Reports

Reports

Reports Isolation of fungal homokaryotic lines from heterokaryotic transformants by sonic disruption of mycelia. Zafer Dallal Bashi1,2, George Khachatourians2, and Dwayne Daniel Hegedus1,2 1Agriculture and Agri-Food Canada, Saskatoon, SK, Canada and the 2Department of Food and Bioproduct Sciences, University of Saskatchewan, Saskatoon, SK, Canada BioTechniques 48:XXX-XXX ( January 2010) doi 10.2144/000113243 Keywords: Sclerotinia sclerotiorum; fungal transformation; sonication; karyotype

Fungal hyphae—and in some cases, spores—are multi-nucleate. During genetic transformation of these spores or mycelia, only one nucleus generally receives the transferred T-DNA generating heterokaryotic colonies. Characterization of genetic changes, such as the effects of gene disruption in the transformants, requires purified homokaryotic lines. Hyphal tip transfer has conventionally been used to isolate homokaryons. We developed an alternative method for purification of fungal homokaryons from transformed heterokaryotic lines of Sclerotinia sclerotiorum. Ultrasound pulses were used to generate bi-septate, unicellular hyphal fragments that regenerate under selection to produce homokaryotic lines that can be easily identified using colony PCR. This technique facilitates the purification of transformed lines, which allows for routine genome manipulation, and it should be adaptable for other filamentous fungi.

Introduction

Functional characterization of genes requires the development of mutant lines that disrupt or precisely alter the function of the resultant protein. In this context, simple and reliable genetic transformation systems are required. Traditionally, fungal spheroplasts or protoplasts were transformed by electroporation (1,2) or other means such as polyethylene glycol (3). However, protoplasts can be difficult to produce in some species and the activity of cell wall–degrading enzyme varies between lots and thereby requires ongoing optimization (4,5). As such, methods for the direct transformation of intact fungal mycelia or spores, such as biolistic transformation (6,7), are more desirable. de Groot and colleagues (8) reported the first use of Agrobacterium tumefaciens, historically used for plant transformation, as a vehicle Vol. 48 | No. 1 | 2010

for the introduction of DNA into fungi. This method is 100–1000 times more efficient than conventional transformation approaches and has been used with many filamentous fungal species (9,10). Transformation of filamentous fungi often results in the uptake of the introduced DNA by only one of the nuclei, which leads to the formation of heterokaryons—cells in which two or more types of nuclei coexist. In addition, the plasmid DNA can integrate into the chromosome by either homologous or ectopic recombination (11). To perform reliable genetic analyses, homokaryotic clones must be isolated. In Neurospora crassa, this was achieved through multiple rounds of single spore isolation (12). The hypha of ascomycetes usually contains a single nucleus near the tip (13,14) and therefore hyphal tip transfer can be used for purification of genetic clones (15). Three to five rounds of hyphal tip transfer are usually

351

required to isolate pure homokaryons and only trained individuals with excellent motor skills can perform this technique. Sclerotinia sclerotiorum is an important plant pathogen that can infect over 400 different hosts, including important crops (16). Protocols for transformation of ascospores and mycelia using A. tumefaciens have been established (17,18); however, these tissues are multi-nucleate and methods to isolate homokaryons are lacking. The carpogenic production of homokaryotic ascospores requires 4–40 weeks based on the isolate (19). Here we provide an alternative technique for homokaryon isolation that uses ultrasound pulses to generate bi-septate, unicellular structures. Clones derived from mycelial fragments having a single nucleus are then identified using colony polymerase chain reaction (PCR).

Materials and methods

Fungal transformation and detection of homo- and heterokaryons Sclerotinia sclerotiorum (Lib.) de Bary strain 1980 (No. 18683, ATCC, Manassas, VA, USA) was propagated in minimal salt– glucose (1% w/v) (MS-glu) broth as per Li et al. (20). Mycelia were blended for 10 s in a Waring blender [Q1] and transformed using A. tumefaciens strain AGL1 harboring the pCB301 binary vector containing a MAPKinase gene (Smk3, SS1G_05445.1; www.broad.mit.edu/annotation/genome/ sclerotinia_sclerotiorum) [Q2], which was disrupted with a transposon carrying a hygromycin resistance cassette (hph). The transformation was carried as per Liberti et al. (18). Briefly, mycelia grown in MS-glu media for 4 days in the dark were blended in a Waring blender for 5 s, pelleted by centrifugation and resuspended in 2 mL induction medium (IM) [Q3] per 0.5 g mycelial wet weight. A. tumefaciens AGL-1 containing the transformation construct pCB301Smk3υ (Figure 1) was grown in minimal media for 1 day at 27°C with aeration. This culture was used to inoculate IM containing kanamycin (50 μM) and acetosyringone (200 μM) and grown to an OD600 of 0.3. Blended mycelia was diluted 1/100 in IM and mixed with an equal volume of A. tumefaciens, spread onto a cellophane membrane overlaid onto co-cultivation medium [Q4] and incubated in the dark at 20°C for 3 days. Filters were transferred to MS-glu agar medium containing hygromycin (100 μg/mL), cefotaxime (200 μM) and moxalactum (100 μM) and incubated at 20°C for 3 days. Fungal colonies that were resistant to hygromycin after three rounds of subculturing were tested by PCR. Plugs containing colonies were transwww.BioTechniques.com

Reports

ferred to minimal salt–glucose–hygromycin (MS-glu-hyg; 100 μg/mL) [Q5] liquid medium and incubated as above for 3 days. Nucleic acids were extracted by transferring a 500 μL wet volume of mycelia to a 1.5 mL microcentrifuge tube and centrifuging at 13000 rpm for 2 min. The supernatant was removed and the tissue ground for 15 s using a pestle. Subsequently, 400 μL extraction buffer (200 mM Tris-HCl pH 8.0, 250 mM NaCl, 25 mM EDTA, 0.5% SDS) was added and the solution mixed with a vortex for 5 s and then centrifuged at 13000 rpm for 1 min. Three hundred microliters of the supernatant were transferred to a tube containing 300 μL isopropanol. The DNA precipitated at room temperature for 2 min followed by centrifugation for 5 min at 13000 rpm. The pellet was washed once with 75% ethanol, air-dried for 5 min, and dissolved in 50 μL ddH20. PCR was used to test for (i) homologous integration of the Smk3υ construct into the Smk3 gene and (ii) whether the resultant colony contained homo- or heterokaryotic mycelia. Homologous integration was examined using two sets of primers complementary to the hph cassette and either the 5′ or 3′ untranslated region (UTR) of the Smk3 gene, both of which were outside of the region used to construct pCB301-Smk3υ [Q6]. The first combination consisted of Pmod Seq R (5′-GAGCCAATATGCGAGAACACCCGAGAA-3′) and Smk3 5′ (5′-CCTCAACCTCAACCAACCTCAA-3′), while the second consisted of Pmod Seq F (5′-GCCAACGACTACGCACTAGCCAAC-3′) and Smk3 3′ (5′-TCGGGAATCTTGTATCATACGCTTA-3′). The presence of non-recombinant nuclei containing the wild-type Smk3 gene was evaluated using primers complementary to the 5′ UTR and 3′ UTR, again outside of the region used to construct pCB301-Smk3υ. The product amplified from the 5′ flanking region was sequenced to confirm that the construct had integrated properly. Amplification of a region of the SsNep1 gene (encoding the necrosis and ethylene-inducing peptide 1) [Q7]( SS1G_03080.1 [Q8]) using the SsNep1 F (5′-GGAATTCCATATGCTCCAGTCGAGGG -3′) and SsNep1 R (5′-CCGCTCGAGTTAGATTTGTGCCTCTG-3′) primers served as control for the PCR. The PCR reaction mixture contained 2.5 μL 10× buffer, 2 μL dNTPs (5 mM each), 2 μL forward primer (2.5 mM), 2 μL reverse primer (2.5 mM), 0.5 μL rTaq polymerase I, 2 μL containing 500 ng genomic DNA, and 14 μL dH20. S. sclerotiorum wild-type DNA was used as a PCR Vol. 48 | No. 1 | 2010

Figure 1. Transformation of S. sclerotiorum using A. tumefaciens. Upper panel: Diagram of the pCB301-Smk3υ plasmid based on the plant transformation vector pCB301 (26). The region of the Smk3 gene comprising the open reading frame was inserted into the pCB301 multiple cloning site and disrupted using the EZ::TNTM system (Epicenter Biotechnologies, Madison, WI), using the pSK846 transposon containing a chloramphenicol/hygromycin B resistance cassette (18). Primer used to analyze the resultant transformants by PCR and location is indicted with an arrow. CmR, chloramphenicol resistance gene; HgR, hygromycin resistance gene; KnR, kanamycin resistance gene; LB, left border; ORF, open reading frame; PTrpC, promoter from the Aspergillus nidulans TrpC gene; RB, right border. Lower panel: Detection of the Smk3 gene and Smk3υ alleles in wild-type and transformed lines (indicated). The ratio of Smk3: Smk3υ PCR product reflects the fraction of non-transformed nuclei in the heterokaryon. Amplification of the single-copy SsNep1 gene was used as a genomic DNA control.

control. The PCR conditions used were as follows: initial denaturation at 94°C for 5 min; followed by 27 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s; and a final extension of 72°C for 7 min. Isolation and analysis of homokaryotic lines Five 3-mm plugs from the growing margin of colonies resistant to hygromycin after three rounds of subculturing were transferred to 25 mL of MS-glu-hyg medium in a 125 mL Erlenmyer flask and incubated at 20°C for 24 h with shaking at 80 rpm. One hundred milligrams of mycelia (wet weight) were transferred to 900 μL MS-glu medium in a 1.5 mL microcentrifuge tube and subjected to a range of sonication periods to determine the optimal time for fragmentation. Ultrasound pulses did not exceed 10 s and samples that were sonicated for longer than 10 s in total were allowed to cool for 10 s between pulses. A Misonix S-4000 sonicator (Qsonica, Newtown, CT, USA) with a frequency of 20 kHz set at 25 W was used. The degree of mycelial fragmentation was assessed by light microscopy. The concentration of intact bi-septate fragments (those bounded by single septae

352

at their termini) was determined using a hemocytometer. Samples with the highest number of bi-septate fragments and the lowest number of multicellular hyphae were plated onto MS-glu-hyg selection medium and incubated at 20°C for 5 days. Mycelia and mycelial fragments were also stained with Calcofluor White (Invitrogen [Q9]) and 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich [Q10]) according to the manufacturer’s instructions and viewed using a fluorescence microscope [Q11] to visualize septae and nuclei, respectively. Transformants were also examined to determine whether they were unable to produce transcript from the disrupted Smk3 gene (Smkυ). For reverse transcription PCR (RT-PCR) analysis, mRNA was converted to cDNA using the Superscript First Strand Synthesis System (Invitrogen) followed by PCR using the Smk3 F (5′ TTGATGTATGGTCAGTAGGGTG 3′) and Smk3 R (5′ GCTTCTTGTGGTCTCGG 3′). Amplified transcripts from the S. sclerotiorum actin gene using SsAct F (5′-ACCATCTGTCTTGGGTCTTGAG-3′) and SsAct R (5′- G ATACC TG G G TAC ATG G TAGTTCC-3′) were used as a control. www.BioTechniques.com

Reports

Using a 1/20th dilution of cDNA as a template, PCR conditions were: initial denaturation at 94°C for 5 min; followed by 50 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s; and a final extension of 72°C for 7 min. [Q12]

Results and discussion

In order to provide a proof-of-principle that homokaryotic strains can be generated using

this technique, the Smk3 gene was chosen for the generation of a gene replacement strain. Smk3 is homologous to the Botrytis cinerea bpm3 gene, which encodes a MAP kinase involved in cell wall formation and response to contact with solid surfaces (21) and is therefore important for pathogenicity. S. sclerotiorum mycelial fragments were transformed using the A. tumefaciens delivery method with a construct designed to disrupt the Smk3 open reading frame.

Figure 2. Fragmentation of S. sclerotiorum mycelia by sonication. Panels show mycelial fragments generated by increasing exposure to ultrasound pulses (with duration ranging 0–30 s [Q16]). Mycelia were stained with Calcofluor White and DAPI followed by fluorescence microscopy to reveal the location of septae (S) and nuclei (N). The 20-s pulse generated the highest number of intact bi-septate fragments and hyphal tips (HT). Scale bar, 20 μm.

Figure 3. Determination of the purity of S. sclerotiorum Smk3υ clones. Upper panel: Primers flanking the Smk3 gene were used to detect nuclei containing the wild-type Smk3 gene. Amplification of the single-copy SsNep1 gene was used as a genomic DNA control. Lower panel: PCR analysis of regions flanking the disruption cassette in two homokaryotic Smk3υ clones, and RT-PCR analysis to detect transcripts from Smk3 and SsActin genes in wild-type and Smk3υ clones.

Vol. 48 | No. 1 | 2010

353

Five transformed colonies were tested, all of which were found to possess a mixture of nuclei containing the Smk3υ cassette and the wild-type Smk3 allele (Figure 1). In all of the transformants, the Smk3υ cassette had integrated through homologous recombination. Amplification of the single-copy gene SsNep1 [Q13] was used as an internal control for gene copy number. A similar amount of SsNep1 product was amplified from each of the samples tested. This demonstrated that the ratio of Smk3υ to wild-type Smk3 product could be used to estimate the relative proportion of each type of nucleus in the line tested. Those lines with the least amount of wild-type nuclei (i.e., the highest ratio of Smk3υ to Smk3 product) were selected for development of homokaryotic lines. Previous reports described that sonication depending on the dose applied could be used to separate compartmentalized units of bacterial cells (22) or break up mycelial aggregates to allow extraction of cell components (23). In this study, mycelia from individual colonies were fragmented by sonication to generate bi-septate fragments. A range of sonication times were applied to select the optimal sonication conditions (Figure 2). For S. sclerotiorum, two 10-s sonication pulses were sufficient to produce the maximal number of intact bi-septate fragments. Post-sonication quality assurance using the microscope was necessary since inadequate sonication periods are counterproductive (they can lead to multicellular structures that would develop heterokaryotic colonies). Sonication for longer periods led to complete destruction of the mycelia (Figure 2) and colonies could not be regenerated. While ultrasound intensities twice that used here led to chromosome non-disjunction in diploid Aspergillus nidulans nuclei, it was not mutagenic (24) and therefore this procedure is unlikely to introduce background point mutations. Hyphal tip isolation has been traditionally used for the purification of homokaryons. Staining with Calcofluor White and DAPI revealed that the bi-septate fragments and hyphal tips were multi-nucleate. In the synchronous model for mitosis, a wave of mitosis progresses from the nucleus closest to the tip so that sister nuclei located nearest the tip are of the same genotype (25). Branch formation and mitosis are also closely coordinated, and new branches acquire one or a few seed nuclei that subsequently undergo mitosis. In either case, this increases the likelihood that new hyphal tips or branches will possess nuclei of the same genotype. The karyotype of colonies regenerated from the www.BioTechniques.com

Reports

mycelial fragments on selective medium was established using PCR to amplify the two Smk3 alleles. Of the colonies examined, all contained mycelia having nuclei with only the Smk3υ allele and were presumably homokaryotic (Figure 3) [Q14]. This indicates that the multiple nuclei observed in the bi-septate fragments and hyphal tips were derived from the same progenitor nucleus and that the original heterokaryotic colonies contained a mixture of homokaryotic mycelia containing nuclei with either the wild-type or Smk3υ allele. Sequencing the region flanking the disruption cassette confirmed that it had faithfully integrated into the Smk3 gene via homologous recombination. The absence of Smk3 gene expression as demonstrated using RT-PCR provided confirmation of the homokaryotic state. In addition, the Smk3υ lines exhibited phenotypes expected to be associated with disruption of this gene including lack of sclerotia formation and reduced virulence which was not the case for the heterokaryotic lines (data not shown). In summary, sonic disruption of mycelia for homokaryon isolation is a versatile method that requires only limited skill and can generate unicellular structures far quicker than traditional hyphal tip transfer. Typically, we found that homokaryotic clones could be isolated from heterokaryotic transformants within 4 days. While this method has only been tested with S. sclerotiorum, it is reasonable to assume that it could be easily adapted to other filamentous fungi.

Acknowledgments [Q15]

Competing interests

The authors declare no competing interests.

References

1. Chakraborty, B.N. and M. Kapoor. 1990. Transformation of filamentous fungi by electroporation. Nucleic Acids Res. 18:6737. 2. R iche y, M .G ., E .T. Ma rek, C . L . Schardl, and D.A. Smith. 1989. Transformation of filamentous fungi with plasmid DNA by electroporation. Phytopathology 79:844-847. 3. Riach, R. and R. Kinghorn. 1996. Genetic transformation and vector developments in filamentous fungi. In C.J. Bos (Ed.) Fungal Genetics: Principles and Practice. Marcel Dekker, New York. 4. Tschen, J.S.-M. and I.-F. Li. 1994 . Optimization of formation and regeneration of protoplasts from biocontrol agents of Trichoderma species. Mycoscience 35:257-263.

Vol. 48 | No. 1 | 2010

5. Wiebe, M.G., M. Novákova, L. Miller, M.L. Blakebrough, G.D. Robson, P.J. Punt, and A.P.J. Trinci. 1997. Protoplast production and transformation of morphological mutants of the Quorn myco-protein fungus, Fusarium graminearum A3/5, using the hygromycin B resistance plasmid pAN7-1. Mycol. Res. 101:871-877. 6. Christiansen, S.K., S. Knudsen, and H. Giese. 1995. Biolistic transformation of the obligate plant pathogenic fungus Erysiphe graminis f.sp. hordei. Curr. Genet. 29:100-102. 7. Aly, R., N. Halpern, B. Rubin, E. Dor, S. Golan, and J. Hershenhorn. 2001. Biolistic transformation of Cercospora caricis, a specific pathogenic fungus of Cyperus rotundus. Mycol. Res. 105:150-152. 8. de Groot, M.J., P. Bundock, P.J. Hookykaas, and A.G. Beijersbergen. 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16:839842. 9. Utermark, J. and P. Karlovsky. 2008. Genetic transformation of filamentous fungi by Agrobacterium tumefaciens. Nature Protocols Network. doi 10.1038/nprot.2008.83. 10. Michielse, C.B., P.J. Hooykaas, C.A. van den Hondel, and A.F. Ram. 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48:1-17. 11. Dev, K. and R . Maheshwari. 20 02 . Transformation in heterokaryons of Neurospora crassa is nuclear rather than cellular phenomenon. Curr. Microbiol. 44:309-313. 12. Fincham, J.R . 1989. Transformaiton in fungi. Microbiol. Rev. 53:148-170. 13. Roberson, R.W. and M.S. Fuller. 1988. Ultrastructural aspects of the hyphal tip of Sclerotium rolfsii preserved by freeze substitution. Protoplasma 146:143-149. 14. Trigiano, R ., M. Windham, and A. Windham (Eds.). 2004. Plant Pathology: Concepts and Laboratory Exercises, 2nd ed. CRC Press, Boca Raton, FL. 15. L esl ie, J., A . Su m merel l, a nd S . Bullock. 2006. The Fusarium Laboratory Manual, Wiley-Blackwell, Hoboken, NJ. 16. Bolton, M.D., B.P.H.J. Thomma, and B.D. Nelson. 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Mol. Plant Pathol. 7:1-16. 17. Weld, R.J., C.C. Eady, and H.J. Ridgway. 2006. Agrobacterium-mediated transformation of Sclerotinia sclerotiorum. J. Microbiol. Methods 65:202-207. 18. Liberti, D., S.J. Grant, U. Benny, J.A. Rollins, and K.F. Dobinson. 2007. Development of an Agrobacterium tumefaciens mediated gene disruption method for Sclerotinia sclerotiorum. Can. J. Plant Pathol. 29:394400. 19. Smith, E.A. and G.J. Boland. 1988. A reliable method for the production and maintenance of germinated sclerotia of Sclerotinia sclerotiorum. Can. J. Plant Pathol. 11:45-48. 20. Li, R., R. Rimmer, L. Buchwaldt, A. Sharpe, G. Seguin-Swartz, and D. Hegedus. 2004. Interaction of Sclerotinia sclerotiorum with Brassica napus: cloning and characterization of endo-and exo-polygalacturonases expressed during saprophytic and parasitic modes. Fungal Genet. Biol. 41:754-765.

354

21. Rui, O. and M. Hahn. 20 07. The Slt2-type MAP kinase Bmp3 of Botrytis cinerea is required for normal saprotrophic growth, conidiation, plant surface sensing and host tissue colonization. Mol. Plant Pathol. 8:173184. 22. K h a c h a t ou r i a n s , G .G . a nd C . A . Saunders. 1973. A new method for preparation of minicells for physiological studies. Prep. Biochem. 3:291-298. 23. Wise, D.L., D.J. Trantolo, E.J. Cichon, H.I. Inyang, and U. Stottmeister (Eds.). 2000. Bioremediation of Contaminated Soils. Marcel Dekker, New York. 24. Houghton, J.A. and J. O’Dowd. 1979. The effect of ultrasound on genetic instability in diploids of Aspergillus nidulans. Folia Microbiol. (Praha) 24:385-388. 25. Harris, S.D. Mitosis in f ilamentous fungi. 2006. In U. Kües and R. Fischer (Eds.) The Mycota: Growth, Differentiation and Sexuality, 2nd ed. Springer-Verlag, Berlin. 26. Xiang, C., P. Han, I. Lutziger, K. Wang, and D.J. Oliver. 1999. A mini binary vector series for plant transformation. Plant Mol. Biol. 40:711-717. Received 21 April 2009; accepted 29 October 2009. Address correspondence to Dwayne Hegedus, Agriculture and Agri-Food Canada, 107 Science Place Saskatoon, SK, Canada, S7N 0X2. email: [email protected]

www.BioTechniques.com