminus of many partially processed peptide hormone precursors (21,23,24). Carboxypeptidase H activity has been identified in rat brain (21, 25) and in secretory granules from the three lobes of rat pituitary (24). These localization data have been interpreted to suggest that the enzyme is involved in the processing of proenkephalin, Most polypeptide hormones are synthesized as inactive POMC, and provasopressin, among other peptides. The enprotein precursors which require post-translational processing zyme has been purified to homogeneity from bovine brain, for biological activity. Post-translational processing events pituitary, and adrenal chromaffin granules (21, 26) and also consist of several different specific enzymatic modifications from insulin secretory granules of a rat insulinoma (23), where (1-4). Following the removal of the signal sequence, which it is thought to be involved in proinsulin processing. Carboxdirects the precursor into theendoplasmic reticulum, a “tryp- ypeptidase H, from both bovine and rat tissues, is a zinc sin-like endoprotease” cleaves at pairs of basic amino acid metallocarboxypeptidase which is activated by Co2+,has an residues (Arg, Lys). Subsequently, a “carboxypeptidase B-like apparent molecular weight of 52,000-55,000, and anacidic pH enzyme” removes the basic residues from the C terminus of optimum (23, 24, 26). A membrane-bound and a matrixsoluble form of the enzyme have been found in all the tissues * This research was supported by National Institutes of Health Grant AM 20542-12. This is journal paper 11,772 from the Purdue Agricultural Station. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted totheGen3nnkTM/EMBLDataBankwith accession numbeds) 504625. ll To whom correspondence should be addressed.
The abbreviations used are: POMC, preproopiomelanocortin; CRF, corticotropin-releasing factor; kb, kilobase pair; SDS, sodium dodecyl sulfate; Mops, 4-morpholinepropanesulfonic acid. *CarboxypeptidaseH (“H” for hormones), EC 3.4.17.10, is the name that has been recommended by the Enzyme Nomenclature of the International Union of Biochemistry, see Ref. 53. In this paper, the enzyme will always be referred to as carboxypeptidase H, even when discussing data obtained by investigators who referred to it with a different name.
5988
Structure and Regulationof Preprocarboxypeptidase H
5989
pH 6.5, 5 X SSC, 1 X Denhardt's solution, 0.1% SDS, 100 pg/ml sheared, denatured calf thymus DNA, and 1 X lo6 cpm/ml of radiolabeled oligonucleotide. The filters were washed twice at room temperature for 15 min in 2 X SSC, 0.5% SDS, once at 42 "C for 30 min in 1 X SSC, 0.5% SDS, and once at 55 "C for 10 min in the same solution. A second synthetic oligonucleotide, d(ATCTCCTTCGAGTACCA CCGCTATCC) (probe 2), corresponding to the 5'-end of the largest WG9 clone, was used to screen the WG9 cDNA library again and the BRIN cDNA library. A total of 300,000 recombinants of the WG9 H. library and of the BRIN library were screened by the procedure In this reportwe describe the cloning and sequence analysis described above. of a full-length rat cDNA which encodes a complete precursor Sequencing-BarnHI fragments (containing the complete cDNA to carboxypeptidase H, and show for the first time that a insert) of the largest positive clones of both the BRIN and WG9 proteolytic-processing enzyme is itself synthesized as a pre- libraries were subcloned into M13mp18 and pUC19. Both strands of clones were sequenced by the Sanger dideoxysequencing method cursor, preprocarboxypeptidase H. We also examine the tissue the (31), using the M13 universal primer and synthetic oligonucleotide distribution of rat preprocarboxypeptidase H mRNA and primers (17-26mers in length) derived from the sequence as it was show that the nucleotide sequence of carboxypeptidase H being elucidated. cDNAs from two tissues are identical. In addition, we study RNA Blot Analysis-Total RNA was isolated from rat brain, whole the regulation of carboxypeptidase H in mouse AtT20 cells heart, liver, lung, spleen, kidney, anterior pituitary, and mammary and demonstrate that dexamethasone and CRF regulate the gland by the method of Chirgwin et al. (28). One gram of tissue was in 20 ml of 4 M GTC, 25 mM sodium citrate, pH 7.0, mRNA levels of carboxypeptidase H and POMC in this cell homogenized 1%sodium lauryl sarcosine, 50 mM sodium EDTA, and 100 mM 2line. mercaptoethanol, and 3 mlof the homogenate were layered over a 1.2-ml cushion of 5.7 M CsCl, 100 mM EDTA, pH 7.0. The RNA was MATERIALS AND METHODS pelleted by centrifugation at 36,000 rpm for 17 h a t 20 "C ina Beckman SW55 Ti rotor. The RNA pellet was resuspended in 250 pl Preparation of RNA and Construction of the cDNA LibrariesRIN-m-5F rat insulinoma cells weregrown to near confluence in of the 4 M GTC solution (see above) and precipitated by the addition RPMI 1640 supplemented with 10% heat-activatedfetal bovine of 0.1 volumes of 2 M potassium acetate, pH 5.0, and 2.5 volumes of serum, penicillin, and streptomycin in a 5% COI, 35 "C incubator. cold ethanol. Two additional precipitations were performed, and the RNA was extracted from the cells by a modification of the method of pellet was dried and resuspended in diethylpyrocarbonate-treated Chirgwin et al. (28). After one wash with 10 mM sodium phosphate, water. Ten micrograms of total RNA were subjectedto electrophoresis pH 7.4, 0.14 M sodium chloride, 2-4 X 10' cells were treated with 100 through a 1%agarose, 6% formaldehyde denaturing gel in 50 mM ml of 5.5 M guanidine thiocyanate, 25 mM sodium citrate, 200 mM 2- Mops, 1 mM EDTA, pH 7.5 buffer, as described by Maniatis et al. mercaptoethanol, and 0.5% sodium lauryl sarcosine, pH 7.0. The (32). The gelwas capillary blottedin 20 X SSC ontoaNytran DNAwas sheared by being drawn repeatedly through a 19-gauge membrane (Schleicher & Schuell). After baking in a vacuum oven for needle, and totalRNA was isolated by centrifugation through cesium 2 h a t 80 "C, the membrane was prehybridized in 50% formamide, 5 trifluoroacetate (Pharmacia LKB Biotechnology Inc.; density 1:51 g/ X SSC, 4 X Denhardt's, 0.1 M sodium phosphate, pH 6.5,0.075% ml). The RNA pellet was dissolved in 4 M guanidine thiocyanate, 25 sodium pyrophosphate, 0.1% SDS, and 100 mg/ml denatured calf mM sodium citrate, 0.5% sodium lauryl sarcosine, pH 7.0, and precip- thymus DNA for 5 h a t 42 "C. Denatured, nick-translated probe (lo6 itated by the addition of acetic acid and ethanol. The RNA was twice cpm/ml), with a specific activity of 2 X 10' cpm/pg, was then added and hybridized to themembrane for 16 h a t 42 "C (33).The membrane dissolved in 10 mM Tris-HC1, pH 7.5, 1 mM EDTA, and precipitated with 2 M NaCl and ethanol. Polyadenylated RNA was isolated by two was washed as described above (see screening of cDNA libraries). rounds of oligo(dT)-cellulose chromatography, and 15 pg were used Determination of POMC and Carboxypeptidase H mRNAs in AtTto prepare a recombinant cDNA library in the pcD2 vector, as 20 Cells-AtT-20/D-l6v mouse anterior pituitarycorticotropic tumor described previously (29). The library was prepared in Escherichia cells were maintained in growth medium consisting of Dulbecco's coli DH-1 cells and contained3 X lo6 recombinants. In order to modified Eagle's medium supplemented with 10% horse serum, 10% increase the proportion of large cDNAs in this library, 12 pgof fetal bovine serum, 10% Nu Serum (Collaborative Research, Lexingplasmid DNA weredigested with SfiI and subjected to electrophoresis ton, MA), 120 gg/ml penicillin, 200 pg/ml streptomycin sulfate, and in a 0.6% agarose gel. That portion of the gel containing linearized 600 pg/ml glutamine. Cultures were pretreated in medium containing plasmids with inserts larger than 1.8-kb was dissolved in aNaI 1 p~ dexamethasone for 72 h. Cells were then treated for 5 h with solution, and theDNA was recovered by adsorption onto glass beads growth medium or medium containing 1 p~ dexamethasone or 100 (29). The beads were eluted with 10 mM Tris-HC1, pH 7.5, 1 mM nM ovine CRF (Peninsula). After treatment, thecells were harvested EDTA, and the DNA was recircularized with T4 DNA ligase. This and washed in phosphate-buffered saline, and the total RNA was product was used to transform DH-1 cells. It should be noted that extracted by the method of Chromczynski and Sacchi (34). Ten restriction of the recombinant pcD2 plasmids with SfiI results in the micrograms of RNA from each set of cells were fractionated on loss of the neomycin gene and its promoter (29). Thus, the size- formaldehyde-agarose gels, blotted onto a Nytran membrane, and selected library (henceforth referred to as BRIN) reverts to the pcDl hybridized with nick-translated probes as described above. Relative type. levels of RNA were estimated by densitometry of the autoradiograms A cDNA library was prepared from WG9 rat medullary thyroid of bothNorthern and slot blots. Slot blots were done by direct carcinoma cells, as described above. The WG9 library was not size- application of 10 pg of RNA from each set of cells to a nitrocellulose selected and, therefore, belonged to thepcD2 type. filter, using a slot blot apparatus (Minifold I1 Slot-Blot System, Screening of the cDNA Libraries-A total of 180,000 recombinants Schleicher & Schuell). The filter was then hybridized with labeled of the WG9 library were initially screened by the method of Grunstein probes as described above. and Hogness (30),using a 32P-labeledsynthetic oligonucleotide probe, d(GCTGCATGGTACAGCGTGCCTGGAGGAATGCAAGATRESULTS TTCAATTAC) (probe 1). The sequence of the oligonucleotide corIdentification and Characterization of cDNA Coding for Rat responded to a stretch of the bovine carboxypeptidase H cDNA (bases libraries were con823-8671, coding for amino acid residues thought to be essential for Preprocarboxypeptie H-ThecDNA enzyme activity (22). The probe was 5'-end-labeled with [y-32P]ATP, structed using mRNA isolated from either a rat medullary using T4 polynucleotide kinase, to a specific activity of -1 X 10' thyroid carcinoma (WG9) or from a rat insulinoma (RIN-mcpm/pg. The filters were washed for 14 h at 65 "C in 3 X SSC (1 X 5F) cell line following strategies similar to those described by SSC = 0.15 M NaC1, 0.015 M sodium citrate) andprehybridized for 5 Okayama et al. (29). In order to increase the proportion of the h at 65 "C in 2 X Denhardt's solution (1 X = 0.02% Ficoll, 0.02% bovine serum albumin, 0.02% polyvinylpyrrolidone), 6 X SSC, and larger cDNAs in the RIN-m-5F insulinoma library, plasmids 0.5% SDS. Hybridization was carried out for 20 h at 42 "C in 40% were linearized with SfiI. Plasmid DNA with cDNA inserts formamide, 0.075% sodium pyrophosphate, 0.1 M sodium phosphate, greater than 1.8 kb was separated, recircularized, and trans-
investigated. Both forms of the enzyme appear to be glycoproteins, have identical activity in vitro, and are recognized by the same antisera (21,23,27). The two forms of the enzyme differ in molecular weight (that of the soluble enzyme being 2,000-3,000 lower than that of the membrane-bound form) and in their relative distribution in the different tissues (21, 23). Recently, Fricker et al. (22) reported the sequence of a partial cDNA coding for bovine pituitary carboxypeptidase
5990
Structure and Regulution of PreprocarboxypeptidaseH
formed back intoDH-1 cells. The use of the restriction enzyme SfiI, which has an 8 base pair recognition site, to linearize the plasmid greatly reduces the change of cleaving within the newly synthesized cDNA. The structure of the pCD vector (29) harboring the cDNA insert, pcD-cbpH, is shown in Fig. lA. Initial screening of 180,000 recombinants of the rat medullary thyroid carcinoma WG9 library with 5’ 32P-labeled probe 1 (Fig. 1B) afforded 18 positive colonies. The sequence of probe 1 (see “Materials and Methods”) corresponded to nucleotides which encode a deduced bovine amino acid sequence thought to be important for carboxypeptidase H activity (22) and,therefore, was likely to be homologous to thatof the corresponding rat enzyme. Analysis by restriction endonuclease cleavage of the 18 positive clones showed that they were subsets of the largest clone, pcD-wcpH. Because of the method of construction of the cDNA library, all the positive clones contained an identical 3’-end with varying 5”extensions. The cDNA insert from the pcD-wcpH clone, approximately 2.0 kb in length, was subcloned and sequenced. Sequence analysis indicated that this clone did not encode a full-length cDNA corresponding to carboxypeptidase H. In an effort to obtain a full-length cDNA clone coding for the carboxypeptidase, the 5’ 32P-labeledprobe 2 (Fig. 1B) (corresponding to bases 1-26 of pcD-wcpH) was used to screen a size-selected rat insulinoma (BRIN) library. Upon screening 300,000 recombinants, 23 positive clones were obtained and analyzed by restriction endonuclease digestion. The largest positive clone, pcD-cbpH, with an approximate length of 2.2 kb, was subcloned into M13mp18, and both strands of the cDNAwere sequenced using synthetic oligonucleotides as
primers, according to thestrategy shown in Fig. 1B. Nucleotide Sequence of Rat PreprocarboxypeptidaseH-The sequence of the cDNA insert of pcD-cbpH is shown in Fig. 2. There were no discrepancies in the nucleotide sequence obtained from sequencing the two strands. The first ATG codon is located 44 nucleotides from the 5’-end of the cDNA and is preceded by a relatively GC-rich (67% G C) 5”nontranslated region. The putative initiator methioninecodon follows residues upstream which are compatible with the consensus sequence reported by Kozak (35). This methionine initiates a single open reading frame of 475 codons, ending with the termination codon TAA at nucleotide positions 1471-1473. A t least eight additional, in-frame, termination codons are found within the 3“untranslated region. The 5”untranslated RNA region contains no additional AUG codons that might serve as translational start sites. The nucleotide sequence of the rat insulinoma clone (Fig. 2) was found to be identical to that of the rat medullary thyroid carcinoma clone, whose 5’end corresponds to nucleotide 188 of the insulinoma clone. The identity between the two cDNAs belonging to the two different rat tissues extended to all of the determined 3‘untranslated region (423 nucleotides). Comparison of the nucleotide sequence of the rat insulinoma carboxypeptidase H cDNA to that of the bovine pituitary enzyme (22) reveals that nucleotide number 1of the bovine sequence corresponds to nucleotide number 170 of the rat sequence. An identity of 86.4% is observed between the coding regions of the carboxypeptidase cDNAs from the two species. The identity decreases to 80.0% in the first 125 nucleotides 3‘ to the termination codon and falls to only 46.2% in the next 200 nucleotides in the 3’ direction.
+
A
FIG. 1. Structure of pcD-cbpH and sequencing strategy of the cbpH cDNA insert. A , diagram of pcD-cbpH, the plasmid carrying the complete rat insulinoma carboxypeptidase H cDNA insert. The blackened area corresponds to the coding region and the white area to the noncoding regions of cDNA. The direction of transcription from the simian virus 40 (SV40) promoter is indicated by the arrows.ampR, ampicillin resistant gene. polyA, simian virus 40 polyadenylation site. B, sequencing strategy of the carboxypeptidase H cDNA insert. The bluckened and white areas correspond to the coding and noncoding regions, respectively, of the cDNA. The blackened squares, 1 and 2, indicate the probes used for the screening of the cDNA libraries (see “Materials and Methods.”).
Pst I
pBR322 6ri
\
Barn H I
d-T tail Hinc II
Sac1 Hinc II
-
1
7
2
b
. >
-
100bp
Structure and Regulation of Preprocarboxypeptidae H 40
30 10
1470
20
1460
1450
1440
1430
1420
430
-40 110
100
90
1480
1410
AGGAAGGAGGAGGAGAAGGMGAATTGATGGAGTGGTGC~TGATGTCAGAGACT~GAATTTCTAAG~GCCTC ArgLyrGluGluCluLysGlucluLeunetGluTrpTrpLysnetHecSerGluThrLeuA~nPhe
CCGGGCAGAC~GAGACCGGCGGTACAGCTCGCGGGACGCGATGGCCGGGCGCGGAGGACCGGTGCTGCTGGCGCTG HetAlaGlyArgGlyGlyArgValLeuLeuAlaLeu
420
1540 140
130 150
1530
1520
1550 1560 CTAACTAATGGCTTT~TATATCCATAGACTATAGTAAGATGCAACGTGGCTCTT~ATT~AGGTTGTGTGCCAGTT
lSl0
1500
TGTGCCGCGCTCGTGGCCGGCGGGTGGCTGTTAGCGCCTGAAGCCCAGGAGCCCGGGGCGCCACCGGCTGGCATGCGG
1490
CysAlaAlaLeuValAlaGlyGlyTrpLeuLeuAlaAlaGluA~aGlnGluProGlyAlaProAlaAlacly~etArg
- 20
- 30 180
170
1640
160
1630
-
10 1620
10 230
1610
1600
1590
1580
CGGCGCCGGCGGCTGCAGCAGGACGACGGCATCTCCTTCGACTACCACCGCTATCCCGAGCTGCGCGAGGCGCTGGTG ArgArgArgArgLeuGlnGlnGluA~~ClyIleSerPheGluTyrHisArgTyrProCluLeuArgCluAl~v~1
60
250
1720
10
-1 1 *(ArgPro)
1710
240
1700
1790
1690 20
300 1780
1680
1670
1660
310 1770 1760
1750
380
310 320 360
3 30350
1740
1730
T C A C A T G A C A G A T G C C A T G A G T C A A C C G A T G ? I \ C C
SerValTrpLeuClnCysThrALalleSerArgIleTyrThrVelGlyArgSerPheGluGlyArgGluLeuLe~Va1
390
1650
T G T C T G G A T C G A C ~ C A T T C T T T C A T G A A C A T T C G C T T T T G
TCGGTATGGCTGCAGTGCACCGCCATCAGCAGGATCTACACGGTGGGGCGCAGCTTCGACGGCCGGGAGCTCCTGGTC 30 ( A l a () V a l )
1570
AATATTTAACATCGGTTTATTT~GATCATTTAAGTAGTAGTTGCTAATCACTT~TACACTTGGACAGAACCGTAG
220
40 1870
1860
1800 1850
184018101830
1820
AGTTCCATATAAGTTGTCCTTAGTCTCTGTGCTGATCCACTGTATAGCATGATCCTG~AATG~GCTTCTGAGCGAAG
340
ATCGAGCTGTCTGACAACCCCGGGCTCCATGAGCCCGGTGAACCTGAGTTT~TACATTGGGAACATGCATGGTAAT I l e G l u L e u S e r A s p A s n P r ~ G l y V a l H i s C l u P r o C l y G l u P r ~ G l ~ P h ~ L y ~ T y ~ l l ~ G l ~ A ~ ~ ~1890 t H i ~ C1880 lyA~n 50
70
60
GAAAACGTACGTGCTTGCAA
(Leu) 420
410
FIG. 2"continwd
400
GAGGCGGTTGGACGGGAGCTGCTCATTTTCTTCGCCCAGTACCTGTGTAACGAATACCAGAGAGGGAATGAGACAATT GluAlaValGlyArgGluLeu~ull~PheLeuAlaClnTy~LeuCy~A~nGluTy~GlnA~~GlyA~nGluTh~Il~ 80 90 100 (LYS) 4530 90
540
4 520 80
510
500
GTCAACCTGATCCACAGCACACGAATCCATATCATGCCCTCCTTGAACCCCGATGGCTTTGAG~GCAGCATCTCAG ValAsnLeulleHisSerThrArgIleHisIleHetProSerLeuAsnProAspGlyPheGluLysAlaAlaSerGln 110 120
560
550
CCCGGTGAGCTGAAGGACTGGTTCGTGGGCCGCAGCAATGCCCAGGGAATAGATCTGAACCGGAACTTCCCAGAC~TG ProGlyGluLeuLysAspTrpPheValGlyArgSerAsnAlaGlnGlyIleAspLeuAsnArgAsnPheProAspLeu 130 (Leu) 50
640
630
GATAGGATCGTATATGTTAATGAGAAAGAAGGCGGTCCCAACAACCACCTGCTGAAGAATCTGAAG~TTGTGGAC ASpArglleValTyrValAsnG~uLysGluGlyGlyProAsnAsnHi~LeuLeuLysAsnLeuLysLy~Ly~lleValA~p 160 (11e) 730
720
Hydrophilic
710
CAAAATTCGAAGCTTGCCCCCGAGACCAAGGCTGTCATTCACTGGATCATGGACATCCCATTTGTGCTCTCTGCC~C GlnAsnSerLysLeuAlaProGluThrLyrAlaValIleHisTrpIleHetAspIleProPheValLeuSerAl~sn
200
180
190
-42
8
I
I
I
-I
108 58
I
I
I
1 5 8
208
258
308
I
I
350 408
(Thr) 810
860 790 830 850 840 CTGCACGGAGGAGACCTCGTGGCTAATTACCCGTATGATGAGACGCGGAGTGGTACTGCT~ACGAATA~GTTCCTGC LeuHisGlyGlyAspLeuV~I1Al~~nTy~P~~Ty~A~pGl~~rA~gS~~Gly~~Al~Hi~GluTy~S~rS~~cy~
800
230
210
(Ser) 890
880
930
870
II
920
I
I
I
I
I
CCTGATGACGCAATTTTCCACTTGGCTCGCGCATACTCTTCT~CAACCCAGTCATGTCTGACCCCAATCGACCT ProAspAspAlaIlePheGlnSerLeuAlaArgAlaTyrSerSerPheAsnProValHetSerAspProAsnArgPro 240 (Asp)
60
950
(Pro)
(Asp)
940
CCCTGTCGCAAGAATGATGATGACAGTAGCTTTGTAGATGGAACAACCAATGGTGGTGCATGCTACAGCGTCCCCGGT 50aa ProCysArgLysAsnAspAspArpSerSerPheValA~pGlyThrThrA~nGlyGlyAl~T~pTy~s~~V~lP~~Gl~ 260
280
(Glu)
050
1040
1030
(Ala)
1090 GGAATGCAAGACTTCAATTACCTGAGCAGCAACTGCTTTGACATCACTGTGGAGCTTAGCTGTGAGAAGTTCCCACCT GlyHetGlnArpPheAsnTyrLeuSerSerAsnCysPheGluIleThrValGluLeuSerCysGluLy~PhePraPro 10601080
1020
'
FIG. 3. Diagram of the structureof preprocarboxypeptidase H. A, hydropathy profile of preprocarboxypeptidasase H obtained by
1070
the method of Kyte and Doolittle (38).The numbers a t the bottom indicate the amino acid residues in the sequence (Fig. 2). B, main 290 300 structural features of preprocarboxypeptidase H. The blackened area 1120 1110 1100 1170 1160 11301150 1140 represents the putative signal peptide. The dotted area denotes the GAAGAGACTCTC~GCTACTGGGAAGATAAC~CTCCCTCATCAACTACCTGGAGCAGATACACCGAGCTGTT putative pro fragment, whose amino acid sequence is shown. The GluGlu~rLeuLysSerTyrTrpCluAspAsnLyrAsnS~~L~~lleAsnTyrLeuGluGlnIleHisArgGlyVel 310 320 330 open area corresponds to the mature carboxypeptidase H. Residues (Ser) ( I l e G l n ) ( A 4 inside circles are believed to be responsible for Zn2+binding. Residues 0 1210 1200 1190 1180 inside squares are thought to be involved in substrate binding. ResiAI\AGGGTTTGTCCGTGACCTTCAAGGTAATCCGATTGCCAACGCAACCAT~CCGTGGAT~GGATAGACCATGATGTC trinngles are believed to participate in the enzymatic reaction. L y ~ G l y P h e V a l A r g A ~ p L e u G l ~ G l y A s n P r o I l e A l a A ~ l l ~ S ~ ~ V ~ l A ~ p G ~ y l l ~ A ~dues p H i ~ in A~p V~l 340 w,n The pointa labeled with a N correspond to the Asn residues that are (Leu) (Glu) potentialsites for N-linked glycosylation. The numbering of the 300 1290 1280 1270 1260 13101330 1320 amino acid residues is the same as that of Fig. 2. ACCTCGGCTAAGGATGGGGATTACTGGCGATTGCTTGTGCCTGG~CTAT~CTTACAGCCTCAGCTCCCGGCTAC ThrserAlaLysAspGlyAspTyrTrpArgLeuLeuValPr~GlyA~~Ty~Ly~~uThrA~~~~~Al~P~~G~yTy~ 370 380
1370
1360
1350
1340
Analysis of Preprocarboxypeptidase H Sequence-Fig. 2 shows the deduced amino acid sequenceof rat preprocarboxypeptidase H, which contains 476 amino acids and has a predicted mass of 53,315 Da. At the N terminus, the first seven amino acids include 2 Arg residues, at positions -39 and -36, that are followedby 18 hydrophobicresidues, a feature that is common to signal peptides (36, 37). A KyteDoolittle analysis of the sequence(Fig. 3A) confirms the strong hydrophobicity of theN-terminal sequence of the precursor and further supports the existence of a signal peptide (38).Based onthe suggested criteria (37,39,40), the most likely site for signal peptide cleavage is between Ala-9 and
CTGGCAATCACARAGAAAGTGGCAGTTCCT~CAGCCCTGCTGTTGGGGTGGAC~TGAGCTGGAGTC~CTCTGAA LeuAlalle~rLysLyaValA~aV~lProPheSerP~~Al~V~lGlyV~lA~pPh~GluL~uGlus~~Ph~s~~Gl~ (Tyr)
390 (Ala)
FIG.2. Thenucleotidesequenceencodingratpreprocarboxypeptidase H. The amino acid sequence of preprocarboxypeptidase H is numbered -1-434. Amino acid residue number 1 corresponds to thepredicted N-terminal residue of mature rat carboxypepacid tidase H. Amino acids between brackets correspond to the amino residues in the sequence of bovine carboxypeptidase H that are different to those of the rat enzyme. The asterisk indicates the N terminus of the known partial sequence of bovine carboxypeptidase H (22).
Regulation Structure and
5992
of Preprocarboxypeptidase H
Ala-8, which would render the typical signal peptide C-ter- rat carboxypeptidase H is in very good agreement with that minal sequence: -Pro-Gly-Ala-X-Ala.Althoughless likely, obtained by Davidson and Hutton (23) by analysis of the cleavage of the signal peptide between Ala-16 and Gly-15, purified rat insulin secretory granule enzyme, as shown in which would also occur next to the characteristic Ala-X-Ala Table I. sequence, cannot be ruled out. Cleavage of the signal peptide Northern Blot Analysis of Carboxypeptidase H mRNA-Fig. would result in the formation of the carboxypeptidase H, a 5 shows the results of the Northern blot analysis performed precursor molecule composed of a very basic "pro" region of on RNA isolated from eight different rat tissues. Brain, anthe N terminus, containing5 adjacent Arg residues, followed terior pituitary, and heart show a single band of the same by the maturecarboxypeptidase H sequence. The presence of size, -2300 nucleotides, that hybridizes witha nick-translated multiple basic residues within the lastfive positions of the C probe derived fromthe HincII fragment(1269 base pairs, Fig. terminus of the propeptide is a feature common to several 1B) of the cDNA. Braincontainedthe highest levels of otherpreproproteins (Fig.4). Endoproteolytic cleavage of carboxypeptidase H mRNA; lower but significant levels were signal could be preprocarboxypeptidase H at the carboxyl side of the Arg-1 foundin heart and anterior pituitary. No would generate mature carboxypeptidase H, consistingof 434 detected in lung, liver, spleen, kidney, and mammary gland amino acids. The predicted mass of the mature protein, 49,030 (Fig. 5), and no evidence of size heterogeneity was observed. Da, is in agreement with the estimated molecular weight of Effects of Dexamethasone and of CRF on themRNA Levels 50,000 reported for the unglycosylated enzyme purified by of Carboxypeptidase H and POMC in AtT20 Cells-When mouse AtT2O anterior pituitarycells were treated with dexaHutton and Davidson from a rat insulinoma (23) and also with the estimated molecular weight of the bovine enzyme purified by Fricker et al. (26). TABLEI A comparison of the deduced amino acid sequence of the Amino acid composition of rat carboxypeptidase H mature rat carboxypeptidase H and that of the bovine pituiAnalysis of purified tary carboxypeptidaseH (22) reveals anidentity of 94% rat insulin Predicted from secretory granule cDNA sequence between the two sequences and demonstrates that these two carboxypeptidase H" enzymes are species variants of the same protein. There are mol % mol 76 only 26 residue differences, 14of which are conservative (Fig. (5.5) Ala-24 Ala 5.7 2). All the amino acids known to be important for the funcArg-19 5.1(4.4) Arg tionality of the enzyme have been conserved (Fig. 3B). Thus, Asn-30 (6.9) His-72, Glu-75, and His-225, believed to be responsible for Asp-27 (6.2) Asx 12.8 Zn2+binding (22,41,42);Lys-131, Tyr-227, Tyr-278, and GluCYS-6 (1.4) CYS 1.4 29, thought to participate in the enzymatic reaction (22, 41, Gln-12 (2.8) 42); and Arg-147 and Gln-284, believed to bind to the subGlx 11.1 Glu-38 (8.8) GlY 7.2 strate (22), areall present in thecarboxypeptidases from the (7.1) Gly-31 His 2.7 His-11 (2.5) two species (Figs. 2 and 3B). Also conserved are the pairsof Ile 5.2 Ile-24 (5.5) basic amino acids interspersedalong the sequence (Lys-1749.1 (8.5) Leu Leu-37 Lys-175, Arg-259-Lys-260, Lys-391-Lys-392, and Arg-413LYS 4.6 (4.8) Lys-21 Lys-414) that could serve as potential cleavage sites and the Met 1.3 Met-8 (1.8) two potential sites for N-linked glycosylation (Asn-97 and Phe 3.9 Phe-19 (4.4) Pro 6.1 Pro-25 Asn-348). Interestingly, the firsttwo N-terminal aminoacids (5.8) 9.1 (7.6) Ser Ser-33 of the mature rat enzyme, Leu-Gln, differ from those of the 5.3 Thr Thr-16 (3.7) bovine sequence (22) (Fig. 2). The deduced partial aminoacid 1.o Tv-8 (1.8) Tv sequence of the medullary thyroid carcinoma carboxypeptiTYr 2.8 (4.1) Tyr-18 dase H is identical to thesequence of the deduced insulinoma Val 5.7 Val-27 (6.2) enzyme. The predicted amino acid composition of the mature Obtained by Davidson and Hutton (23). -?n
.In
1
1 2
3 4 5 6 7
8
-
9.5
7.54.4-
2.41.4-
FIG.5. Northern blot of total RNA from rat tissues. Ten micrograms of total RNA from several rat tissues were fractionated on an agarose-formaldehyde gel, blotted onto an Nytran (Schleicher & Schuell) membrane,and probed with a 32P-labeledcDNA probe to carboxypeptidase H. Lanes: I , brain; 2, heart, 3, kidney; 4, liver; 5, lung; 6, spleen; 7, anterior pituitary; 8, mammary gland. Molecular weight markers correspond to those of a RNA ladder(Bethesda Research Laboratories).
Structure andRegulation of Preprocarboxypeptidae H 1)
Carboxypeptidase H-
2)
- D C
-
-
- D C
FIG.6. Effects of dexamethasone and of CRF on the RNA levels of carboxypeptidase H and POMC in AtT2O cells. Ten micrograms of RNA from AtT20 cells that had been pretreated with 1 p~ dexamethasone for 72 h and then exposed for 5 h to (-) control or 100 nM CRF (C),were fracmedium, 1 p~ dexamethasone (D), tionated on an agarose-formaldehydegel and blotted onto a Nytran (Schleicher & Schuell) membrane. The blots were hybridized to 3zPlabeled cDNA probes to carboxypeptidase H ( I ) or POMC (2). Estimation of the molecular weight of the bands was made by comparison with the markers of a RNA ladder (Bethesda Research Laboratories), as in Fig. 5.
methasone for 72 h andthen exposedfor 5 h to media containing 1 PM dexamethasone, the levels of both carboxypeptidase H and POMC RNAs decreased by approximately 30% relative to those of the RNAs from cells treated with dexamethasone and thenexposed for 5 h to media free of the steroid (Fig. 6). However, when the dexamethasone-treated cells (72 h) were exposed for 5 h to the secretagogue CRF, a 2-3-fold increase in thelevels of the two RNAs was observed relative to thoseof the RNAs from the controlmedium (Fig. 6). The results obtained by densitometry of autoradiograms of Northern blots, described above, were confirmed by slot blot analysis of the RNA from two separate sets of experiments (data not shown). DISCUSSION
The sequence of a full-length cDNA codingfor carboxypeptidase H demonstrates that the enzyme is initiallysynthesized as a precursor, preprocarboxypeptidase H. Mature carboxypeptidase H has been localized in the secretory granules of tissues (21, 23, 24), and the deduced amino acid sequence of the precursor to carboxypeptidase H is compatible with the generally accepted mechanisms of intracellular sorting and (1,36,43).After transport of secretory peptides and hormones cleavage of the signal peptide andpassage through the lumen
5993
of the endoplasmic reticulum and the Golgi, the procarboxypeptidase would be directed to the secretory granule, where maturation would occur. Hook et al. (44) have presented evidence suggesting that, in rat pituitary, maturation of an inactive form of carboxypeptidase H occurs in the secretory granules as they are transported along the axon to nerve terminals. Previous immunocytochemical and enzyme activity studies established the presence of carboxypeptidase H in rat and bovine brain, pituitary, and adrenal and in rat pancreatic insulin secretory cells (23, 27,45). Recently, binding sites for guanidinoethylmercaptosuccinic acid,a potent inhibitor of carboxypeptidase H, have been demonstrated in rat salivary gland and, in lower levels, in numerous peripheral tissues including heart, where carboxypeptidase H activity has been (55). Investigation of the tissue found in the granule fraction localization of carboxypeptidase H by Northern blot analysis reveals that theenzyme’s mRNA is present not only in brain and anterior pituitary, as expected, but is also present in comparable levels inheart (Fig. 5). CarboxypeptidaseH mRNA was not found in the rest of the peripheral tissues assayed, i.e. liver, lung, kidney, spleen, and mammary gland. This observation could reflect low levels of carboxypeptidase H RNA which were not detectable in Northern blots of total RNA. The size of the mRNA (-2300 kb) is identical in the three rat tissues (brain, anterior pituitary, and heart) alsoand in AtT2O mouse anterior pituitary tumorcells and is compatible with the size of the cDNAs. The size of rat and mouse carboxypeptidaseH mRNAs differs from that of bovine, which has been reported to be 3.3 kb (22). In addition, only one species of carboxypeptidase H mRNA has been found in rat and mouse, in contrast to the three species apparently present in bovine (22). The finding of relatively high levels of carboxypeptidase H message in heartisinteresting.Theratatrialnatriuretic peptide is synthesized as a precursor with 2 Arg residues a t its C terminus that are absent from the biologically active peptide (47,48). Therefore, the natriureticpeptide could well be a substrate for the action of carboxypeptidase H in heart. The presence in cardiac tissue of carboxypeptidase H as well as peptidyl glycine a-amidating monooxygenase (46) opens the possibility of other novel active peptides in theheart. The excellent agreement of the amino acid composition deduced from the carboxypeptidase H cDNA and that obtained by Davidson and Hutton (23) for the enzyme purified from rat insulinsecretory granules (Table I) strongly supports the idea that theycorrespond to the sameenzyme. Similarly, the identity notonly of the aminoacid sequences but also of the cDNA sequences of carboxypeptidase H from two different rat tissues strongly argues against possibility the of tissuespecific differences in the primary structureof carboxypeptidase H. The identity of 94% between the deduced amino acid sequences of rat insulinoma carboxypeptidase H and bovine pituitary carboxypeptidase H (22) (Fig. 2) shows that they are species variants of the same enzyme (EC 3.4.17.10). These facts taken together suggest that a single enzyme, carboxypeptidase H, is likely to be responsible for the processing of a wide variety of different neuropeptides ina number of different tissues. However, sometissue-specificdifferenceshavebeenreported for carboxypeptidase H. The rat pituitaryenzyme has been found to be inhibited by leupeptin and benzylsuccinic acid (24), but neither compound affects either the ratinsulinoma (23) or the bovine pituitary enzyme (45). Also a difference in apparent K,,, values of the bovine pituitary and rat pancreatic enzymes towards a synthetic substrate has been
5994
Structure and Regulation of Preprocarboxypeptidase H
reported (23, 26). The significance of these discrepancies is unclear and could reflect differences in themethodology used or small contaminations of lysosomal enzymes. Of more importance is the difference in the ratios of membrane-bound to soluble enzyme found in the different tissues. In the insulinoma granules, more than 90% of carboxypeptidase H activity appears to be soluble (23), whereas in brain, pituitary, and adrenal medulla, there is a significant proportion of membrane-bound activity, and this proportion varies in different areas of the brain and in the different lobes of the pituitary (21,49). Both the soluble and membrane-bound forms of the enzyme are glycoproteins, both are equally active and are recognized by the same antibodies (21, 27, 49). They differ only in their mass, that of the membrane-bound form being approximately 2000-3000 Da higher than that of the soluble form (21). In the light of the results of this paper, it can be concluded that the difference between the membrane-bound and the soluble forms of carboxypeptidase H is caused by a post-translational event and notby the translation of different mRNAs. It is evident that further experimental work is necessary to characterize the nature of the biochemical differences between soluble and membrane-bound forms of carboxypeptidase H. Earlier studieshave shown that inAtT2O cells, stimulation of secretion of POMC-derived peptides by CRF results in a parallel stimulation of secretion of both carboxypeptidase H and peptidyl glycine a-amidating monooxygenase activities (50) and in an increase in thePOMC and peptidyl glycine aamidating monooxygenase RNA levels inside the cells (18). In this paper, we have shown that dexamethasone-treated AtT2O cells exposed to CRF for 5 h underwent an increase of 2-%fold in the mRNA levels of both carboxypeptidase H and POMC, relative to those of dexamethasone-treated cells exposed to control medium for 5 h. Similar co-regulation has been reported for peptidyl glycine a-amidating monooxygenase and POMC (18). These results suggest that regulation of secretion can be effected at theRNA leveland that it includes the secretory proteins, as well as theenzymes responsible for their post-translational processing? Carboxypeptidase H and peptidyl glycine a-amidating monooxygenase (20) are the only mammalian enzymes involved in post-translational processing of precursors to bioactive peptides whose complete primary structure has been elucidated. Interestingly, peptidyl glycine a-amidating monooxygenase is also localized in secretory granules in the pituitary and is synthesized as a preproprotein (18). It is noteworthy that enzymes which activate peptide precursors need themselves to be post-translationally activated. This suggests a high level of complexity in the regulation of post-translational modification processes and poses the question of what activates the activators. Although the N-terminal “pro” fragments of carboxypeptidase H and peptidyl glycine a-amidating monooxygenase do not show a high degree of sequence homology (Fig. 4), their sizes are similar (less than 16 amino acid residues), and both share preponderance a of basic amino acid residues surrounding the site of proprotein cleavage. The role of the pro fragment of carboxypeptidase H is unknown. Clues to its potential function may be obtained from studies of other preproproteins. Valls et al. (51) have shown that the N-terminal propeptide of yeast carboxypeptidase Y renders the enzyme inactive duringintracellular transit and targets the molecule to thevacuole. Although the size of the propeptide of procarboxypeptidase H is much After submission of this manuscript for publication, Thiele and Fricker reported that they did not see an effect of CRF and dexamethasone upon carboxypeptidase H RNA levels in AtT20 cells (56).
smaller than that of procarboxypeptidase Y and no sequence homology is apparent between the two propeptides (Fig. 4), it is possible that thepropeptide of carboxypeptidase H plays a similar targeting role. On the other hand, the blood coagulation factors are also synthesized as preproprecursors, and it has been shown that residues of glutamic acid present in the propeptide are required for proper y-carboxylation of Glu residues which function in Ca2+binding (52). A look at the sequences of these propeptides fails to detect significant sequence homologies with the profragment of procarboxypeptidase H, but it shows that they all share a very basic C terminus region that extends for 4 or 5 amino acid residues (Fig. 4). Furthermore, it has been shown that theArg residue at position -4 is an absolute requirement for correct processing of the precursor to factor IX (52). It is likely that the 5 adjacent Arg residues in procarboxypeptidase H play a similar role in determiningthe specificity of cleavage in theprecursor to render the mature active enzyme. Studies of site-directed mutagenesis and deletions in the propeptide of procarboxypeptidase H and analysis of their effects on the processing and subcellular localization of the enzyme should help to elucidate the biological function of the propeptide in carboxypeptidase H. Eucaryotic expression vectors containing the complete preprocarboxypeptidase H cDNA, like the one whose construction and isolation are described in this paper, should prove ideal to undertake the above mentioned studies. Acknowledgments-We wish to thank Junko Aimi for carrying out the tissue culture of the AtT2O cells and the preparation of RNA, Hong Qiu for help with the screening of the libraries, and Ake Robaeus for the RIN cell RNA. We also thank Drs. Richard Mains and Ian Dickerson for the kind gift of POMC cDNA, David Pot for his assistance with computer data handling, and Dr. Lloyd Fricker for communicating manuscripts to us before publication. REFERENCES 1. Loh, Y. P., Brownstein, M. J., and Gainer, H.(1984) Annu. Reu. Neurosci. 7,189-222 2. Andrews, P. C., Brayton, K., and Dixon, J. E. (1987) Experientiu 43,784-789 3. Bradbury, A. F., and Smyth, D.G. (1985) in Biogenetics of Neurohormonal Peptides (Hakanson, R., and Thorell, J., eds) pp. 171-186, Academic Press, Orlando, FL 4. Wold, F. (1981) Annu. Reu. Biochem. SO, 783-814 5. Howells, R.D., Kilpatrick, D.L., Bhatt, R., Monahan, J. J., .~ . Poonian. M.. and Udenfriend, S. (1984) Proc. Natl. Acad. Sci. U. 5‘. A. 81,’7651-7655 6. Nakanishi, S., Inoue, A., Kita, T., Nakamura, M., Chang, A. c. Y., Cohen, S. N., and Numa, S. (1979) Nature 278,423-427 7. Davidson, H. W., Rhodes, C. J., and Hutton,J. C. (1988) Nature 333993-96 8. Loh, Y. P., Parish, D. C., and Tuteja, R. (1985) J. Biol. Chern. 2 6 0 , 7194-7205 9. Parish, D. C., Tuteja, R., Alstein, M., Gainer, H., and Loh, Y. P. (1986) J. Biol. Chem. 261,14392-14397 10. Clamagirand, C., Creminon, C., Fahy, C., Boussetta, H.,and Cohen, P. (1987) Biochemistry 26,6018-6023 11. Chang, T. L., and Loh, Y. P. (1983) Endocrinology 112, 18321838 12. Loh, Y. P., and Gainer, H. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,108-112 13. Zingg, H. H., and Patel, Y. C. (1983) Life Sci. 33, 1241-1247 14. Lindberg, I., Yang, H. Y. T., and Costa, E. (1982) Biochem. Biophys. Res. Commun. 106,186-193 15. Lindberg, I., Yang, H. Y . T., and Costa, E.(1984) J. Neurochem. 42,1411-1419 16. Evangelista, R., Ray, P., and Lewis, R. V. (1982) Biochem. Biophys. Res. Comrnun. 106,892-902 17. Mizuno, K., Miyata, A., Kangawa, K., and Matsuo, H. (1982) Biochem. Biophys. Res. Commun. 108,1235-1242 18. Eipper, B. A., Park, L. P., Dickerson, I. M., Keutmann, H. T., Thiele, E. A., Rodriguez, H., Schofield, P. R., and Mains, R. E. (1987) Mol. Endocrinol. 1,717-790 ~
Structure and Regulation of Preprocarboxypeptidase H 19. Murthy, A. S. N., Keutmann, H. T., and Eipper, B.A. (1987) Mol. Endocrinol. 1, 290-299 20. Murthy, A. S. N., Mains, R. E., and Eipper, B. A. (1986)J. Biol. Chem. 261,1815-1822 21. Supattapone, S., Fricker, L.D., and Snyder, S. H. (1984)J. Neurochem. 42, 1017-1023 22. Fricker, L. D., Evans, C. J., Esch, F. S., and Herbert, E. (1986) Nature 323,461-464 23. Davidson, H. W., and Hutton,J. C. (1987)Biochem. J. 245,575582 24. Hook, V.Y. H., and Loh, Y. P. (1984)Proc. Natl. Acud. Sei. U. S. A.499-516 81, 2776-2780 25. Fricker, L. D., and Snyder, S. H.(1982)Proc. Nutl. Acud. Sci. U. S. A. 79,3886-3890 26. Fricker, L.D., and Snyder, S. H. (1983)J. Biol.Chem. 258, 10950-10955 27. Hook, V.Y. H., Mezey, E., Fricker, L. D., Pruss, R. M., Siegel, R. E., and Brownstein, M. J. (1985)Proc. Nutl. Acud. Sci. U. 5'. A. 82,4745-4749 47. 28. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979)Biochemistry 18,5294-5299 29. Okayama, H., Kawaichi, M., Brownstein, M., Lee, F., Yokota, T., and Arai, K. (1987)Methods Enzymol. 164, 3-28 30. Grunstein, M., and Hogness, D. (1975)Proc. Nutl. Acud.Sci. U. S. A. 72,3961-3965 31. Sanger, F., Nicklen, S., and Colson, A. R. (1977)Proc. Nutl. Acud. Sci. U. S. A. 74,5453-5467 32. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982)in Mokcular Cloning: A Laboratory Manual, pp. 202-203,Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 33. Thomas, P. S. (1980)Proc. Natl. Acud. Sci. U. S. A. 77, 52015205 34. Chomczynski, P., and Sacchi, N. (1987)Anal. Biochem. 162, 156-159 35. Kozak, M. (1984)Nucleic Acids Res. 12,857-871 36. Blobel, G., and Dobberstein, B. (1975)J. Cell Biol. 67,835-851
5995
37. Von Heijne, G . (1983)Eur. J. Biochem. 133,17-21 38. Kyte, J., and Doolittle, R. F. (1982)J. Mol. Bwl. 157, 105-132 39. Perlman, D., and Harlvorson, H. 0.(1983)J. Mol. Bwl. 167, 391-409 40. Von Heijne, G. (1985)J. Mol. Biol. 184,99-105 41. Schmid, M. F., and Herriott, J. R. (1976)J. Mol. Biol. 103,175190 42. Rees, D. C., Lewis, M., Honzatko, R. B., Lipscomb, W. N.,and Hardman, K. D. (1981)Proc. Nutl. Acud. Sci. U. S. A. 78, 3408-3412 43. Walter, P., and Lingappa, V. R. (1986)Ann. Rev.CellBwl. 2, 44. Hook, V. Y. H., Palkovits, M., and Affolter, H. V. (1987)Ann. N. Y. Acud. Sci. 493,394-396 45. Fricker, L. D., Supattapone, S., and Snyder, S. H. (1982)Life. Sci. 31,1841-1844 46. Sakata, J., Mizuno, K., and Matsuo, H. (1986)Biochem. Biophys. Res. Commun. 140,230-236 Maki, M., Takayanagi, R., Misono, K. S., Pandei, K. N., Tibbetts, C., and Inagami, T. (1984)Nature 309,722-724 48. Yamanaka, M., Greenberg, B., Johnson, L., Seilhamer, J., Brewer, M., Friedemann, T., Miller, J., Atlas, S., Laragh, J., Lewicki, J., and Fiddes, J. (1984)Nature 309, 719-722 49. Hook, V.Y. H. (1985)J. Neurochem. 46,987-989 50. Mains, R. E., and Eipper, B. A. (1984)Endocrinology 115,16831690 51. Valls, L.A., Hunter, C. P., Rothman, J. H., and Stevens, T. H. (1987)Cell 48,887-897 52. Furie, B., and Furie, B. C. (1988)Cell 53, 505-518 53. Webb, E. C. (1986)Eur. J. Biochem. 167, 16 54. Strittmatter, S. M., Lynch, D. R., and Snyder, S. H. (1984)J. Biol. Chem. 259,11812-11817 55. Lynch, D.R., Venable, J. C., and Snyder, S. H. (1988)Endocrinology 122,2683-2691 56. Thiele, E. A., and Fricker, L. D. (1988)in Progress in Endocrinology (Imura, H. etal., eds) pp. 329-334,Elsevier, Amsterdam
