S7 Table. Pairwise genetic distance (FST)

Recommend Documents

S8 Table. Pairwise genetic distance (FST)

5.500 1.586 10.000. â. Tomohan. 6. 0.004. 0.035 0.022 0.050 -0.085. --. â. 5.677. 4.958 0.625 165.000 2.071 3.315. â. Minikodong. 7. -0.107. 0.089 0.074 ...

S6 Table. Median pairwise genetic distance (percent ... - PLOS

WA cluster 1 nightshade: psyllids in Washington from nightshades, shown as ... 3: psyllids collected from Othello (potato host) and one from Colfax (nightshade.

S5 Table. Pairwise population differentiation (FST) estimates ... - PLOS

S5 Table. Pairwise population differentiation (FST) estimates of potato psyllid from four potato fields at Othello in summer 2013. * indicates p-value > 0.05, 500 ...

S3 Table. Pairwise population differentiation (FST) estimates ... - PLOS

S3 Table. Pairwise population differentiation (FST) estimates of potato psyllid from nightshades at the Mesa site at different sampling dates: June (J), August (A), ...

Table S6 Pairwise FST estimates (Weir & Cockerham 1984 ... - PLOS

Table S6 Pairwise FST estimates (Weir & Cockerham 1984) across Ugandan Cx quinquefasciatus populations. Jinja. Kampala. Kanungu. Tororo. Jinja.

S10 Table. Pairwise FST values for microsatellite data

0.19. 0.25. Monodelphis. 0.29. 0.11. 0.15. 0.22. 0.28. 0.37. 0.33. 0.17. 0.13. 0.34. P_opossum. 0.26. 0.33. 0.17. 0.30. 0.28. 0.42. 0.38. 0.18. 0.25. 0.29. P_frenatus.

Supplementary Table 1. Pairwise distance matrix

Riemerella anatipestifer reduced virulence. PHI:4819. 0.000002. A6122_1701 hypothetical protein. FkpA. Cronobacter universalis reduced virulence. PHI:4584.

S4 Table. Matrix of the pairwise FST genetic distances among ... - PLOS

S4 Table. Matrix of the pairwise FST genetic distances among the 5 geopolitical regions of Brazil and seven European populations. (below diagonal) and the ...

Table S7 - PLOS

*Lefty2 (Ebaf, Lefta, AV214969,. MGC98569, 6030463A22Rik, left- right determination, factor A). TGFb signalling, growth factor activity, cell growth, growth, axial ...

S7 Table - PLOS

Amoebiasis (4). 7124 3592 3586 5055. C=106; E=0.44; R=9.11;. adjP=0.0028. Type I diabetes mellitus. (3). 7124 3592 4049. C=43; E=0.18; R=16.85;. adjP= ...

Table S7 - PLOS

Genes with increased expression in B. anthracis Sterne (34F2) in CO2 (MGM + 0.8% bicarbonate). *SEQUENCE ID GENE INFO. Fold difference. GBAA0167.

S7 Table. - Plos

... D); Pristimantis hernandezi (EN, D); Pristimantis ignicolor (EN, D); Pristimantis incanus ...... D); Marmosops handleyi (CR, D); Monodelphis unistriata (CR, U); ...

S7 Table. - PLOS

Left Lateral Occipital Cortex inferior division. -61 -95 -17 ... Left Temporal Occipital Fusiform Cortex. -45 -63 -17 ... Right Juxtapositional Lobule Cortex. 3. 1. 47.

Supplementary Table S7

Adaptor-related protein complex 3, beta 1 subunit. 10. APOE. Apolipoprotein E ... 44. CDIPT. CDP-diacylglycerol--inositol 3-phosphatidyltransferase. 45. CHKA.

S7 Table. - PLOS

S7 Table. Full single-level regression models for post-consumption levels of product endorsement. ... Stepwise regression was conduced twice, using either.

S7 Table - PLOS

KCTD8 Fwd AACCAGTACCGCGACGACAA. IFIT2 Fwd. CCCTGCCGAACAGCTGAGAA. KCTD8 Rev AGCTCATTACAGGAAGTCCCACT IFIT2 Rev.

Table S7 - PLOS

4.90E-07. 0.000126. ATPases involved in chromosome partitioning. COG0294. 1.42. 21.82. 3.53E-05. 0.008489. Dihydropteroate synthase and related enzymes.

S7 Table. - PLOS

sequences. D-hordeins (6). BAA11642.1. 318 D hordein. H. vulgare ssp. vulgare. 8. BAK04239.1. 318 Predicted protein. H. vulgare ssp. vulgare. 8. AFM77735.1.

table s7 - PLOS

APO S581L GLYCYL-TRNA SYNTHETASE MUTAN. LGRI .... HUMAN ARGININOSUCCINATE SYNTHASE IN COMPLEX WITH ASPARTATE AND CITRULLINE.

S7 Table. - PLOS

1.04. (0.82â1.32). Other. 1. (0.86â1.16). 0.96. (0.84â1.10). 1.07. (0.85â1.36). 0.96. (0.81â1.14). 0.87. (0.62â1.22). 0.92. (0.80â1.06). Absence of spouse=Ref. 1. 1.

Table S7 - PLOS

signature in Caenorhabditis elegans Dauer larvae and long-lived daf-2 mutants implicates detoxification system in longevity assurance. J Biol Chem 279:.

S7 Table - PLOS

Stout. 57. 48. 12 - 267. 30 (55). 54. Imperial Stout. 86. 79. 14 - 475. 105 (126). 83. Sour ales. 30. 21. 14 - 116. 6 (82). 7. Fruit/Vegetable/Spice. 56. 49. 12 - 127.

S7 Table - PLOS

Table S7. Regulated metabolites by FABP5 in ADSC (CE-TOFMS). ID. Compound name. Ratio. P. A_0024 Glycerol 3-phosphate. 2.0. 0.001. A_0044 ...

Table S7

Feb.-Mar. 2003. (before renovation). D. +. +. VC. +. In1b. Index-1. Feb.-Mar. 2004 ... a) All studied buildings are located in central Finland, Europe (62-64Âº N); b) ...

S7 Table. Pairwise genetic distance (FST)

Download PDF

1 downloads 0 Views 141KB Size Report

Comment

34.000 13.333 1.313. â. â. 0.588. â. â. Tinukadan Laut 3. -0.089 0.063. --. â. 7.500. â. 2.143 27.143 0.952. â. 7.500 0.289 7.500 7.500. Mambatu Laut. 4.

S7 Table. Pairwise genetic distance (FST) and gene flow (Nm) between subpopulations of An. balabacensis based on the cox2. Values above the diagonal are for Nm, while values below the diagonal are for FST. Values marked with asterisk indicate the genetic distances between two subpopulations are significant: *p