RGS18 Acts as a Negative Regulator of ... - Wiley Online Library

Download PDF
8 downloads 180708 Views 4MB Size Report
Comment
Jun 18, 2007 - cells that are differentiated from hematopoietic mac- rophage/monocyte .... (Adobe Photoshop v 7.0.1; Adobe Systems). RNA interference ...
JOURNAL OF BONE AND MINERAL RESEARCH Volume 22, Number 10, 2007 Published online on June 18, 2007; doi: 10.1359/JBMR.070612 © 2007 American Society for Bone and Mineral Research

RGS18 Acts as a Negative Regulator of Osteoclastogenesis by Modulating the Acid-Sensing OGR1/NFAT Signaling Pathway Kaori Iwai,1 Masato Koike,2 Shiro Ohshima,1 Kunio Miyatake,3 Yasuo Uchiyama,2 Yukihiko Saeki,1 and Masaru Ishii1

ABSTRACT: We showed that RGS18, a myeloid lineage-specific RGS protein that is inhibited after activation of the RANK/RANKL system, is a negative regulator of osteoclastogenesis. RGS18 acts through an external acidosis-sensing osteoclastogenic mechanism through the OGR1/NFAT pathway. Introduction: Osteoclasts are bone-resorbing multinuclear giant cells that are differentiated from mononuclear macrophage/monocyte lineage precursors stimulated by the RANK/RANKL system. The regulators of G-protein signaling (RGS) family is a diverse group of proteins that accelerate intrinsic GTP hydrolysis on heterotrimeric G-protein ␣ subunits and play crucial roles in physiological regulation of G-protein–mediated cell signaling in various tissues and organs. We examined the expression and function of RGS18, a myeloid lineage-specific RGS protein, during osteoclastogenesis. Materials and Methods: A macrophage/monocyte lineage cell line, RAW264.7, and primary osteoclast precursor monocytes derived from mouse bone marrow cultured with macrophage-colony stimulating factor (M-CSF) (bone marrow–derived monocytes [BMMs]) were used in this study. Both cell types differentiate into osteoclast-like cells on activation by RANKL. Expression of different RGS proteins, including RGS18, was assessed by gene-specific RT-PCR. The subcellular distribution of RGS18 on native osteoclasts in bone tissues, as well as in RAW264.7 cells, was examined by immunohistochemistry using a specific polyclonal antibody. Short interfering RNA against RGS18 was used to inhibit the function endogenous RGS18 in these cell types. Activation of NFATc1, an osteoclastogenic transcription factor, on external acidosis was assessed by visualizing the nuclear localization of NFATc1 visualized with anti-NFATc1 antibody. Results: RAW264.7 and BMM cells both expressed mRNA for 10 different mammalian RGS proteins, including RGS18. Expression of RGS18 is significantly inhibited by RANKL both cell types, and inhibition of RGS18 function using RNA interference prominently enhanced osteoclastogenesis on stimulation with RANKL. The effect of RGS18 inhibition was reversed by blocking of proton-sensing OGR1 signaling, and overexpression of exogenous RGS18 inhibited extracellular acidosis-mediated NFATc1 activation. Immunohistochemical studies of mouse bone tissues revealed expression of RGS18 in osteoclasts in vivo. Conclusions: RGS18 acts as a negative regulator of the acidosis-induced osteoclastogenic OGR1/NFAT signaling pathway, and RANKL stimulates osteoclastogenesis by inhibiting expression of RGS18. Therefore, the results suggest a novel control mechanism of osteoclastogenesis by RGS proteins. J Bone Miner Res 2007;22:1612–1620. Published online on June 18, 2007; doi: 10.1359/JBMR.070612 Key words: osteoclast, G-protein, regulator of G-protein signaling protein, acidosis, OGR1 INTRODUCTION

O

STEOCLASTS ARE BONE-RESORBING multinuclear giant cells that are differentiated from hematopoietic macrophage/monocyte lineage precursors and play crucial roles in bone remodeling.(1–3) Osteoclastogenesis is mainly regulated by the RANK/RANKL system. It has recently been shown that the transcription factor, NFATc1 (NFAT2) is most strongly induced by stimulation with RANKL and is essential for osteoclastogenesis.(4,5) However, the regulatory mechanisms of osteoclastogenic signaling cascades are not fully understood.

The authors state that they have no conflicts of interest.

Several reports have shown a crucial involvement of ovarian cancer G-protein–coupled receptor 1 (OGR1, or GPR68) in regulation of osteoclastogenesis.(6,7) OGR1 is a histidine-enriched heterotrimeric G-protein–coupled receptor that acts as a proton-sensor for stimulation of the Gq-inositol phosphate pathway in response to external acidosis.(8) OGR1 is expressed in osteoclasts and contributes to intracellular calcium mobilization, leading to NFATc1 activation on extracellular acidification.(6) Expression of OGR1 is enhanced by stimulation with RANKL, and targeted inhibition of OGR1 by neutralizing antibody or RNA interference suppresses RANKL-induced osteoclastogenesis.(7) This series of studies has led to the suggestion of pivotal roles of heterotrimeric G-protein signaling, such

1 Department of Clinical Research, National Hospital Organization, Osaka, Japan; 2Department of Anatomy and Cell Biology, Osaka University Graduate School of Medicine, Osaka, Japan; 3National Osaka-Minami Medical Center, National Hospital Organization, Osaka, Japan.

1612

RGS18 DURING OSTEOCLASTOGENESIS TABLE 1. PRIMER PAIRS USED

RGS1 RGS2 RGS3 RGS3L* RGS4 RGS5 RGS6 RGS7 RGS8 RGS9 RGS10 RGS11 RGS12 RGS13 RGS14 RGS16 RGS17 RGS18 RGS19 RGS20 GAPDH

1613 FOR

RT-PCR

TO

DETECT mRNA

OF

RGS PROTEINS

Forward (5⬘-3⬘)

Reverse (5⬘-3⬘)

bp

TTGAATTCTGGTTGGCTTGTG GACCCGTTTGAGCTACTTCTTG TCCCGGAAGAGAAAGAGCAAAAA TTCACCCCGCACCCTCAAAA TGCAAGCAACAAAAGAGGTGAA AGCCGCCAGCCAAAATGTGTA GGGGCGGGACCAGTTCCTCAGAT ACCCATTTCTTGTGCCGCCTGACC GACAAACCCAACCGCGCTCTCAAG TACCGGACTGGAAAGGAAAGGAAC GAGCCTTAAGAGCACAGCCAAGTG TCAGTGCGGAAAACCTCA ATCGAAATGTTAGAAAGACCAAAGAAGAC AGCAGGCATATCTGTTGGAT TCAGCGCAGAGAACGTAACTTT TGCCGCACCCTAGCCACCTTC GGAAACCAAAGGCCCAACAATAC GCCAAAATCAGAGCGAAAGA ACGGGCCGCAGTGTATTCC AGAAGACCAGAGACCCCAAAGAGC ACCACAGTCCATGCCATCAC

TTGATTTCAGGAACCTGGGATAA CCGTGGTGATCTGTGGCTTTTTAC ATGCCTGGATCGCGATGTATTCA AAGCCTGGATTGCGATGAATTCA CCCCGCAGCTGGAAGGAT CAAAGCGGGGCAGAGAATCCT CCCGCCAGCGACTTTCCCTTCT TTTTCCCTTTCTCTTTGCCTGTAG CGTGGCCTCTCGGGTCTGGAAATC ACCTGGGGCCAGGAACAGC GTGGCTCTTCCAGAATCTTTTCAG CCGCAAGAATGGAAATG ATGGAGAACCCGGACTTGACAGCA GTATACAATCTTCTGAGCTT TGGGCCAGCACCTCCTCACTAA TTCGCTGCGGATGTACTCGTCAAA ATCATCCTGGCCTTTTCTTCAACA GTGCCGTATCAAAACTGTGGAG CCGGTGCATGAGGGTGTAGAT AGTTCATGAAGCGGGGATAGGAGT TCCACCACCCTGTTGCTGTA

246 494 349 473 192 525 352 485 288 654 579 335 1105 380 181 369 350 421 276 434 452

The expected molecular weight in base pairs is indicated. The presence of mRNA for GAPDH was detected as a control. * RGS3L is a “long” splice isoform of RGS3.(21)

as that stimulated by OGR1 in the regulation of the osteoclastogenic RANKL–NFATc1 axis. Heterotrimeric G-proteins mediate different intracellular signaling cascades and regulate a number of cellular functions.(9) Numerous kinds of G-protein–coupled receptors and effectors have been identified, but regulators of the G-protein cycle have been relatively neglected. However, a family of cytosolic proteins named “regulators of G-protein signaling” (RGS) proteins has recently been identified.(10,11) These proteins share a conserved “RGS domain” of ∼120 amino acids, which is responsible for accelerating GTPase activity on the G-protein ␣ subunit.(12–14) RGS proteins are thought to play a central role in physiological regulation of the G-protein cycle, and their importance in cell signaling has been confirmed in various hematopoietic cells.(15–19) To date, >20 mammalian RGS proteins have been identified. These proteins vary in their molecular structure, tissue distribution, and intracellular localization, and thus are likely to play divergent functional roles in different tissues.(13,14) In this study, we examined the expression and function of RGS proteins in the regulation of osteoclastogenic OGR1/RANKL/NFATc1 signaling cascades.

MATERIALS AND METHODS Cell culture RAW264.7, a murine macrophage/monocyte lineage cell line, was obtained from ATCC (ATCC: TIB-71) and cultured with ␣-MEM (Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inactivated FCS (HyClone, Logan, UT, USA) and penicillin/streptomycin (Invitrogen). Mouse bone marrow–derived monocytes (BMMs) containing osteoclast precursor cells were obtained from male

C57BL/6J mouse bone marrow cultured with 100 ng/ml macrophage-colony stimulating factor (M-CSF; R&D Systems, Minneapolis, MN, USA), as previously described.(20) To differentiate the cells into multinuclear osteoclast-like cells (OCLs), 50 ng/ml RANKL (PeproTech, Rocky Hill, NJ, USA) was added to the medium, and the cells were incubated for 4 days. In some experiments, 200 ng/ml pertussis toxin (PTX; List Biological Laboratories, Campbell, CA, USA) was added to the culture medium 24 h before activation by RANKL. ZnCl2 (100 ␮M) and anti-OGR1 neutralizing antibody (2 ␮g/ml; ExAlpha Biologicals, Watertown, MA, USA, and MBL, Nagoya, Japan) were added simultaneously with RANKL. For evaluation of OCL formation, the cells were fixed in citrate acetone fixative and stained using a TRACP staining kit (Sigma-Aldrich, St Louis, MO, USA). Nuclei of multinucleated (more than four nuclei) TRACP+ cells were counted under light microscopy.

RT-PCR amplification Total RNAs from RAW264.7 and BMM cells were extracted using TRIzol reagent (Invitrogen), and cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen), according to the manufacturer’s protocol. To eliminate contamination of genomic DNA, RNA samples were treated with DNase I (Takara, Kyoto, Japan) before cDNA synthesis. Specific primer pairs (Tables 1 and 2) were used to amplify the cDNA.(21) PCR amplification was performed for 25 cycles at 95°C for 45 s, at 55°C for 30 s, and at 72°C for 1 min. The products were electrophoresed on a 2% agarose gel. Bands were visualized with a transilluminator, and images were acquired using an image acquisition system with a CCD (LAS-3000; Fuji Photo Film Co., Tokyo, Japan) equipped with acquisition software (Fujifilm

1614

IWAI ET AL.

TABLE 2. PRIMER PAIRS USED

Gi␣1 Gi␣2 Gi␣3 Go␣ Gq␣ G11␣

FOR

RT-PCR

TO

DETECT mRNA

OF

G-PROTEIN ␣ SUBUNITS

IN THE

Gi

AND

Gq SUBFAMILIES

Forward (5⬘-3⬘)

Reverse (5⬘-3⬘)

bp

ACTTCGGAGACTCTGCTCGG AGAGGAACAAGGGATGCTTC TATGGCGAGATGGCGGGGTA TCAAAGAAGATGGCATCAGC TCATGCACAATTGGTTCGAG TCAACGCGGAGATCGAGAAA

TAGCATATCGTGAGGGGGCT GCTGGCTGCCTCGTCGTACT ATAACAGATTGTTAATGGAC GAGTCGAAGAGCATGAGAGA GGGAATACATGATTTTCTCC CTGGTGCTCAAAAGTTGTGA

584 566 473 691 536 320

The expected molecular weight in base pairs is indicated.

Image Reader; Fuji Photo Film Co.). Nucleotide sequencing of the amplified PCR products was performed using ABI Dye terminator cycle sequencing with an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).

Quantitative real-time PCR Relative quantification with real-time RT-PCR was performed using an ABI PRISM 7900 (Applied Biosystems) with an Assay-on Demand TaqMan probe and relevant primers (RGS18, Assay ID Mm00491661_m1; RGS2, Assay ID Mm00501385_m1; RGS19, Assay ID Mm00458977_m1; GAPDH, Assay ID Mm99999915_g1), according to the manufacturer’s instructions. Isolation of total RNA from RAW264.7 and BMM cells and cDNA synthesis were performed as described above. Each sample was assayed in triplicate, and the median threshold cycle (Ct) value was used to calculate the relative concentration of transcripts. Values were normalized against the level of GAPDH.

Immunocytochemistry RAW264.7 and BMM cells were fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2) at 4°C for 2 h. After the cells were washed twice with PBS containing 0.1% Triton X-100 (PBST) for 5 min each, they were treated with 5% (vol/vol) goat serum and 5% (wt/vol) BSA in PBST (IH solution) at room temperature for 60 min and incubated with anti-mouse RGS18 rabbit polyclonal antibody (Imgenex, San Diego, CA, USA; 1:100) in IH solution at 4°C overnight. The samples were washed three times with PBST at room temperature for 30 min each and exposed to a secondary antibody, Alexa488-labeled goat antirabbit IgG antibody (Molecular Probes, Eugene, OR, USA). After two washes with PBST, the sample was incubated with 4⬘,6-diamino-2-phenylindole (DAPI) in PBS (1: 5000) for staining of nuclei. The cells were observed using a laser scanning confocal microscope (LSM5 Pascal; Carl Zeiss, Jena, Germany) equipped with a ×63 oil-immersion objective lens (Plan-Apochromat, Carl Zeiss; N.A. 1.40) and with 405-nm blue diode and 488-nm Argon lasers. RGB images were acquired on-line using LSM acquisition software (Carl Zeiss), and the color channels were divided for presentation using commercially available software (Adobe Photoshop v 7.0.1; Adobe Systems).

RNA interference against RGS18 A small interfering RNA duplex (siRNA) targeting RGS18 and a control RNA duplex (scrambled sequence)

was purchased from B-Bridge International (Sunnyvale, CA, USA): RGS18 siRNA, 5⬘-GCCATTTGGTTATGAGTAATT-3⬘ (nucleotides 694–712 of mouse RGS18), control, 5⬘-TATTATTAGGGTCGTAACG-3⬘. The synthesized 21-mer sense and antisense RNA strands were hybridized and transfected into RAW264.7 cells using LipofectAmine2000 (Invitrogen) according to the manufacturer’s instructions. After transfection, the cells were incubated for 3 days in ␣-MEM supplemented with 10% FCS and antibiotics. The cells were observed using an inverted differential interference microscope (IX-71; Olympus, Tokyo, Japan) equipped with a ×20 objective lens (UPLSAPO, Olympus; N.A. ∼0.75), and the image was acquired on-line using a cooled CCD (ORCA 3CCD; Hamamatsu Photonics, Hamamatsu, Japan) and processed with data acquisition software (Aquacosmos; Hamamatsu Photonics). A reduction of the amount of RGS18 mRNA in the siRNA-targeted cells was assessed by conventional RTPCR and quantitative real-time RT-PCR using RGS18specific primers and probes, as described above. For evaluation of OCL formation, the cells were fixed in citrate acetone fixative and stained with a TRACP staining kit (Sigma-Aldrich). Nuclei of multinucleated (more than four nuclei) TRACP+ cells were counted under light microscopy. More than 1000 cells in 10 different visual fields were counted in each experiment. The results were consistent in three independent experiments, and representative data are shown.

Transfection of RGS proteins and NFATc1 activation assay Full-length mouse RGS18, RGS2, and RGS19 (GAIP) cDNA was cloned by RT-PCR and subcloned into a commercially available mammalian expression vector pcDNA3 (Invitrogen). The plasmid and pEGFP-C1 (Clontech, Palo Alto, CA, USA) were transiently expressed in RAW264.7 cells using LipofectAmine2000 reagent (Invitrogen), according to the manufacturer’s instructions. Two days after transfection, the cells were preincubated for 75 min with 10% FCS-supplemented F-12 medium (Invitrogen), at a pH adjusted to 7.0 or 7.4 with HCl/NaOH and with bubbling of a 5% CO2/95% air mixture. The cells were fixed with 4% paraformaldehyde at room temperature for 30 min and immunostained with anti-NFATc1 antibody (clone 7A6; Santa Cruz Biotechnology; 1:100) and Alexa598-conjugated goat anti-mouse IgG (Molecular Probes), using the method described above. After immunostaining, the sample was incubated with DAPI in PBS (1:5000) for staining of nuclei.

RGS18 DURING OSTEOCLASTOGENESIS The cells were observed using a laser scanning confocal microscope (LSM5 Pascal; Carl Zeiss) equipped with a ×63 oil-immersion objective (Plan-Apochromat, Carl Zeiss; N.A. 1.40) and 405-nm blue diode, 488-nm Argon and 543nm He-Ne lasers. NFATc1 nuclear accumulation was assessed by immunofluorescence and analyzed densitometrically using NIH Image v. 1.62 software (NIH, Bethesda, MD, USA). To evaluate the results, >50 cells in 10 different visual fields were counted in one experiment. The results were consistent in three independent experiments, and representative data were shown.

Immunohistochemistry of mouse femoral bone tissues To perform immunohistochemical localization of RGS18 in bone tissue, three C57BL/6J mice were anesthetized deeply with pentobarbital (25 mg/kg, IP) and fixed by cardiac perfusion with 4% paraformaldehyde buffered with 0.1 M phosphate (pH 7.2) containing 4% sucrose. Femoral bones were excised and decalcified with 10% EDTA solution for 7 days. Samples were embedded in OCT compound (Miles, Kankakee, IL, USA) after cryoprotection with 15% and 30% sucrose solutions, cut into 10-␮m sections with a cryostat (CM3050; Leika, Nussloch, Germany), and placed on silane-coated glass slides and stored at −80°C until use. In the biotin-avidin method, the sections were first treated with methanol with 0.3% H2O2 to inactivate endogenous peroxidase activity in the tissues. After washing twice with PBS containing 0.1% Triton X-100 (PBST) for 5 min each, the sections were treated with 5% (vol/vol) goat serum and 5% (wt/vol) BSA in PBST (IH solution) at room temperature for 60 min and incubated with anti-RGS18 rabbit polyclonal antibody (Imgenex; 0.5 ␮g/ml) in IH solution at 4°C overnight. The sections were washed three times with PBST at room temperature for 30 min and exposed to the secondary antibody (biotin-labeled goat antirabbit IgG antibody (Vector, Burlingame, CA, USA). After three washes with PBST, the sections were incubated with streptavidin-peroxidase complex for 1 h at room temperature, and the enzyme reaction was developed with diaminobenzidine tetrahydrochloride (Dojindo, Kumamoto, Japan). In some experiments, nuclei were conterstained with hematoxylin. Images were acquired with an upright microscope (CX31; Olympus) equipped with a ×10 objective lens (UPLSAPO NA 0.40) and a digital camera (DP71; Olympus). Image data were acquired using commercially available software (Olympus). Fluorescent immunostaining of sections was performed as previously described.(22) To combine TRACP staining for identifying osteoclasts with immunohistochemostry in the same section, fluorescence-based staining for TRACP(23) was applied with some modifications. Briefly, sections were incubated for 15 min at 37°C with ELF 97 substrate (20 ␮M, E6588; Invitrogen) using the same buffer for the TRACP staining kit [104 mM acetate buffer, pH 5.2, 28 mM L(+)-tartrate buffer, pH 5.2]. Immunofluorescence was performed afterward. Sections were incubated with rabbit anti-RGS18 antibody (0.5 ␮g/ml) overnight at 4°C followed by Alexr488-conjugated goat anti-rabbit IgG an-

1615 tibody (Invitrogen). For control experiments, immunohistochemical staining with purified nonimmune rabbit IgG (control for anti-RGS18 rabbit polyclonal Ab) and fluorescent TRACP staining without ELF 97 substrate were performed. For staining nuclei, the samples were incubated with DAPI (Dojindo) or 7-AAD (Invitrogen) in PBS. Stained sections were mounted with an anti-fade solution and examined using confocal laser scanning microscopes, LSM5 Pascal (Carl Zeiss) or FV1000 (Olympus).

Statistics All results are expressed as the mean ± SE obtained from n experiments. Statistical differences were evaluated by unpaired Student t-tests. Probability values of p < 0.05 were considered significantly different.

RESULTS Expression profile of RGS proteins and alteration by RANKL Total RNA was extracted from RAW264.7 cells and mouse BMMs (which include many osteoclast precursor cells), cultured in the presence or absence of RANKL for 4 days. RT-PCR analyses were conducted with oligonucleotide primers for 20 different mammalian RGS proteins and GAPDH. Amplification products of the expected sizes were found for 10 RGS proteins (RGS1, 2, 3, 10, 11, 12, 14, 16, 18, and 19) in RAW264.7 cells and 9 (RGS1, 2, 3, 10, 12, 14, 16, 18, and 19) in BMM cells (Fig. 1A).(21) These products were confirmed by nucleotide sequencing. The presence of mRNA for GAPDH was examined as a control and was found to be of the expected molecular weight (Fig. 1A). On stimulation with RANKL, some RGS protein transcripts were upregulated, some were downregulated, and some were unchanged. For example, mRNA levels for RGS10 and RGS11 in RAW264.7 cells were increased, but these changes were not detected in BMM cells. In contrast, mRNA for RGS18 decreased in both cell types. RGS18 was of particular interest, because its expression level was consistently “downregulated” during RANKL-induced osteoclastogenesis, and because it reported to be expressed specifically in myeloid cell-lineage hematopoietic cells including megakaryocytes, which form a polykaryon, similarly to mature osteoclasts.(24–26) The expression level of RGS18 mRNA was examined quantitatively by real-time RT-PCR using a TaqMan probe and relevant primers (Fig. 1B). On stimulation of osteoclastogenic RANKL signaling, RGS18 mRNA was downregulated to 5.3 ± 4.2% in RAW264.7 cells and to 35.9 ± 12.1% in primary BMM cells, relative to controls. The change was highly significant in independent experiments (p < 0.01). Transcripts of other RGS proteins such as RGS2 and RGS19 (GAIP) were unaltered on stimulation by RANKL (Fig. 1B). The expression levels of RGS18 protein in RAW264.7 cells and BMM cells were assessed by immunocytochemistry using an anti-mouse RGS18 polyclonal antibody (Fig. 1C). Abundant RGS18 was detected under control conditions, and the protein level was decreased by RANKL. Fur-

1616

IWAI ET AL.

FIG. 1. Expression of RGS proteins in osteoclasts. (A) RT-PCR analysis of mRNA encoding 20 mammalian RGS proteins expressed in an osteoclast precursor cell line, RAW264.7 (left) and in mouse bone marrow–derived primary osteoclast precursor monocytes (BMMs) (right). These cells were cultured in the absence [RANKL(−)] or presence [RANKL(+)] of RANKL for 4 days. As a control, mRNA for GAPDH was detected. RT(+), PCR with synthesized cDNA; RT(−), negative controls without reverse transcriptase. The numbers on the left indicate the positions of molecular weight marker in base pairs. Lane 1, RANKL(−), RT(+); lane 2, RANKL(+), RT(+); lane 3, RANKL(−), RT(−); lane 4, RANKL(+), RT(−). (B) Quantitative real-time RT-PCR analysis of RGS18, RGS2, and RGS19 (GAIP) mRNA expressed in RAW264.7 cells and in murine primary BMMs, cultured in the absence (C) or presence (R) of RANKL. Error bars represent ± SE; *p < 0.05; ns, not significantly different. (C) Expression of RGS18 protein in RAW264.7 cells. Cells cultured in the absence (a and b) or presence (c and d) of RANKL (for 4 days) were fixed and stained using anti-RGS18 polyclonal antibody (rabbit) followed by Alexa488-conjugated anti-rabbit IgG secondary antibody. Nuclei were counterstained with DAPI. Scale bars (in c and e) represent 10 ␮m.

thermore, the RGS18 level was lower in cells undergoing cell fusion in response to RANKL stimulation. Similar changes in the level of RGS18 protein were also observed in primary BMMs. These RANKL-induced changes in RGS18 protein expression are consistent with the RT-PCR analysis in Figs. 1A and 1B. In addition, RGS18 was found to be distributed mainly in the cytoplasm, which is compatible with a previous study of RGS18 in megakaryocytes.(25) Targeted inhibition of RGS18 enhances osteoclastogenesis to form giant polykaryons in an OGR1-dependent manner. To study the role of RGS18 in osteoclastogenesis, the effect of siRNA against mouse RGS18 was examined (Fig. 2). RGS18-targeted siRNA or a scrambled control RNA duplex was transfected into RAW264.7 cells, and the reduction of RGS18 mRNA in the targeted cells was assessed by real-time RT-PCR using RGS18-specific primers and probes (Fig. 2A). The siRNA potently inhibited endogenous RGS18 mRNA expression to ∼26% at the transcript level. In this series of experiments, we also examined the effect of overexpression of exogenous RGS18 in RAW264.7 cells. The transfected cells were cultured for 4 days in the pres-

ence of RANKL to induce differentiation. Cells with decreased RGS18 expression caused by siRNA were found to differentiate into TRACP+ polykaryons more efficiently than control cells (Figs. 2B and 2C). Moreover, the RGS18 siRNA-treated cells tended to form giant polykaryons (>20 nuclei) rather than small polykaryons (>4 nuclei; Fig. 2Bd, arrowheads). These results show that osteoclastogenesis is aberrantly enhanced when endogenous RGS18 expression is inhibited. Treatment with RGS18 siRNA did not induce osteoclast formation in the absence of RANKL (Figs. 2Bb and 2C), suggesting that a decrease of RGS18 alone is not sufficient to stimulate osteoclastogenesis. The number of nuclei in TRACP+ cells (including mononuclear cells) per visual field did not change significantly with siRNA treatment (920.1 ± 269.1 and 878.2 ± 273.2 for control and RGS18 siRNA, respectively), which may suggest that RGS18 targets a later phase of osteoclastogenesis, such as cell–cell fusion, rather than an early step. Furthermore, exogenous RGS18 completely blocked osteoclastogenesis on stimulation by RANKL (Fig. 2C). Taken together, these results strongly suggest that RGS18 is a physiological regulator (suppressor) of the propagation of osteoclastogenic signaling cascades.

RGS18 DURING OSTEOCLASTOGENESIS

1617

FIG. 2. Effects of targeted inhibition of RGS18 using gene-specific short interfering RNA (siRNA) and overexpression of RGS18. (A) Quantitation of RGS18 mRNA by real-time RT-PCR analysis. C, control; SCRAMBLED, sequence-scrambled siRNA control for RGS18 siRNA; pcDNA3/RGS18, exogenous overexpression of RGS18. Error bars represent ± SE; *p < 0.05 and **p < 0.01. ns, not significantly different. (B) Representative images of RAW264.7 cells under control conditions (a and c) and transfected with RGS18 siRNA (b and d) in the absence (a and b) or presence (c and d) of RANKL. Scale bars represent 50 ␮m. (C and D) Number of nuclei within TRACP+ multinucleated (more than four nuclei) cells per visual field. Error bars represent ± SE. *p < 0.05 and **p < 0.01. ns, not significantly different. More than 1000 nuclei were counted in 10 visual fields.

RGS is a GTPase-activating protein that acts on the ␣ subunit (especially Gi␣ and Gq␣) in heterotrimeric Gprotein signaling.(12–14) Recently it has been shown that heterotrimeric G-protein (Gq) signaling initiated by a proton-sensing G-protein–coupled receptor, OGR1/GPR68, has a crucial role in regulation of osteoclastogenesis.(6,7) Targeted inhibition of OGR1 by neutralizing antibody or RNA interference has been shown to markedly suppress RANKL-induced osteoclastogenesis in vitro.(7) To reveal the function of RGS18 in osteoclasts, we examined the effect of anti-OGR1 neutralizing antibody (from ExAlpha and MBL) and Zn2+ (100 ␮M), a potent antagonist of OGR1.(8) Both anti-OGR1 neutralizing antibodies and Zn2+ significantly inhibited the effect by RGS18 siRNA (i.e., enhancement of RANKL-induced osteoclastogenesis; Fig. 2D); however, we noted that Zn2+ may also have nonspecific cytotoxic effects. These results showed that the effect of RGS18-targeted inhibition is dependent on OGR1 signaling, and thus suggest that RGS18 acts on the Gprotein signaling pathway induced by OGR1. In contrast, the effect of RGS18 siRNA was unchanged by PTX, which specifically inactivates the Gi subfamily ␣ subunit by ADPribosylation(27,28) (Figs. 2B and 2C), thereby suggesting that RGS18 is not involved in control of Gi signaling (expression of the Gq␣ subunit, as well as those of Gi␣2 and Gi␣3, were confirmed by RT-PCR analysis, as shown in Fig. 3). These results are consistent with the previous reports showing that OGR1 activates Gq signaling for osteoclastogenesis.(6,7)

RGS18 suppresses extracellular acidosis-induced NFATc1 activation To examine the regulatory function of RGS18 on OGR1mediated G-protein signaling more directly, we next examined the effect of RGS18 on extracellular acidosis-induced

NFATc1 activation through OGR1.(6) Under control conditions (pH 7.4) NFATc1 was located predominantly in the cytoplasm, whereas extracellular acidification to pH 7.0 for 75 min induced redistribution of NFATc1 to nuclei, suggesting activation of NFATc1 (Figs. 4A, left two panels, and 4B). However, with overexpression of exogenous RGS18, the acidosis-induced translocation of NFATc1 was significantly suppressed (Figs. 4A, middle two panels, and 4B). This result indicates that RGS18 can inhibit OGR1mediated cell signaling. In contrast, RGS2 and RGS19 (GAIP), two other RGS proteins expressed in RAW264.7 and BMM cells (Fig. 1), had no significant effects on OGR1 signaling (Figs. 4A, right two panels, and 4B), suggesting specificity of RGS proteins in regulation of OGR1 signaling. Inactivation of the Gi␣ subunit by pretreatment with PTX also had no significant effect (Fig. 4B), consistent with the concept that OGR1 preferentially uses Gq␣, but not Gi␣, subunits.

In vivo expression and distribution of RGS18 in mouse bone tissues To examine the expression and distribution of RGS18 in bone, immunohistochemical analysis of a section of mouse femoral bone tissue was performed using specific antibodies (Fig. 5). Immunoreactivity for RGS18 was clearly detected along the bone surface, which presumably includes osteoclasts (Fig. 5A, arrowheads), as well as in multiple hematopoietic cells, which include osteoclast precursor monocytes. To further identify the localization of RGS18 in osteoclasts, we combine fluorescence-based TRACP staining(23) with fluorescent immunostaining for RGS18 (Fig. 5B). Immunoreactivity for RGS18 detected in large cells adjacent to bone trabeculae (Figs. 5Ba and 5Bb, arrowheads) over-

1618

IWAI ET AL.

FIG. 3. Heterotrimeric G-protein subunits in osteoclasts. RT-PCR analysis of mRNA encoding six mammalian G-protein ␣ subunits expressed in an osteoclast precursor cell line, RAW264.7, cultured in the absence [RANKL(−)] or presence [RANKL(+)] of RANKL. RT(+), PCR with synthesized cDNA; RT(−), negative controls without RT. Numbers on the left indicate the positions of molecular weight marker in base pairs. Lane 1, RANKL(−), RT(+); lane 2, RANKL(+), RT(+); lane 3, RANKL(−), RT(−); lane 4, RANKL(+), RT(−).

FIG. 4. Effect of extracellular pH on nuclear accumulation of NFATc1. (A) RAW264.7 cells transfected with empty plasmid (Mock) (left two panels), expressing RGS18 (middle two panels), and expressing RGS19(GAIP) (right two panels) were exposed to pH 7.4 or 7.0 for 45 min and fixed. A plasmid inducing EGFP expression was co-transfected as a reporter of transfection efficiency (a–f). NFATc1 localization was assessed by immunofluorescence with antiNFATc1 antibody (g–l), and nuclei were stained with DAPI (m–r). s–x, Nomarski images of the cells. Scale bars represent 10 ␮m. (B) Summary. NFATc1 nuclear accumulation assessed by immunofluorescence. Error bars represent ± SE. *p < 0.05 and **p < 0.01. ns, not significantly different.

lapped well with that for TRACP activity. These results strongly suggest that osteoclasts residing in native bone tissues express RGS18. However, we cannot exclude the possibility that osteoblasts also express RGS18, because these cells also line the bone surface.

DISCUSSION In this study, we showed redundant expression of RGS proteins in osteoclasts and their precursor cell types, including expression of RGS18, a myeloid cell lineage-specific

RGS18 DURING OSTEOCLASTOGENESIS

1619

FIG. 5. In vivo expression and distribution of RGS18 in mouse bone tissues, based on immunohistochemical analysis of sections of mouse femoral bone tissue using specific antibodies. (A) Immunoreactivity to RGS18 was clearly detected along the bone surface and in multiple hematopoietic cells in bone marrow: A broad view in a and magnified image in b. Nuclei were counterstained with hematoxylin in a. Scale bars represent 50 ␮m. (B) Double fluorescent labeling for immunostaining of RGS18 and fluorescence-based staining for TRACP activity. Fluorescent images of RGS18 (a), TRACP staining (b), and double exposure with Nomarski image (c) are shown. For control experiments, immunofluorescent staining with purified nonimmune rabbit IgG (d) or fluorescence-based TRACP staining without substrate (e) were performed, and the data are shown as triple exposure images (merged with nuclei staining and Nomarski images). Scale bars represent 10 ␮m.

RGS subtypes. Expression of RGS18 mRNA was suppressed by RANKL signaling, and this decrease in RGS18 expression promoted osteoclastogenesis. RGS18 acts on OGR1/GPR68-dependent extracellular acid-sensing Gprotein–coupled signaling cascades and is expressed in osteoclasts on the bone surface in vivo. These results indicate a novel regulatory mechanism of osteoclastogenesis through G-protein/RGS signaling pathways. The function of osteoclasts is highly specialized for resorbing the hard bone matrix to maintain the process of dynamic bone remodeling. To perform this difficult task, osteoclasts undergo special maturation with characteristic properties that distinguish them from other somatic cells. For example, mature osteoclasts are formed into unique giant multinucleated cells on the bone surface through homotypic cell–cell fusion of hematopoietic monocyte-lineage precursors.(1) However, survival of the large multinucleated cells requires intracellular trafficking of requisite materials, and collapse occurs rapidly when growth goes beyond a given limit.(1) Thus, control and balance of osteoclastogenesis is critical to the function and survival of osteoclasts, and RGS18 may play a key role in the “fine-tuning” of this process. Heterotrimeric G-protein signaling is accepted as an important element in intracellular signal transduction, but its involvement in osteoclast function has not been fully recognized until the recent discovery of proton-sensing OGR1 in osteoclasts.(6–8) OGR1 expression in osteoclasts causes intracellular calcium mobilization and resultant NFATc1 activation on extracellular acidification.(6) Because targeted inhibition of OGR1 significantly suppressed RANKLinduced osteoclastogenesis in an in vitro culture system, it is likely that OGR1 is also involved in regular osteoclastogenic processes.(8) It is unclear how external acidosis arises and affects RANKL-induced osteoclastogenesis in vitro, but it is plausible that protons secreted through the vacuolar-type H+-ATPase (H+ pump) in osteoclasts influence

the acid–base equilibrium in the local microenvironment.(29,30) Based on our results, RGS18 is an emerging candidate as a participant member in the acid-sensing osteoclastogenic G-protein signaling pathway. Various tissues and cell types express redundant RGS proteins, which vary in molecular structure (except for the conserved “RGS domain”), subcellular distribution, and mode of regulation.(12–15,31,32) In RAW264.7 and BMM cells, 9–10 different RGS proteins are expressed, at least at the transcriptional level, and each is likely to have a distinct function. Another RGS protein, RGS12, has recently been reported as a “positive” regulator of osteoclastogenesis,(33) with an important role in [Ca2+]i oscillation and RANKLinduced osteoclast differentiation, possibly by modulation of phospholipase C␥-Ca2+ channel systems. These results and our data suggest different RGS proteins expressed in osteoclasts have unique functions. Regarding transcriptional regulation, RGS4 is regulated by a homeodomain transcription factor, Phox2b, in the developing nervous system,(34) but nothing is known for other RGS proteins. Therefore, further studies are needed to examine regulation of transcription of RGS proteins by RANKL.

ACKNOWLEDGMENTS The authors thank Sachiyo Uesugi (Department of Clinical Research, Osaka Minami Medical Center) for secretarial assistance. This work was supported by a Grant-inAid for Encouragement of Young Scientists (17790170) (MI) from the Ministry of Education, Science, Sports and Culture of Japan, a Grant-in-Aid from the Ministry of Health, Labor and Welfare of Japan (YS), a Grant-in-Aid from the Ichiro Kanehara Foundation (MI), a Grant-in-Aid from Takeda Science Foundation (MI), and a Grant-in-Aid from Kanae Foundation for Socio-Medical Sciences (MI).

1620

IWAI ET AL.

REFERENCES 1. Teitelbaum SL 2000 Bone resorption by osteoclasts. Science 289:1504–1508. 2. Teitelbaum SL, Ross FP 2003 Genetic regulation of osteoclast development and function. Nat Rev Genet 4:638–649. 3. Boyle WJ, Simonet WS, Lacey DL 2003 Osteoclast differentiation and activation. Nature 423:337–342. 4. Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, Taniguchi T 2002 Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev Cell 3:889–901. 5. Ishida N, Hayashi K, Hoshijima M, Ogawa T, Koga S, Miyatake Y, Kumegawa M, Kimura T, Takeya T 2002 Large scale gene expression analysis of osteoclastogenesis in vitro and elucidation of NFAT2 as a key regulator. J Biol Chem 277:41147– 41156. 6. Komarova SV, Pereverzev A, Shum JW, Sims SM, Dixon SJ 2005 Convergent signaling by acidosis and receptor activator of NF-␬B (RANKL) on the calcium/calcineurin/NFAT pathway in osteoclasts. Proc Natl Acad Sci USA 102:2643–2648. 7. Yang M, Mailhot G, Birnbaum MJ, MacKay CA, Mason-Savas A, Odgren PR 2006 Expression of and role for ovarian cancer G-protein-coupled receptor (OGR1) during osteoclastogenesis. J Biol Chem 281:23598–23605. 8. Ludwig M-G, Vanek M, Guerini D, Gasser JA, Jones CE, Junker U, Hofstetter H, Wolf RM, Seuwen K 2003 Protonsensing G-protein-coupled receptors. Nature 425:93–98. 9. Gilman AG 1987 G proteins: Transducers of receptorgenerated signals. Annu Rev Biochem 56:615–649. 10. De Vries L, Mousli M, Wurmser A, Farquhar MG 1995 GAIP, a protein that specifically interacts with the trimeric G protein G␣i3, is a member of a protein family with a highly conserved core domain. Proc Natl Acad Sci USA 92:11916–11920. 11. Berman DM, Wilkie TM, Gilman AG 1996 GAIP and RGS4 are GTPase-activating proteins for the Gi subfamily of G protein alpha subunits. Cell 86:445–452. 12. Ross EM, Wilkie TM 2000 GTPase-activating proteins for heterotrimeric G proteins: Regulators of G protein signaling (RGS) and RGS-like proteins. Annu Rev Biochem 69:795– 827. 13. Neubig RR, Siderovski DP 2002 Regulators of G-protein signalling as new central nervous system drug targets. Nat Rev Drug Discov 1:187–197. 14. Ishii M, Kurachi Y 2003 Physiological actions of regulators of G-protein signaling (RGS) proteins. Life Sci 74:163–171. 15. Kehrl JH 1998 Heterotrimeric G protein signaling: Roles in immune function and fine-tuning by RGS proteins. Immunity 8:1–10. 16. Beadling C, Druey KM, Richter G, Kehrl JH, Smith KA 1999 Regulators of G protein signaling exhibit distinct patterns of gene expression and target G protein specificity in human lymphocytes. J Immunol 162:2677–2682. 17. Denecke B, Meyerdierks A, Bottger EC 1999 RGS1 is expressed in monocytes and acts as a GTPase-activating protein for G-protein-coupled chemoattractant receptors. J Biol Chem 274:26860–26868. 18. Reif K, Cyster JG 2000 RGS molecule expression in murine B lymphocytes and ability to down-regulate chemotaxis to lymphoid chemokines. J Immunol 164:4720–4729. 19. Berthebaud M, Riviere C, Jarrier P, Foudi A, Zhang Y, Compagno D, Galy A, Vainchenker W, Louache F 2005 RGS16 is a negative regulator of SDF-1-CXCR4 signaling in megakaryocytes. Blood 106:2962–2968. 20. Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, Nakagawa N, Kinosaki M, Yamaguchi K, Shima N, Yasuda H, Morinaga T, Higashio K, Martin TJ, Suda T 2000 Tumor necrosis factor ␣ stimulates osteoclast differentiation by

21. 22.

23.

24.

25.

26.

27.

28.

29.

30. 31.

32. 33. 34.

a mechanism independent of the ODF/RANKL–RANK interaction. J Exp Med 191:275–286. Doupnik CA, Xu T, Shinaman JM 2001 Profile of RGS expression in single rat atrial myocytes. Biochim Biophys Acta 1552:97–107. Ishii M, Iwai K, Koike M, Ohshima S, Kudo-Tanaka E, Ishii T, Mima T, Katada Y, Miyatake K, Uchiyama Y, Saeki Y 2006 RANKL-induced expression of tetraspanin CD9 in lipid raft membrane microdomain is essential for cell fusion during osteoclastogenesis. J Bone Miner Res 21:965–976. Filgueira L 2004 Fluorescence-based staining for tartrateresistant acidic phosphatase (TRAP) in osteoclasts combined with other fluorescent dyes and protocols. J Histochem Cytochem 52:411–414. Park I-K, Klug CA, Li K, Jerabek L, Li L, Nanamori M, Neubig RR, Hood L, Weissman IL, Clarke MF 2001 Molecular cloning and characterization of a novel regulator of G-protein signaling from mouse hematopoietic stem cells. J Biol Chem 276:915–923. Nagata Y, Oda M, Nakata H, Shozaki Y, Kozasa T, Todokoro K 2001 A novel regulator of G-protein signaling bearing GAP activity for G␣i and G␣q in megakaryocytes. Blood 97:3051– 3060. Yowe D, Weich N, Prabhudas M, Poisson L, Errada P, Kapeller R, Yu K, Faron L, Shen M, Cleary J, Wilkie TM, GutierrezRamos C, Hodge MR 2001 RGS18 is a myeloerythroid lineage-specific regulator of G-protein-signaling molecule highly expressed in megakaryocytes. Biochem J 359:109–118. Katada T, Ui M 1982 ADP ribosylation of the specific membrane protein of C6 cells by islet-activating protein associated with modification of adenylate cyclase activity. J Biol Chem 257:7210–7216. Bokoch GM, Katada T, Northup JK, Ui M, Gilman AG 1984 Purification and properties of the inhibitory guanine nucleotide-binding regulatory component of adenylate cyclase. J Biol Chem 259:3560–3567. Sun-Wada GH, Wada Y, Futai M 2004 Diverse and essential roles of mammalian vacuolar-type proton pump ATPase: Toward the physiological understanding of inside acidic compartments. Biochim Biophys Acta 1658:106–114. Blair HC, Athanasou NA 2004 Recent advances in osteoclast biology and pathological bone resorption. Histol Histopathol 19:189–199. Ishii M, Inanobe A, Kurachi Y 2002 PIP3 inhibition of RGS protein and its reversal by Ca2+/calmodulin mediate voltagedependent control of G protein cycle in a cardiac K+ channel. Proc Natl Acad Sci USA 99:4325–4330. Ishii M, Kurachi Y 2004 Assay of RGS protein modulation by phosphatidylinositides and calmodulin. Methods Enzymol 389:105–118. Yang S, Li Y-P 2007 RGS12 is essential for RANKL-evoked signaling for terminal differentiation of osteoclasts in vitro. J Bone Miner Res 22:45–54. Grillet N, Dubreuil V, Dufour HD, Brunet JF 2003 Dynamic expression of RGS4 in the developing nervous system and regulation by the neural type-specific transcription factor Phox2b. J Neurosci 23:10613–10621.

Address reprint requests to: Masaru Ishii, MD, PhD Department of Clinical Research National Hospital Organization Osaka Minami Medical Center 2-1 Kidohigashi-machi, Kawachinagano Osaka 586-8521, Japan E-mail: [email protected] Received in original form January 27, 2007; revised form March 23, 2007; accepted June 15, 2007.