Arch Virol (2015) 160:371–374 DOI 10.1007/s00705-014-2242-9
ANNOTATED SEQUENCE RECORD
Recombination in truncated genome sequences of porcine circovirus type 2 Libin Wen • Fengzhi Wang • Kongwang He Bin Li • Xiaomin Wang • Rongli Guo • Jianping Xie
•
Received: 5 August 2014 / Accepted: 22 September 2014 / Published online: 1 October 2014 Ó Springer-Verlag Wien 2014
Abstract Porcine circovirus type 2 (PCV2) is the causal agent of a serious disease found in pigs. Here, we report the first detection of truncated genome sequences of PCV2 strain ZJ-R, with the genomic region encoding part of Rep and Cap with a nonviral insertion. To our knowledge, the genome of ZJ-R represents the first PCV2 DNA with a coding insertion. The PCV2 ZJ-R genome is 694 nucleotides long and has two main open reading frames. The whole genome sequence of ZJ-R may facilitate further study of the origin and evolution of PCV2.
Introduction Porcine circovirus type 2 (PCV2), a member of the genus Circovirus in the family Circoviridae, consists of a singlestranded circular genome of 1766 to 1768 nucleotides. PCV2 has an ambisense genome that encodes proteins from 11 potential open reading frames (ORFs) [5]. Four of these are functionally characterized. ORF1 codes for viral replication proteins (Reps) [3, 11], ORF2 for the viral capsid L. Wen F. Wang K. He (&) B. Li X. Wang R. Guo J. Xie Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China e-mail:
[email protected] L. Wen e-mail:
[email protected] L. Wen F. Wang K. He B. Li X. Wang R. Guo J. Xie Key Laboratory of Veterinary Biological Engineering and Technology, Ministry of Agriculture, Nanjing, China L. Wen F. Wang K. He B. Li X. Wang R. Guo J. Xie National Center for Engineering Research of Veterinary Bio-products, Nanjing, China
(Cap) [12, 13], and ORF3 for an apoptotic protein [8, 9]. ORF4 can suppress caspase activity and regulate CD4(?) and CD8(?) T lymphocytes during PCV2 infection [7]. PCV2 is considered the essential aetiological agent for several diseases in pigs. These are designated as porcine circovirus-associated diseases (PCVAD) [16]. They include postweaning multisystemic wasting syndrome (PMWS) [6], porcine dermatitis and nephropathy syndrome (PDNS) [17], respiratory diseases [15], and reproductive failure [14]. PCV2 is found worldwide and causes severe economic losses to the pig industry. Despite its small size and limited protein-coding capacity, the rate of evolution of PCV2 is very rapid [4]. PCV2 isolates are classified into three genotypes: PCV2a, PCV2b and PCV2c [18]. So far, two types of recombination events have been reported. One occurs between and within genotypes of PCV2 [1, 2, 10, 19– 21], and the other between PCV2 and other viral or host DNAs [10, 23, 25]. A small circular genome sequence of the PCV2 isolate (GenBank no. KC415249) has been reported to contain a nonviral insertion [10], but the insertion sequence appears to lack protein-coding ability. This is the first report of the presence of a truncated genome sequence of the PCV2 Chinese isolate (ZJ-R) for which possible recombination with cellular protein-coding sequences was observed.
Provenance of the virus materials In early 2014, sporadic cases of PMWS were observed in 4- to 6-week-old piglets in Zhejiang, China. These animals showed the typical clinical signs of PMWS, including progressive wasting, pallor of the skin, respiratory distress and diarrhea. Twenty serum samples from the affected
123
372
L. Wen et al.
Fig. 1 Nucleotide sequence of PCV2 ZJ-R (GenBank accession no. KM259933 [this study]) aligned with that of PCV2 BF (GenBank accession no. AF381175) and Sus scrofa (pig) fosmid end sequence (GenBank accession no. HE214143). Identical nucleotides are indicated by dashes (-)
swine herd were submitted to the laboratory for diagnosis. PCV2 strain ZJ-R was isolated from the serum of a gilt. Total viral DNA was extracted from serum samples using a QIAamp Viral DNA Mint Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions.
123
The primer-design strategy for PCR amplification was as described previously [24]. Three pairs of modified primers were designed using Oligo 6.0 software (Molecular Biology Insights Inc., Cascade, CO, USA) and selected for use in three separate PCRs, which would yield three
Recombination in porcine circovirus type 2
overlapping fragments. The sequences of these primers (50 to 30 ) were as follows: F1 (nt 63 to 82), AAGAATGGAA GAAGCGGACC; R1 (nt 482 to 506), CTTCGGATATAC TGTCAAGGCTACC; F2 (nt 210 to 233), CCTGGGCCA CTCGCGCTTGCATTC; R2 (nt 165 to 189), GCCCA CTGATCCACGCCCGTGTCAC; F3 (nt 665 to 690), TGAAAACGAAAGAAGTGCGCTGTAAG; R3 (nt 639 to 664), GCTATGACGTATCCAAGGAGGCGTTA. PCR products were analyzed using 1.5 % agarose gels stained with EB, extracted from the gel and cloned into the vector pMD18-T (TaKaRa). Sanger sequencing was performed on an automated sequencer (ABI 3730 DNA Analyzer), and sequence analysis and alignment analysis were performed using DNAMAN software and a web server (http://www.ncbi.nlm.nih.gov/Blast.cgi), respectively. To avoid artifacts produced by amplification, the whole procedure from PCR to sequencing was repeated twice.
Sequence properties The complete sequence of PCV2 ZJ-R isolate was 694 nt in length and had a GC content of 57 %. The circular genome of ZJ-R isolate comprised the ori sequence of PCV2, characterized by a stem-loop structure with a nonamer motif (AAGTATTAC) at the apex of the stem-loop and three repeats of hexanucleotide motifs (CGGCAG) adjacent to the stem-loop, which serve as binding sites for the replicases. The genome sequence of ZJ-R from nt 1 to 158 and that from nt 339 to 694 showed considerable homology to the corresponding sequence of PCV2. The 180-nt sequence between nt 159 and 338 in the genome of ZJ-R was quite different from that of PCV2 but showed 99 % homology to a sequence from Sus scrofa (pig) (GenBank no. HE214143) (Fig. 1). The genome of ZJ-R contained two main ORFs organized in a pattern typical of members of the genus Circovirus. ORF1 extended from nt positions 51 to 282 and encoded a protein of 76 amino acids (aa) with a predicted molecular mass of 8.4 kDa. ORF2 had a length of 660 nt and encoded a protein of 219 aa (25.2 kDa). The genome included an open reading frame encoding a truncated Rep/ Cap protein of PCV2 that was somewhat different from the normal PCV2 Rep/Cap protein. The amino acid sequence of ORF1 from aa 1 to 36 and that of ORF2 from aa 1 to 107 showed high homology to those of the corresponding sequence of PCV2. A previous study showed the recombinant porcine circovirus-like virus P1 to be associated with PMWS [22]. It is not clear whether PCV2 ZJ-R is the causal agent of PMWS. The current study lays the groundwork for constructing full-length infectious clones of the ZJ-R isolate to
373
investigate the possible role in PMWS. In summary, this is the first report of a truncated genome sequence of a PCV2 Chinese isolate (ZJ-R) capable of recombination with a cellular protein-coding sequence. It may contribute to further study of the molecular epidemiology and evolution of PCV2. The complete genomic sequence of the PCV2 ZJ-R isolate was deposited in the GenBank database under accession no. KM259933. Acknowledgments This study was funded by the National Natural Science Foundation of China (31272574, 30972184) and Fund for Independent Innovation of Agricultural Sciences in Jiangsu province CX(14)2045. We thank LetPub (http://www.letpub.com) for its linguistic assistance during the preparation of this manuscript.
References 1. Cadar D, Csa´gola A, Lorincz M, Tomba´cz K, Spıˆnu M, Tuboly T (2012) Detection of natural inter- and intra-genotype recombination events revealed by cap gene analysis and decreasing prevalence of PCV2 in wild boars. Infect Genet Evol 12(2):420–427 2. Cai L, Ni J, Xia Y, Zi Z, Ning K, Qiu P, Li X, Wang B, Liu Q, Hu D, Yu X, Zhou Z, Zhai X, Han X, Tian K (2012) Identification of an emerging recombinant cluster in porcine circovirus type 2. Virus Res 165(1):95–102 3. Cheung AK (2003) Transcriptional analysis of porcine circovirus type 2. Virology 305(1):168–180 4. Duffy S, Shackelton LA, Holmes EC (2008) Rates of evolutionary change in viruses: patterns and determinants. Nat Rev Genet 9(4):267–276 5. Hamel AL, Lin LL, Nayar GP (1998) Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. J Virol 72(6):5262–5267 6. Harding JC (1996) Post-weaning multisystemic wasting syndrome (PMWS): preliminary epidemiology and clinical presentation. In: Proceedings of the 27th Annual Meeting of the Western Canadian Association of Swine Veterinarians, Saskatoon, Saskatchewan, Canada, p 21 7. He J, Cao J, Zhou N, Jin Y, Wu J, Zhou J (2013) Identification and functional analysis of the novel ORF4 protein encoded by porcine circovirus type 2. J Virol 87(3):1420–1429 8. Liu J, Chen I, Du Q, Chua H, Kwang J (2006) The ORF3 protein of porcine circovirus type 2 is involved in viral pathogenesis in vivo. J Virol 80:5065–5073 9. Liu J, Chen I, Kwang J (2005) Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. J Virol 79: 8262–8274 10. Luo W, Zhao D, Yu XL, Ge M, Li RC, Jiang DL (2013) Smallsized circular genomes similar to genome of porcine circovirus 2. Genome Announc 1(2):e0009313 11. Mankertz A, Mankertz J, Wolf K, Buhk HJ (1998) Identification of a protein essential for replication of porcine circovirus. J Gen Virol 79(2):381–384 12. Nawagitgul P, Harms PA, Morozov I, Thacker BJ, Sorden SD, Lekcharoensuk C, Paul PS (2002) Modified indirect porcine circovirus (PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assays for detection of antibodies to PCV. Clin Diagn Lab Immun 9(1):33–40
123
374 13. Nawagitgul P, Morozov I, Bolin SR, Harms PA, Sorden SD, Paul PS (2000) Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol 81(9):2281–2287 14. Pensaert MB, Sanchez RE, Jr, Nauwynck HJ (2001) Transmission of porcine circovirus type 2 from the sow to the litter. In: Proceedings of the international conference on ssDNA viruses of plants, birds and primates, Saint Malo, France, p 84 15. Pesch S, Schmidt U, Ohlinger VF (2000) Proliferative necrotizing pneumonia (PNP) is a result of coinfection with porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circovirus type 2 (PCV-2). In: Proceedings of the 16th international pig veterinary society congress, Melbourne, Australia, p 581 16. Segale´s J (2012) Porcine circovirus type 2 (PCV2) infections: clinical signs, pathology and laboratory diagnosis. Virus Res 164: 10–19 17. Segale´s J, Domingo M, Latimer KS (1998) Porcine circovirus is present in cases of porcine dermatitis and nephropathy syndrome (PDNS). In: Proceedings of the 15th international pig veterinary society congress, Birmingham, England, p 215 18. Segale´s J, Olvera J, Grau-Roma L, Charreyre C, Nauwynck H, Larsen L, Dupont K, McCullough K, Ellis J, Krakowka S, Mankertz A, Fredholm M, Fossum C, Timmusk S, StockhofeZurwieden N, Beattie V, Armstrong D, Grassland B, Baekbo P, Allan G (2008) PCV2 genotype definition and nomenclature. Vet Rec 162:867–868
123
L. Wen et al. 19. Wen L, He K, Li B, Wang X, Guo R, Yu Z, Mao A, Ni Y, Zhang X, Zhou J, Lv L, Jiang J (2012) In vitro and in vivo isolation of a novel rearranged porcine circovirus type 2. J Virol 86(23):13120 20. Wen L, He K, Ni Y, Zhang X, Li B, Wang X, Guo R, Yu Z, Mao A, Zhou J, Lv L, Jiang J (2012) Complete genome sequence of the rearranged porcine circovirus type 2. J Virol 86(10):5963 21. Wen L, He K, Ni Y, Zhang X, Li B, Wang X, Guo R, Yu Z, Mao A, Zhou J, Lv L, Jiang J (2012) In vitro intragenomic rearrangement of porcine circovirus type 2. J Virol 86(16):8911 22. Wen L, He K, Xiao Q, Yu Z, Mao A, Ni Y, Zhang X, Li B, Wang X, Guo R, Zhou J, Lv L, Jiang J (2012) A novel porcine circovirus-like agent P1 is associated with wasting syndromes in pigs. PLoS One 7(8):e41565 23. Wen L, He K, Yang H, Ni Y, Zhang X, Guo R, Pan Q (2008) Complete nucleotide sequence of a novel porcine circovirus-like agent and its infectivity in vitro. Sci China C Life Sci 51(5): 453–458 24. Wen L, He K, Yang H, Yu Z, Mao A, Zhong S, Ni Y, Zhang X, Li B, Wang X, Zhou J, Guo R, Lv L, Jiang J (2011) Prevalence of porcine circovirus-like agent P1 in Jiangsu, China. Virol J 8: 543–547 25. Wen L, He K, Yu Z, Mao A, Ni Y, Zhang X, Guo RL, Li B, Wang X, Zhou J, Lv L (2012) Complete genome sequence of a novel porcine circovirus-like agent. J Virol 86(1):639
