SAMPLE TITLE PAGE LAYOUT

A Systematic and Taxonomic Review of Two Australo-Pacific Snake Genera (Elapidae: Oxyuranus And Pseudonaja)

Christopher James Gregory A.A., B.Sc., M.Sc.

Griffith School of Environment Science, Environment, Engineering and Technology Griffith University

Submitted in fulfilment of the requirements of the degree of Doctor of Philosophy

April 2010

© Christopher James Gregory

―The classification of snakes is a hard test of intellectual honesty...‖ First written by Underwood (1967), later adapted by Minton, Jr. and Salanitro (1972)

GENERAL ABSTRACT

This study investigated two protocols for use with taxonomic research and provides a significant step toward a comprehensive taxonomic revision of two Australo-Pacific snake genera: taipans (Elapidae: Oxyuranus) and brown snakes (Elapidae: Pseudonaja). These snakes are of interest to many people for reasons such as the proximity of their distribution to major urban centres, the potential lethality associated with their venom, and the morphological variation found in most sub-taxa. Distributed throughout Australia and parts of Indonesia and Papua New Guinea, taipans and brown snakes are noted both for their morphological variability and sub-taxa similarity. These two reasons are partially why, since the first species of brown snake was erected in 1854, 48 different (sub)species of Oxyuranus and Pseudonaja have been described as valid taxa. A third reason may be methodological: the use of inappropriate sampling techniques and laboratory methods. The present study tested and validated a novel systematic sampling methodology for taxonomic and systematic research, investigated the appropriateness for the inclusion of archival DNA in molecular research, and conducted phylogenetic and morphologic analyses of past and present data collected from these taxa.

A review of the taxonomic history of these snakes (presented in Chapter 1) shows that the evolutionary relationships of Oxyuranus and Pseudonaja sub-taxa have long been uncertain. Previous taxonomic and systematic inquiries have been descriptive in nature, inconsistent characters have been selected for analysis, specimen selection has been opportunistic, and molecular studies have been reliant on fresh tissue for genetic analyses. These issues may be, in part, why there is still taxonomic uncertainty regarding the number of valid taxa associated with these snakes. This study attempted to uncover the evolutionary relationships of these snakes using novel and improved techniques. These techniques were first tested for their adequacy, then employed in further experiments designed to resolve Oxyuranus and Pseudonaja taxonomy.

While there have been many investigatory studies on the systematic and nomenclatural taxonomy of Australo-Pacific elapids, most researchers have chosen their samples

General Abstract

v

opportunistically, and few have attempted to do so in a systematic manner. Chapter 2 investigates the efficacy of morphological characters from previous regional and national identification keys to Pseudonaja using a systematic sampling regime. Many identification keys were less useful than previously believed (accuracy rates as low as 62%) when using snakes selected from throughout their distributional range. Therefore, it was assumed that all past researchers employed an opportunistic sampling strategy (based also on personal comments from some of the original authors, as well as the presence of low sample sizes in the literature) which was not able to include the full range of morphological variation associated with these snakes. Several additional sources of morphological variation (some new, some previously described yet subsequently ignored) were tested and several characters which improved identification of Pseudonaja species were found. These characters were used to create a new, temporary identification guide with a 96% success rate. In short, a systematic sampling regime appears to be the most appropriate protocol for taxonomic and phylogenetic research.

With increasing frequency, analyses of molecular data are complementing or replacing traditional morphological analyses within taxonomic research. Karyomorphic analyses in the 1980s helped move Australian elapid systematics into the modern era of evolution research and subsequent phylogenetic analyses of mitochondrial data in the 2000s were largely confirmatory of earlier karyomorphic results. However, previous molecular work may have been hindered not only by the opportunistic selection of snakes (typically collected near large human population centres), but also by reliance on the use of fresh tissue. Fresh tissue from these taxa is not easily available throughout their distributions. Thus, to uncover the full genetic diversity of Oxyuranus and Pseudonaja, DNA extracted from archival, formalin-fixed tissue is required. Chapter 3 details a comparison of 47 methods of archival DNA extraction, along with further investigations on the efficacy of using selected polymerase chain reaction (PCR) additives, several Taq-replacements, different sizes of targeted gene fragments, different sizes of starting tissue, and how the time of storage since extraction affects PCR success. Although the use of archival material is not as fruitful as using fresh tissue, methods employing one of two main extraction strategies (exposing tissue to a high heating step [≥ 90° C] or magnetic attraction of DNA molecules) were shown to maximise PCR success, and reactions often benefited with the use of bovine serum albumin or dithiothreitol.

General Abstract

vi

The two previously described novel and optimised techniques were used with phylogenetic analyses of all Oxyuranus and Pseudonaja sub-taxa (Chapter 4). A total of 388 full-length DNA sequences (773 base pairs of the ND4 and associated Histidine-, Serine-, and Leucine-tRNA mitochondrial genes) were extracted from fresh and archival tissue or were obtained from an online genetic database. Approximately 40% of all archival tissue attempted for use was successful. Full success was not possible, not only because of the presence of failed PCRs, but also because conservative methods were implemented to guard against the inclusion of any successfully amplified segment which may have contained base pair substitutions (one of several by-products of the fixation process inherent to most archival specimens). Phylogenetic analyses confirmed several previously-recognised relationships, while new relationships were also recovered. In particular, Pseudonaja modesta was most often recovered as the sister group to all other Oxyuranus and Pseudonaja. Final recovered relationships were retested numerous times and consistently reproduced with support values normally above 90%, while tests of several previously published results could not be easily replicated as originally described.

Chapter 5 presents the results of morphological analyses undertaken of over 1,400 specimens selected systematically from throughout their range, with no observer bias toward size, age, or gender. Analyses were conducted based on the molecular results obtained in the previous chapter, as well as based on original morphological descriptions taken from all previously published taxonomic hypotheses. As expected, most hypotheses presented with limited or no data were shown to have no support. Morphological delineations were consistent with genetic delineations, but new morphological variants were also discovered. As with genetic results, morphological results sometimes led to new hypotheses without strong support, which were assumed to be affected by rapid and recent evolutionary divergences. Finally, all type specimens were examined, with most assigned to their assumed appropriate groups. However, several type specimens failed to be ‗accurately‘ identified by discriminate function analyses. ‗Failed‘ type specimens could be consistently categorised by the time spent in storage (very old), their geographic origin (islands), or their authorship (incorrect labels by an author who had not examined any specimens).

General Abstract

vii

The present study has been able to address previously-developed hypotheses about the evolutionary relationships between these taxa, often with strong support for the findings presented here. Based on the weight of molecular, morphological, and geographic distribution evidence compiled during the present study, the following snakes and relationships1 were recognised as being valid: 1) Pseudonaja modesta is the sister group to all other ingroup taxa examined, should be elevated to its own genus, and contains four species (one of which is new); 2) Oxyuranus is the sister group to the remaining Pseudonaja, contains three species (pending further examination of O. temporalis), and one additional subspecies; 3) Pseudonaja contains eight species and an additional five subspecies (one of which is new). However, not all results obtained were clear, presumably due to rapid and recent evolutionary divergences. It is recommended that a further analysis of additional molecular data (such as that provided by nuclear genes) be undertaken before final relationships can be assumed. These analyses have begun, and additional ecological data (diet, habitat, and parasites) have been collected to help delineate and describe final taxonomic results. The results from this thesis, in addition to the extra data collected, provide the first comprehensive evaluation of the ecology and evolution of these snakes. Not only will this satisfy our curiosity and lead to new ecological investigations, but also will have conservation implications for the future management of taipans and brown snakes.

1

As per the rules of the International Code of Zoological Nomenclature (International

Code of Zoological Nomenclature 1999), any relationships presented within this thesis do not constitute an official taxonomic revision for nomenclatural purposes and are used for illustrative purposes only.

Acknowledgments

viii

STATEMENT OF ORIGINALITY AND PROOF OF RESEARCH PERMISSION

This work has not previously been submitted for a degree or diploma in any university. To the best of my knowledge and belief, the dissertation contains no material previously published or written by another person except where due reference is made in the thesis itself.

All work was conducted under Griffith University Animal Ethics Committee protocol EAS/04/05/AEC. All material was handled under the following permits: Queensland – Environmental Protection Agency Scientific Purposes Permit WISP03547406 and Northern Territory – Permit to Take Wildlife for Commercial Purposes 24350.

Christopher James Gregory

ACKNOWLEDGMENTS

I fear the mental fatigue associated with the end of my candidature will cause me to overlook some of the people who have—directly or indirectly—helped me with my thesis. Should that be the case, please know that you are certainly present in my heart, even if you have not been listed on these pages (in alphabetical order). I am truly humbled by—and grateful for—your time and help, and I will always be indebted to each of you. Even if I have thanked each of the you in the past, I thank you here again, and I will continue to thank you in the future. ADVISORS – I owe much of what has gone into this study (the good parts, at least) to my advisors at Griffith University (GU): Jean-Marc Hero – I allegedly met Marc and his wife, Narinder, in Sri Lanka in 2001—an event of which I have no recollection. Fast forward ten years, and I know that I will never forget Marc, especially for everything he has done with and for me during my degree. The supervision, support, and patience he has shown has been invaluable, and has positively influenced my approach to science. Jane Hughes – Part of my interest in this project was that it had a molecular component—a topic that held absolutely no appeal for me as an undergraduate student. Jane can explain complicated subjects in a way which makes them sound both fascinating and surprisingly simple. If I had Jane as my genetics and microbiology professor as an undergraduate, I would have actually attended the lectures! Steve Phillips – Through sheer coincidence (serendipity?), I first made contact with Steve soon after he decided to start thinking about Pseudonaja again. It was at his suggestion that I began this project, and only through his guidance and confidence in my abilities that I was able to complete it. His role as a personal mentor is perhaps his greatest contribution to the thesis... COLLEAGUES – The people listed below have all gone out of their way to help me, whether it be talking science, teaching me how to catch elapids or amplify their DNA, or attempting to answer my questions (about anything).

Acknowledgments

x

Peter Baverstock, Brian Bush, Helen and John Cann, Tim Caro, Ray Carthy, Hal and Heather Cogger, Naomi Doak, Angus Emmott, Ed Ferrero, Mark Fitzgerald, Mike Gillam, ‗Geeks‘ from the Nathan Campus (Andrew Bentley, Giovannella Carini, Kat Dawkins, Ana Dobson, Rod Eastwood, James Fawcett, Jane Hughes, Tim Page, Dan Schmidt, Jemma Somerville), Harry Hines, Robert Kimsey, Jodie Kuncoro, Greg Mengden, Peter Mirtschin, Leonard Pearlstine, Ben Phillips, Brad Shaffer, Barbara Triggs, Richard Wells EDUCATION – Several organisations provided space to work, partial funding, travel bursaries, access to equipment, and the opportunity to teach. Their staffs were always professional, extremely helpful, accommodating during the tribulations encountered during the course of my thesis, and downright nice people. GU, DNA Sequencing Facility – Fraxa Caraiani, Nicole Hogg GU, Environmental Futures Centre (née Centre for Innovative Conservation Solutions) – Jean-Marc Hero, Darryl Jones, Dianna Woods, Zhihong Xu GU, Gold Coast Association of Postgraduates – Joel McInnes GU, Graduate Research School – Minerva Capati, Loree Joyce, Vanessa Langton, Razia Osman, David Rounsevell, Rita Wockner GU, Library Services – Kathryn Marcantelli, Noelene Mendoza, Shirley Spiller GU, School of Environment – Michael Arthur, Margie Carsburg, Sonya Clegg, Tony Carroll, Rod Connolly, Petney Dickson, Naomi Doak, James Furse, Jean-Marc Hero, Mariola Hoffmann, Jane Hughes, Darryl Jones, Jutta Masterton, Hamish McCallum, John Robertson, Luke Shoo, Meredith Stewart, Peter Teasdale, Jan Warnken, Carmel and Clyde Wild GU, Student Guild – Jessica Brown, Michelle Brown, Joel McInnes GU, Various – Tony Farrell, Graham Fitzpatrick, Debbie Haynes, Michael Holder, Mona Kazoun, Sarah Simpson International Student Volunteers – Narelle Best, Randy Sykes Peter Rankin Trust Fund for Herpetology – Ross Sadlier FAMILY AND FRIENDS – The people listed below have all gone out of their way to help me, whether it be giving me a place to stay, providing a meal, donating money to

Acknowledgments

xi

the project, assisting with data collection, helping to translate Australian English, making me smile, putting this thesis into its proper perspective, or dropping off (another?!?) snake to measure. Jordyn de Boer, Vincent Byrne, Naomi Doak, Angus Emmott, the Frenzels (Hilde, Katrin, Lothar), Jan Gilroy, the GreenDoggs, Linda Gregory (without whom, literally, this would not have been possible), Marama Hopkins, Apple and David Losada, the Lucky Shots, Glen Mara, Claire Morrison, everyone from the Nepal trip, Felicia Pereoglou, Sue Phillips, everyone in the Postgraduate student offices of G24, Leah Robbie, Clay Simpkins, the old Southport Stadium Thursday through Saturday basketball crews, Kirsty Sullivan (who will be a far better PhD student than I ever was), the Gold Coast Virdees (Diva, Narinder, Priya), the Birmingham Virdees (Balbir, Charan, Harjinder, Rani), and everyone else who should be here but for space, time, and memory constraints MUSEUMS – I have received a tremendous amount of assistance from the staff of a number of museums worldwide. The people listed here provided me space to work, no time limits in which to complete the work, seemed to be genuinely interested when answering my many questions, and, as above, are genuinely good people. I am grateful for the opportunity to examine collections from their respective institutions. AM – Rebecca Johnson, Andrew King, Robert Mason, Ross Sadlier ANWC – Leo Joseph, Rob Palmer, John Wombey BMNH – Colin McCarthy CAS – Ricka Stoelting, Jens Vidnum FMNH – Kathleen M. Kelly, Alan Resetar MNHP – Ivan Ineich NMV – Dianne Brae, Martin Gomon, Jane Melville, Rhyll Plant NTM – Gavin Dally, Paul Horner, Dane Trembath QM – Andrew Amey, Patrick Couper, Jessica Worthington Wilmer SAM – Steve, Donnellan, Mark Hutchinson, Carolyn Kovach, Adam Skinner WAM – Paul Doughty, Brad Maryan, Clare Stevenson ZMB – Mark-Oliver Rödel ZMH – Jakob Hallermann

TABLE OF CONTENTS

I. Title page .........................................................................................................................i II. Copyright ..................................................................................................................... ii III. General Abstract .........................................................................................................iv IV. Ethics and Originality.............................................................................................. viii V. Acknowledgements .....................................................................................................ix VI. Table of Contents ..................................................................................................... xii VII. List of Figures .........................................................................................................xiv VIII. List of Tables ...................................................................................................... xviii IX. Chapter 1: Taxonomic Review of Oxyuranus and Pseudonaja ...................................1 A. Introduction ....................................................................................................2 B. Pseudonaja History ......................................................................................... 8 C. Oxyuranus History ........................................................................................ 18 D. Thesis Aims ..................................................................................................26 X. Chapter 2: A Systematic Method for Systematic Taxonomy .....................................29 A. Introduction ..................................................................................................30 B. Methods ........................................................................................................ 33 C. Results........................................................................................................... 42 D. Discussion.....................................................................................................69 XII. Chapter 3: Optimising DNA Recovery from Chemically-Treated Tissue ............... 81 A. Introduction ..................................................................................................82 B. Methods ........................................................................................................ 86 C. Results........................................................................................................... 94 D. Discussion...................................................................................................109 XIII. Chapter 4: Genetic Analyses ................................................................................ 116 A. Introduction ................................................................................................ 117 B. Methods ...................................................................................................... 122 C. Results......................................................................................................... 136 D. Discussion...................................................................................................160 XIV. Chapter 5: Morphological Analyses and A Review of Taxonomic Hypotheses ..167 A. Introduction ................................................................................................ 168 B. Methods ...................................................................................................... 171

Table of Contents

xiii

C. Results and Taxonomic Summaries............................................................ 175 D. Discussion...................................................................................................234 XV. Chapter 6: General Discussion and Conclusions ................................................... 243 XV. Literature Cited ...................................................................................................... 250 XVI. Appendix 1: Timeline of Pseudonaja taxonomy ................................................. 289 XVII. Appendix 2: Timeline of Oxyuranus taxonomy ................................................. 298 XVIII. Appendix 3: Abbreviations and their definitions ............................................... 301 XIX. Appendix 4: List of external morphological measurements.................................302 XX. Appendix 5: Head scale names, locations, and measurements .............................. 314 XXI. Appendix 6: Summary of DNA extraction protocols ........................................... 321 XXII. Appendix 7: Modeltest NEXUS block................................................................ 349 XXIII. Appendix 8: MrModeltest NEXUS block ......................................................... 355 XXIV. Appendix 9: Sample MrBayes instruction block............................................... 359 XXV. Appendix 10: Full-length haplotypic sequences ................................................. 361 XXVI. Appendix 11: Fragmented haplotypic sequences .............................................. 366 XXVII. Appendix 12: List of external characters examined by previous authors ........ 371 XXVIII. Appendix 13: Final, predictive discriminant function analysis results for type specimens ...................................................................................................................... 375 XXIX. Appendix 14: Summary of continuous measurements for all species-level taxa recognised ...................................................................................................................... 382 XXX. Appendix 15: Summary of non-continuous measurements for all species-level taxa recognised .............................................................................................................. 411

LIST OF FIGURES

1.1:

Distribution map showing the known locations of Pseudonaja specimens held by various museums ............................................................................................ 6

1.2:

A distributional map showing the known locations of Oxyuranus specimens held by various museums .................................................................................... 7

1.3:

Images of holotype material for all described Pseudonaja (sub)species........... 19

1.4:

Images of holotype material for all described Oxyuranus (sub)species ............ 27

2.1:

Image series showing process of museum snake selection ............................... 36

2.2:

Bubble plot combining infralabial counts with counts of mid-body dorsal scale rows for six Pseudonaja species ........................................................................ 44

2.3:

Mirrored jitter plot of ventral scale counts for seven commonly-recognised species of Pseudonaja ....................................................................................... 45

2.4:

Random-scatter jitter plot of ratios of the posterior frontal scale width compared to the width to the side of the head for four species of Pseudonaja .... ...........................................................................................................................46

2.5:

Bubble plot comparing the position of the lowest part of the postocular scales in relation to the position of the lowest eye orbits between P. affinis and P. nuchalis.............................................................................................................. 47

2.6:

Explanation of counts of infralabial scales ........................................................ 49

2.7:

Explanation of counts of ventral scales (as per Dowling 1951 ......................... 49

2.8:

Explanation of counts of dorsal scales at mid-body .......................................... 50

2.9:

Explanation of couplet four: the ratio of the distance between the frontal and rostral scales by the length of the parietal suture............................................... 51

2.10:

Explanation of couplet five: the ratio of the posterior width of the frontal scale by the width (at roughly the same plane) from the frontal scale to the edge of the head .............................................................................................................. 52

2.11:

Explanation of couplet six: the comparison of the lowest edge of the lower postocular scale with the lowest edge of the eye orbit ...................................... 53

2.12:

Comparison of potential effort and actual effort expended by authors of modern-day taxonomic reviews of Pseudonaja ................................................ 73

List of Figures

xv

3.1:

Relative location and directionality of each primer used in this chapter.......... 91

3.2:

Images of ethidium bromide stains of DNA extracts taken immediately after extraction ........................................................................................................ 100

3.3:

Images of ethidium bromide stains of DNA extracts taken one month after extraction ........................................................................................................ 101

3.4:

Images of ethidium bromide stains of DNA extracts taken two months after extraction ........................................................................................................ 102

3.5:

Images of ethidium bromide stains of DNA extracts (from three final and two reference protocols for DNA extraction) taken immediately after extraction 106

3.6:

Sample image of successful PCR products ..................................................... 107

3.7:

Sample comparison of selected PCR additives .............................................. 107

4.1:

Distributions of samples from previous phylogenetic studies ......................... 124

4.2:

Relative location and directionality of each primer used in this chapter......... 129

4.3:

Images of ethidium bromide stains of DNA extracts and PCR products ........ 130

4.4:

Screen capture of aligned sequences ............................................................... 134

4.5:

Comparisons of trees created from analyses of variable-length Pseudonaja modesta sequences ........................................................................................... 135

4.6:

The 50% majority-rule consensus tree of a Maximum Parsimony analysis ...137

4.7:

The best tree found from a Maximum Likelihood analysis............................. 139

4.8:

Plots of generation time vs. log-likelihood values from Bayesian analyses .... 140

4.9:

Plots of posterior probabilities of clades compared between all Bayesian runs .. .........................................................................................................................141

4.10:

Plots of cumulative posterior probabilities of each split vs. generation time and posterior probabilities of clades compared between all runs ........................... 142

4.11:

The 50% majority-rule consensus tree from Bayesian analyses ..................... 145

4.12:

Comparative results of Doughty et al. (2007) and this study .......................... 147

4.13:

Comparative results of Skinner et al. (2005) and this study ........................... 148

4.14:

Recovered fragmented sequence lengths of known ages separated by various factors .............................................................................................................. 156

4.15:

Storage ages of formalin-fixed specimens....................................................... 157

4.16:

Distributions of all informative DNA sequences ............................................ 158

4.17:

Illustration of typical results from phylogenetic analyses of morphological data .........................................................................................................................159

List of Figures

xvi

4.18:

Summary graphs of snake size organised by clade position ........................... 161

5.1:

Examples of removing the effects of size and shape from all snakes ............ 174

5.2:

Summary of historical character and specimen use in systematic reviews of Pseudonaja ...................................................................................................... 176

5.3:

Summary of historical character and specimen use in systematic reviews of Oxyuranus ........................................................................................................ 177

5.4:

Generalised results combining all size classes and genders for commonly recognised Oxyuranus and Pseudonaja species .............................................. 182

5.5:

Multivariate analyses of Pseudonaja affinis (geography) ............................... 185

5.6:

Multivariate analyses of Pseudonaja affinis (morphology) ............................ 186

5.7:

Geographic distribution of Pseudonaja affinis MBDSR .................................188

5.8:

Multivariate analyses of Pseudonaja guttata (geography and morphology) ..190

5.9:

Geographic distribution of Pseudonaja guttata .............................................. 191

5.10:

Multivariate analyses of Pseudonaja inframacula (geography)...................... 194

5.11:

Multivariate analyses of Pseudonaja ingrami (geography) ............................ 196

5.12:

Geographic distribution of Pseudonaja ingrami ............................................. 197

5.13:

Multivariate analyses of Pseudonaja modesta (morphology) ......................... 201

5.14:

Geographic distribution of Pseudonaja modesta wide body bands ................ 202

5.15:

A comparison of multivariate results varying the sample sizes, the characters examined, and the types of analysis undertaken.............................................. 206

5.16:

Multivariate analyses of Pseudonaja nuchalis (sub-clades)............................ 207

5.17:

Multivariate analyses of Pseudonaja nuchalis (geography)............................ 207

5.18:

Geographic distribution of Pseudonaja textilis ............................................... 211

5.19:

Multivariate analyses of Pseudonaja textilis (geography and sub-clades) ...... 212

5.20:

Geographic distribution of Oxyuranus microlepidotus MBDSR .................... 216

5.21:

Multivariate analyses of Oxyuranus microlepidotus (geography and morphology) .................................................................................................... 218

5.22:

Multivariate analyses of Oxyuranus scutellatus (geography and morphology) .........................................................................................................................221

5.23:

Geographic distribution of Oxyuranus scutellatus MBDSR ........................... 223

5.24:

Final distribution map of measured, non-damaged Pseudonaja affinis .......... 226

5.25:

Final distribution map of measured, non-damaged Pseudonaja guttata ......... 227

5.26:

Final distribution map of measured, non-damaged Pseudonaja inframacula. 228

List of Figures

xvii

5.27:

Final distribution map of measured, non-damaged Pseudonaja ingrami ........ 229

5.28:

Final distribution map of measured, non-damaged Pseudonaja modesta ....... 230

5.29:

Final distribution map of measured, non-damaged Pseudonaja ‘nuchalis’ .... 231

5.30:

Final distribution map of measured, non-damaged Pseudonaja textilis .......... 232

5.31:

Final distribution map of measured, non-damaged Oxyuranus microlepidotus and Oxyuranus temporalis ............................................................................... 233

5.32:

Final distribution map of measured, non-damaged Oxyuranus microlepidotus and Oxyuranus temporalis ............................................................................... 234

LIST OF TABLES

2.1:

Sample identification key used to demonstrate accuracy indices ..................... 40

2.2:

Raw data for analysis as presented in Table 2.1 ................................................ 41

2.3:

New identification key to the seven currently recognised species of Pseudonaja ...........................................................................................................................48

2.4:

Identification key to the seven currently recognised species of Pseudonaja, as presented by Cogger (2000). ............................................................................. 55

2.5:

Identification key to the seven currently recognised species of Pseudonaja, as presented by Kinghorn (1964) ........................................................................... 57

2.6:

Identification key to the five currently recognised species of Pseudonaja found in the Northern Territory, as presented by Gillam (1979) .................................58

2.7:

Identification key to the three currently recognised species of Pseudonaja found in Western Australia, as presented by Storr et al. (1986) ....................... 59

2.8:

Identification key to the two currently recognised species of Pseudonaja found in Victoria, as presented by Coventry and Robertson (1991) ........................... 60

2.9:

Identification key to the five currently recognised species of Pseudonaja in Queensland, as presented by Wilson (2005) ..................................................... 61

2.10:

Comparison of accuracies for four regional keys with accuracy of the new key (using regional data) .......................................................................................... 62

2.11:

Comparison of results from three distribution-wide keys using data from all available type specimens ................................................................................... 63

2.12:

List of type specimen designations after being identified using my new key ...64

3.1:

A list of mitochondrial primer pairs used in this chapter ..................................90

3.2:

Comparisons of relative efficacy of DNA extraction protocols at the time of extraction, one month after extraction, and two months after extraction .......... 95

3.3:

Summary of protocols showing visible DNA under UV fluorescence ............. 99

3.4:

Summary of protocols showing visible DNA (extracted from 3 mm3 tissue) under UV fluorescence .................................................................................... 102

3.5:

Comparison of DNA extraction protocols as determined by UV spectrometry (DNA yield and purity one year after extraction) and UV fluorescence (PCR outcomes immediately after extraction and two months after extraction) ...... 103

List of Tables 3.6:

xix

Comparison of three final and two reference DNA extraction protocols as determined by UV spectrometry (DNA yield and purity immediately after extraction) ........................................................................................................ 106

4.1:

A summary of phylogenetic studies (with sample sizes) involving Oxyuranus and Pseudonaja ............................................................................................... 123

4.2:

A list of mitochondrial primers used in this chapter ....................................... 128

4.3:

Estimated marginal likelihoods for five Markov Chain Monte Carlo Bayesian analyses ............................................................................................................ 143

4.4:

Model parameter summaries over all five Markov Chain Monte Carlo Bayesian analyses ............................................................................................................ 143

4.5:

Uncorrected (full-length) sequence divergences within and between genera .151

4.6:

Uncorrected (full-length) sequence divergences between commonly-defined species of Oxyuranus and Pseudonaja ............................................................ 152

4.7:

Uncorrected (full-length) sequence divergences within and between genera (modified to reflect phylogram results) ........................................................... 153

4.8:

Uncorrected (full-length) sequence divergences between operational taxonomic units of Oxyuranus and Pseudonaja ................................................................ 154

4.9:

Comparison of published bootstrap support for the relationships between Oxyuranus and Pseudonaja ............................................................................. 164

5.1:

Summary of historical character and specimen use in systematic reviews of Pseudonaja ...................................................................................................... 178

5.2:

Summary of historical character and specimen use in systematic reviews of Oxyuranus ........................................................................................................ 180

5.3:

Support for predicted species and clade classification based on initial discriminant function analyses ........................................................................ 181

5.4:

Summary results of diagnostic characters of insular Pseudonaja affinis ........ 184

5.5:

Characters which separate eastern and western populations of Pseudonaja guttata by more than 50% of total variation .................................................... 191

5.6:

Characters which separate geographic populations of Pseudonaja ingrami by more than 50% of total variation ..................................................................... 196

5.7:

Characters which separate geographic populations of Pseudonaja textilis by more than 50% of total variation ..................................................................... 212

List of Tables

xx

5.8:

Nomenclatural priorities for geographic populations of Pseudonaja textilis ..214

5.9:

Morphological characters which separate mitochondrial clades of Oxyuranus microlepidotus by more than 50% of total variation ....................................... 217

5.10:

Summary results of three diagnostic characters put forth to describe northwestern Oxyuranus scutellatus by Hoser (2009) ............................................. 220

5.11:

Summary of final discriminant function analysis predictions for all examined material ............................................................................................................ 225

5.12:

Final identification key for Oxyuranus and Pseudonaja species recognised ..236

5.13:

Final identification key Pseudonaja affinis subspecies ...................................238

5.14:

Final identification key Pseudonaja guttata subspecies..................................238

5.15:

Final identification key Pseudonaja inframacula subspecies ......................... 239

5.16:

Final identification key Pseudonaja modesta subspecies................................ 240

5.17:

Final identification key Oxyuranus scutellatus subspecies ............................. 240

6.1:

Summary of final taxa recognised as valid ...................................................... 247

6.2:

Summary of previous evolutionary studies of Australo-Pacific Elapidae ....... 248

CHAPTER 1 – A HISTORICAL REVIEW OF BROWN SNAKE (PSEUDONAJA) AND TAIPAN (OXYURANUS) TAXONOMY: IS THERE

A

NEED

FOR

YET

ANOTHER

TAXONOMIC

INVESTIGATION OF THESE AUSTRALO-PACIFIC SNAKES?

Abstract

Pseudonaja and Oxyuranus are two well-known genera of snakes distributed throughout Australia, PNG, and parts of Indonesia. The historically high public awareness of these snakes is, in part, due to their wide geographic distribution (covering major human population centres) and their perceived risk to humans (based on high venom toxicity). Interest in these snakes and their medical importance has generated a large volume of research, including a number of investigations into their evolutionary relationships. A review of the systematic and taxonomic literature on Pseudonaja and Oxyuranus (presented here) showed a consistent state of taxonomic uncertainty. Early researchers were hindered by the highly variable morphology of the snakes, as well as difficulties in obtaining access to museum specimens, leading to the use of low sample sizes in analyses and descriptions. More recent research has both helped and hindered taxonomic resolution, the latter, in part, due to poor research design and the lack of synthesis of previous research. Thus, many of the same taxonomic questions that existed eighty years ago (when the last commonly-recognised brown snake species was first described) still exist to the present day. Examination of past research revealed the need for further taxonomic study which utilises improved methods of analysis. Specifically, taxonomic research should include high numbers of specimens used in analyses, specimens should be taken from throughout their geographic range, all previous taxonomic hypotheses should be addressed, and multiple lines of evidence should be included. For genetic work, this may necessitate the inclusion not only of freshly-prepared genetic material, but also material harvested from archival snakes (whose DNA may be severely degraded). The chapter concludes with an overview of the thesis and how each of the previous recommendations have been implemented.

Keywords: Literature Review, Oxyuranus, Pseudonaja, Taxonomy, Systematics.

Chapter 1: Taxonomic Review

2

Introduction

Humans have a long history of organising the living world into groups based on similarities and differences. For example, Aristotle is credited with categorising organisms as either plants or animals, with animals further divided according to traits such as morphological characters and mode of transport (through air, on ground, or through water; Mason 1977, Barnes 1984). The modern system of biological classification is credited to Carl Linnaeus, a Swedish botanist (Linne 1956, Campbell and Reece 2002). In 1735, Linnaeus developed a system of binomial nomenclature, which allocated to every animal and plant a two-part name in the form of Genus species (e.g., Homo sapiens for humans or Pseudonaja textilis for the Australian eastern brown snake; Linne 1956). Groupings into genera and species were based primarily on the similarities of external characteristics and distributions of each organism. Individuals with the ability to successfully reproduce were grouped as a species, and similar species were grouped within a genus. Linnaeus‘ organisational effort was an early precursor to work undertaken by Alfred Wallace and Charles Darwin, who hypothesised in 1859 that evolution should be one basis for taxonomic organisation (Darwin 1968, Sarkar 2006). Although higher-level taxa (such as kingdoms and families) are still considered by many scientists to be ‗artificial‘, the theory of evolution helped validate and provide greater form to the idea of species (Van Regenmortel 1997, Sarkar 2006). Almost 100 years after the publication of Darwin‘s ―On the Origin of Species by Means of Natural Selection, or the Preservation of Favoured Races in the Struggle for Life‖, a debate began as to the exact meaning of the term ‗species‘. The definition of a species being ―groups of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups‖ is known as the biological species concept (Mayr 1940, Mayden 1997). Among modern species concepts, it contains one of the earliest, most basic, and widely used definitions of species. As such, it has perhaps been subject to more criticism than other species concepts (e.g., the definition of ‗potentially‘, how best to quantify reproductive isolation, and the conundrum of hybrids and asexual organisms). Many systematists support, though not explicitly, the phylogenetic species concept, in which ―the smallest population or group of populations within which there is a parental pattern of ancestry and descent and which is diagnosable by unique combinations of character-states‖ (Cracraft 1997, Mayden 1997).


3

Additional species concepts (such as the ecological and evolutionary species concepts) have been proposed and debated, but none has been universally hailed as ideal (Simpson 1961, Van Valen 1976, Wiley 1981, Ridley 1993). As Hull (1997) notes: ―Any species concept, no matter which one we choose, will have some shortcoming or other. Either it is only narrowly applicable, or if applicable in theory, not in practice, and so on.‖

Perhaps because of the problems associated with each species concept, many taxonomic scientists fail to indicate the species concept(s) to which they subscribe or under which their descriptions are valid. This lack of definition, and the inability to adequately (or universally acceptably) define what constitutes a species, has both practical and legal ramifications. At the very least, differing views of species status (and any resultant nomenclatural issues) may be a source of frustration for fledgling amateur and professional biologists trying to learn the names of local taxa. Of greater concern, the lack of a strict species definition can be a major hindrance to conservation efforts, as more and more environmental legislation is being reshaped by the taxonomic interpretations of local, state, and federal courts (Cracraft 1997). To add even more uncertainty, though most taxonomists utilise a cladistic approach (attributable to Willi Hennig [1966]), in which evolutionary relationships between taxa are based on shared, derived characteristics, there is no agreement as to which characters should be measured for use in determining species boundaries.

The oldest form of species delineation is through comparative morphology, a technique that has helped separate and name most of the species recognised to date. Originally undertaken using only simple visual comparisons, species differences based on a series of morphological characters are now determined via analysis with multivariate statistics. There are several advantages to using morphology in a cladistic analysis. Morphological characters are easily available for measurement (especially from museum specimens), inexpensive to measure, and reasonably abundant (Hillis 1987). Utilising an increased number of characters for analysis provides better species definition and minimises the chance of finding an incorrect relationship between taxa, given that multiple characters are probably coded by multiple genes (Hillis and Wiens 2000, Rosenberg and Kumar 2001, Zwickle and Hillis 2002). Additionally, fossil taxa are in most cases only available for morphological analysis (Hillis 1987). Descriptive or statistically analysed


4

morphometric measurements continue to be utilised when describing new species or differentiating higher-level taxa (e.g., Keogh 1999, Sawaya and Sazima 2003). However, sole reliance on morphological characters for rigorous species analysis has declined with the emergence of molecular analysis techniques.

Unlike the straightforward examination of morphological characters, there are several DNA-based, molecular techniques, each of which is better suited for answering different types of questions. For example, certain characteristics of a chromosome (such as restriction fragment length polymorphisms, random amplified polymorphic DNA, and amplified fragment length polymorphisms) are useful for determining if gene flow is taking place, microsatellites are appropriate for fine-scale population studies or paternity issues, and mitochondrial DNA studies, though used for a variety of types of research, are perhaps best suited for examining relationships between taxa, especially species (Berg et al. 2002, Griffiths et al. 2004). Phylogenies have also been inferred using the analysis of amino acid sequences of venom proteins and the examination of the gross morphology of individual chromosomes (Mengden 1983, Slowinski et al. 1997, Skinner 2003, Fry 2005). Given that having a sufficient number of characters available for analysis is crucial to correctly estimate a phylogeny, perhaps the greatest advantage of using molecular techniques is the sheer number of characters available for analysis, as each amino acid base pair is treated as a distinct character (Hillis and Wiens 2000, Rosenberg and Kumar 2001, Zwickle and Hillis 2002). Another benefit of molecular analyses is that the choice of genes and sequences used in analyses has traditionally been less arbitrary and better explained than the choice of morphological characters in comparable analyses (Hillis and Wiens 2000). However, there are drawbacks associated with molecular techniques. The monetary and time costs associated with genetic analyses usually far outweigh the cost of a comparatively sized morphometric analysis. Increased costs inevitably lead to a reduction in the number of samples included for analysis. Finally, there are several assumptions associated with molecular research which require careful consideration before hastily accepting any results (Hillis 1987). By themselves, differences in mitochondrial (or nuclear) sequences in reported clades do not necessarily equate to differences in species or demonstrate reproductive incompatibility.


5

On a case by case basis, there is no guarantee that any one technique will yield better results than a different technique. Taxa poorly resolved through the analysis of morphological data may also be poorly resolved using molecular techniques, often due to a recent or rapid speciation event which has not allowed enough time in which to set any morphological or molecular changes (Shaffer et al. 1997, Wiens and Reeder 1997, Hillis and Wiens 2000). Because of the disadvantages associated with the singular analysis of morphological or molecular data, systematists sometimes incorporate both types of data in the hope of strengthening their results (e.g., Puorto et al. 2001, Slowinski et al. 2001, Wiens and Penkrot 2002, Scanlon and Lee 2004). Other researchers have also utilised behavioural or ecological data (along with morphological or molecular data) in phylogenetic analyses (Melville and Swain 2000, Melville et al. 2004). The combination of multiple data sets increases the number of characters in the analysis, thereby making it more likely that the analysis will reveal the ‗true‘ taxonomic relationships found in nature.

Multidisciplinary approaches typically have not been utilised when investigating the evolutionary relationships of brown snakes (Serpentes: Elapidae: Pseudonaja) and taipans (Serpentes: Elapidae: Oxyuranus). These snakes are generally identifiable: brown snakes and taipans are small to large snakes (from thirty centimetres to over two metres in adult length) found throughout Australia, as well as parts of Indonesia and Papua New Guinea (Figures 1.1 and 1.2; Longmore 1986, O‘Shea 1996, Cogger 2000, Kuch and Yuwono 2002). The taxonomic uncertainty associated with these taxa has most often arisen when trying to determine specific, definable differences useful to identify the number of genera and species found amongst these snakes. For example, species now considered to be part of Pseudonaja and Oxyuranus have been organised into eighteen different genera at some point in their taxonomic history (Appendices I and II). The number of extant species is also a source of ongoing debate among taxonomists, though it is generally agreed that there are more species than currently recognised. As detailed below, the quest for taxonomic clarity within these genera has been both helped and hindered by proposed phylogenies (some published in grey literature) and by past research efforts with small, often regionally-biased, numbers of samples.


6

##

# ## #

#

#

# # # # # ## # # # ## # ### # # # ### # ## # # # ### # ## ## # ## ## # # # # # # # # # # # # # # # # # # # #### # # # # ## # # # # # # # ### # # ## ### # # ## ### # # # # # # # ### # # # # # # # # # # # ### # ## # # ## # ## ### # ## # ## # # # # #### ## # # # ## ## # # #### ## ## # # # # # # ## # ## ## # # # # # ## # ## # # # # # ## ## ## # ##### # ## # # # ## # ## # # ## # ### # # # # ### ## # ## ## # # # # # # # # # # # # # # # # # # ## # # #### # ## # ##### # ####### ## # # # # ### # # # ## # # ## ## # ######## # # # # ## ## # ##### ### # # # # # # # # # #### # # # # # ## # # # # # # # # # # # # # # # ## # # # # # ## # # # ### # ## # # # # # # # ## # ### # # ## # # # # ## # # # # # ### # ### # # ##### ## ### ## # # # # # # # # # # # # ## ## #### # # # # # # # # ## # ## # # # # ## ## # # # # ## # ### # # # # # # # # # # # # # # # # # # # # # # # # # ## # ## # # #### # # ### # ## # ## # ##### # ## # # # ### ### # ## # # # ### # ## # # # # ## # # ### # ## ## ### # # # # # # # # # # ## ### # # # #### # # # ### # # ### # # ### # # # # ## # ## # # # # # # # # # # # # ## # ## # # # # ## # # ## ## # #### # # # # # ### ## # ### # ### # # # ## # # # ## ## # ## # # # # # # #### # # ## # # # ### # # # # # # # # # # # ## # # ## ## # ## ## ## ### # # # ## # # ### # # ## # # # # # # # ## # # # # # ##### ## # ###### # # # # # # ## ## # ## # # # # ## # # ## # #### # # ## # # # # # ## # # # # # # # # # # # # # # # ## # # # # # ##### ## # # # # ##### # ## # # ## ###### # ## # # ## # ### # # ## ### # # # ## # # # # # # # # # # ## # # # # # # # ## ### # # ### # # # # # ### # # # # # # # # # # ## ### ## ## # # ## ## # # # # # # ## ## # # # # # # # # # # # # # # # # # # # # # # ## ## ## # ## # # ## # # # # ### ### # # ### ## ### # # ### ## # # ## # # # ### ## # # # ## ## # # ## # ### ## # # # # # # # # # ## # # # ## ## # # ## # # ## # # # ## ## # # ### ## # ## # # # # ## # # ## # # ### ### ## # # # # # ### # # # # # # # # # # # # # # # # # # # # # # # #### # # # # # # ####### # # # # ## # # # # # #### # # #### # # # ### ### # # # # ### # # # # # # ## ### # ## # ## # # ## # # ## # # ### ## # # ## ## # # #### # ## ## # # # ## # ## # # ### ## ### # # # # # # # # ## # # # # # # ## # # # ##### # # # ####### # # # ### #### ## # ## # # ### ## ## # # # # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ## ## # ## # # # ##### # ## # #### ### # # # ## # # ## # # ### ## # # # # # ### # # # # # # # # # # ## # # # # # # # # # ## # # # # # # # # # # # # ### ### # # # ###### ## # # # ## # ## # # # # # ## # ## ##### # # # # ## ### # ## ##### # ##### # ### ### # ## # # ## # ### #### # # # # # # # # # ## # ## # #### # ## # # ## ## # ## # ## ### ## ### # ### # # # # #### # ## ## ## ## #### # # # ## ### # # ## # # # #### ## # # ## # ## # ## ## # ## ## ## ## # ## # # ## #### # ## # # ## # ## ## # ## ## # # # # # ### ## ### # ## ### #### # #### # ## # # # # ### # # # ## # # # ## ### ## #### # # # # ### # # ## # # # # ## ## # # ## # # # # ### ## # # # # # # # ### ##### # ## ## ### # ## ## # ## ## # # # ########## # # ## # ## ## # ## #### # ## # ## # # ### ## ## # # # # # # # # # ## # # ## ####### ### # # # # # # # ## ### # # ### # ## ### # # # # # # # # ## # # ## ## # # ## # ## ## # # # #### # # #### # #### ## # # # # # ### ###### # ### #### # ##### # ## ## # # # # ## # # # # # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # ## # ## ## ## ## # # # ## ### # ## ## # # # # ## # ## # ###### ### ### # # #### # # # # ## # ## ##### ## # ## ##### ## # # # # ###### # # # ## ## # ## # # # # ### #### # ## # # ### ### # # # # ## ## # # # # # # # ## # # # ##### ## ### # # #### ## ## ## # ### # ## # ### ## # # ### ### ## # # # # # ### # ## #### # # # # # # # # ## ## ##### ### # # ### # # # ##### # ## # ## # # # # # # # # # # # ## # # # ## # # # # # # ## # ## #### ###### ## #### # ##### # # # ## ##### # # # # # # # # # # # # ### # ### # ## # # # ## # ## # # #### ### # #### ## # ## # ## # # # # # # ## # ## # ### # ## ##### ### # # ## # # # ### # ##### #### ##### ## # # # # # # # # # ####### # # ###### # # ## ### ### # # # # # # # # # ## # # ## # # # ###### # # ## ## # # # # # # # # ## # # # ### # # # # # # # # #### ## ## # # # # # # # # # # # ##### # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # # # # # # ## # # # # ### ## ## # ## #### # ## ## ## # ## ## # ### # ## # # # # # # # ## # ## ### # # # # # ## # # ## # ## # ## ### # # # # # # # ### # # ## ## ### ## # ##### # # # # ## #### ## # # ## # ### # # # ## # ## # ### ### # ## ### # # # ## # ## # # # # # ## ## ####### # ###### # # ## ## # ### # # ## # # # # # ### # # # # # # # # # # # # # # # ## # # ### ## # 0 250 500 1,000 1,500 2,000 # ## # ## ## # # ## # # # # # # # # # ## # ### ## ## ### # # ## Kilometers

Pseudonaja Museum Specimens # # # # # # # #

P. affinis P. guttata P. inframacula P. ingrami P. modesta P. nuchalis P. textilis unknown #

®

Figure 1.1. Distribution map showing the known locations of Pseudonaja specimens held by the following organisations: AM, AMNH, ANSP, ANWC, BMNH, CAS, CM, CU, FMNH, KU, LACM, LSU, MCZ, MNHP, MSNM, NMV, NTM, Other, QM, ROM, SAM, SDNHM, SMNS, UCM, USNM, WAM, YPM, ZMB, and ZMH. Organisational abbreviations used throughout this thesis and their definitions are listed in Appendix III. Species chosen for inclusion are the seven currently- and most widelyrecognised species of Pseudonaja.


7

* # * #

# * * # * # * # * # * # * ## * * #

* # # *

## * * * # * # * *# # * # * # # *

* #

* #

## * * * #

* # * # * # * # # * * # * # * #

* #

* # * # * # # *

Oxyuranus

## * * # * * # * #

* #

* ## * *#

* #

* #

# * * #

*# # * * # * # * # * # * # ## * * * # * # * # *# # * * # *# # * * # * * # * # * *# # *# *# # * # * *# # *# # * # * * # *# # * * # *# # * # # * * *# # * # *# * *# # ** *# # * *# # * #

Museum Specimens * # * # * # # * * # *# # *# *# *# * *# # * *# # * * # * # * *# ## * *# *# * *# # *# # *# * *# # *

* # * *# # * # # * * #

* # * # *# # * *# # *

* # *# *# * # * *# # *# # * *# * # * # * # # * *# # * * *# # * # # * * # * *# #

* #

* #

* #

0

250

500

1,000

1,500

2,000 Kilometers

* #

O. microlepidotus O. scutellatus O. temporalis

* # *# # * # * # * * # * # **# # *# # ** # * ## * *# # *# * *# # * # *# # ** * # * * # *# # *# # * * #

®

Figure 1.2. A distributional map showing the known locations of Oxyuranus specimens held by the following organisations: AM, AMNH, ANWC, ASU, BMNH, CAS, CU, FLMNH, FMNH, MCZ, MNHP, MVZ, NMV, NTM, Other, QM, SAM, SMNS, USNM, WAM, and ZMB. Organisational abbreviations used throughout this thesis and their definitions are listed in Appendix III. Species chosen for inclusion are the three currently- and most widely-recognised species of Oxyuranus. The extreme geographic outliers of Australian Oxyuranus microlepidotus and Oxyuranus scutellatus are discussed in the results section of Chapter 5.


8

History Of Pseudonaja Classification And Nomenclature

Published European accounts of Pseudonaja date back at least to 1790. Upon returning home to England, John White (the Surgeon General to the settlement of New South Wales) published an account of his travels, life in (what was to become) Australia, and descriptions of the flora and fauna he observed. Cogger (1985) and Shea et al. (1993) note that Pseudonaja textilis is described, but not named in White‘s (1790) book. Perhaps overlooked is that White also includes a picture and description (but no name) of what is likely to be Pseudonaja modesta. The first-ever formal description of a brown snake occurred in the mid-nineteenth century by Duméril, Bibron, and Duméril (1854), who had access to a juvenile snake which had been in the Museum of Natural History in Paris collection for eight years (MNHP: specimen 3944 not found and presumed missing; Cogger et al. 1983, personal search). Due to the dark band around the neck of the juvenile snake, Duméril et al. (1854) classified the snake as a Furina (known as the ‗coloured-nape snakes‘) textilis (later Pseudonaja textilis). The specific name given in their work came from the appearance of the snake‘s dorsal pattern, as if the snake was wearing fine sewn mesh from a tailor. The second formal description of a brown snake was made by Fischer (1856). In his publication on new snakes housed in the Hamburg Museum, Fischer (1856) described Pseudoëlaps superciliosus (later Pseudonaja textilis) for the first time (ZMH: specimen 362). Because he named this species based on dissimilarities with other snakes, Fischer presciently doubted the finality of his classification.

In a published account of the snakes of the British Museum in 1858, Günther erected the genus Pseudonaja. He used this name to include three specimens of P. nuchalis (BMNH: specimens 1946.1.20.33, 1946.1.20.41, and 1946.1.20.57) and to synonymise Fischer‘s Pseudoëlaps superciliaris. Perhaps due to the smaller, slender nature of a specimen in the collection, Günther also (as with Duméril et al. 1854) mistakenly describes a juvenile Pseudonaja textilis as a whip snake, Demansia annulata (BMNH: specimen 1946.1.17.54). However, the genus Pseudoelaps (now without a trema over the second ‗e‘) was not yet finished. Jan, the director of the Museum of Milan, (very briefly) wrote about two new species (Pseudoelaps Sordellii and P. Kubingii) in 1859. Both specimens are presumed lost or destroyed by their respective museums (Budapest and Milan; Cogger et al. 1983, personal search). Four years later in 1863, Jan updated


9

the spelling of Kubingii to Kubinyi and added a new subspecies, Pseudoelaps superciliosus Beckeri (ZMH: specimen R01261), without benefit of any description. This latter taxon was elevated to Pseudelaps Beckeri by Jan and Sordelli in 1873, who dropped an ‗o‘ from the genus name, provided only a rudimentary species description (―young individual, perhaps the same species as Pseudelaps superciliosus‖), and attributed the name Beckeri to an earlier, unspecified Jan publication (presumably Jan 1863). In between Jan‘s three publications, an Austrian naturalist reported on animals encountered (and collected) by scientists who had circumnavigated the globe in the late 1850s (Fitzinger 1860). With no explanation, Fitzinger synonymised Furina textilis with Euprepiosoma textilis. The first account of Australian brown snakes by a person actually living in Australia was in 1867 by Professor F. McCoy. In a brief account of the fauna of Victoria, he mentioned at least two facts of interest to any herpetologist: that there were ―scarcely any‖ reptiles of economic importance in Victoria, and that there were two resident brown snake species: Pseudonaja nuchalis and Diemenia superciliaris (later to become Pseudonaja textilis). However, he believed that the split between the two species would not be permanent. Although that idea has only been supported by two others in the last 143 years (Loveridge 1934, Mitchell 1951), he did make at least one important remark (in terms of future taxonomic resolution): Pseudonaja nuchalis rostral measurements were highly variable. In 1869, after the examination of material collected during the Novara expedition (the same material discussed by Fitzinger in 1860), Dr. F. Steindachner wrote about Furina textilis and a new species, Cacophis Güntherii (museum unknown: specimen not found and presumed missing; Cogger et al. 1983, personal search). Perhaps named for the man who erected Pseudonaja (nuchalis), Cacophis Güntherii ironically would later be synonymised with Pseudonaja textilis.

Günther (1872) published an update on new snakes added to the British Museum during the previous four years. He correctly identified Pseudonaja affinis (BMNH: specimen 1946.1.19.77) and separated this species from Pseudonaja nuchalis by the differing numbers of dorsal scale rows. He also described Cacophis modesta (later to become Pseudonaja modesta) for the first time (BMNH: specimens 1946.1.17.46, 1946.1.18.42, and 1946.1.18.44). Günther presumably chose Cacophis due to the head and neck


10

patterns observed. In a side note, he also mentioned rostral scale similarities between Diemenia (Australian ground snakes) and Liophis conirostris (a South American ground snake later to become Liophis almadensis). McCoy wrote two manuscripts in 1879 which dealt with brown snakes, both similar to his earlier (1867) work in that they contained inconsistencies in statements and species. In the first volume (1879a), McCoy described Diemenia aspidorhyncha (later to become Pseudonaja nuchalis) for the first time (NMV: specimen D12352). In the second volume (1879b), McCoy described for the first time Furina bicucullata (later to become Pseudonaja textilis), which he dismissed as a species too small to be venomous or deadly (NMV: specimens D1832, D4610, and D8939–D8942)! McCoy also discussed the work of several other scientists while pondering the relationships between (future) brown snakes in the genera Furina, Diemenia, and Cacophis.

The next five species descriptions come from Boulenger, De Vis, and Macleay, of which published assessments have categorised their taxonomic work on reptiles as good, bad, and somewhere in the middle, respectively (Mack and Gunn 1953, Cogger 1985, Shea et al. 1993). De Vis described Brachysoma sutherlandi (QM: specimen J190) in 1884 and Pseudelaps bancrofti (QM: specimen J187) in 1911, both of which later became Pseudonaja nuchalis. The lack of depth in his description of many of the characters he used makes these characters unmeasurable, though some characters show insight and careful observance. In 1885, Macleay described one of three specimens of Furina ramsayi (AM: specimens B5945, B5947, and B5948). Named after the curator of the Australian Museum, this species would later become Pseudonaja modesta. In writing about the three then-known Furina species, Macleay noted their dispersed distributions and wondered if the distributions could be the cause of differences in their appearance. Using descriptions of the original authors, Boulenger summarised and reorganised the British Museum holdings as of 1896, placing most brown snakes into the genus Diemenia. Boulenger emended Brachysoma sutherlandi to Pseudelaps sutherlandi, specified Diemenia modesta to synonymise Cacophis modesta and Furina ramsayi, chose Diemenia nuchalis to synonymise Pseudonaja nuchalis and Diemenia aspidorhyncha, and designated Diemenia textilis to synonymise Furina textilis, Pseudoelaps superciliosus, Demansia annulata, Pseudoelaps sordelli, Pseudoelaps kubingii, Pseudonaja textilis, Diemansia kubingii, Diemenia superciliosa, Diemansia (Pseudelaps) superciliosa, Cacophis guentherii, Pseudoelaps beckeri, Pseudoelaps


11

textilis, and Furina cucullata (previously Furina bicucullata). At least two authors (Loveridge 1934, Cogger et al. 1983) believed part of Boulenger‘s (1896) listings for Pseudechis australis and/or Pseudechis cupreus were descriptions of Pseudonaja textilis. In 1908, Boulenger described Diemenia (later to become Pseudonaja) ingrami for the first time (BMNH: specimen 1946.1.20.32), the snake named after a man who donated a small collection to the British Museum. Another case of taxonomic ‗lumping‘ took place in 1914 when Fry recognised the following species (and synonyms): Demansia affinis (Diemenia nuchalis and Pseudonaja affinis), Demansia modesta (Brachysoma sutherlandi, Cacophis modesta, Diemenia modesta, Furina ramsayi, and Pseudelaps sutherlandi), Demansia nuchalis (Diemenia aspidorhyncha, Diemenia nuchalis, Pseudelaps bancrofti, and Pseudonaja nuchalis), and Demansia textilis (Diemenia textilis). Longman published a description of Diemenia carinata in 1915 (QM: specimen J1508). He mentioned the similarity of its keeled scales to those of Hoplocephalus (which he thought were specialised for climbing) as well as some similarities with Pseudonaja (where it would later become Pseudonaja nuchalis). Ultimately, he found the snake to be most similar to Diemenia. Waite (1925) reported on a variation of Demansia textilis (inframacula; SAM: two specimens not found and presumed missing; Cogger et al. 1983, personal search), a subspecies which would later become Pseudonaja inframacula. His account is interesting in that snakes were ―impossible‖ to be caught alive, and the author resorted to shooting them from a distance. Perhaps because he was left only with mangled specimens with which to work, Waite reported that Demansia textilis inframacula was structurally indistinguishable from Demansia textilis and that the two species could only be separated from each other by colour and ornamentation. In 1926, Parker established Demansia (later to become Pseudonaja) guttata while examining new reptiles from Queensland (BMNH: specimens 1946.1.20.67 and 1946.1.20.68). He distinguished Demansia guttata from Demansia textilis (to which he thought it most closely related) by differing head scale proportions and mid-body dorsal scale row counts.

Loveridge published on the Australian reptiles held in the Museum of Comparative Zoology at Harvard in 1934. The following species (and synonyms) were recognised: Demansia modesta (Cacophis modesta and Furina ramsayi) and Demansia textilis textilis (Diemenia ingrami, Furina textilis, Pseudechis cupreus [part], Pseudonaja


12

affinis, and Pseudonaja nuchalis). As many of the previously defined brown snake species were now included as subspecies of Demansia textilis, a key was provided to differentiate Demansia textilis textilis, Demansia textilis affinis, Demansia textilis inframacula, and Demansia textilis nuchalis from each other. He also noted that Pseudelaps bancrofti might actually be Demansia textilis nuchalis, that Demansia textilis inframacula was an unworthy taxonomic designation, and that the snakes on Rottnest Island might eventually turn out to belong to a new species (though he admitted the latter idea had been around since at least 1909). In 1951, Mitchell composed a comprehensive list of the South Australian reptile fauna. In it he added a description of Demansia acutirostris (SAM: specimen R3133; later to become Pseudonaja nuchalis), primarily based on the undershot lower jaw. Two synonyms are listed (Furina textilis within Demansia textilis and Cacophis modesta within Demansia modesta), and he also expanded on and agreed with several of the points made by Loveridge (1934). Most importantly, he agreed that Demansia textilis inframacula was not worthy of taxonomic recognition and he split Demansia textilis textilis and Demansia textilis nuchalis by way of geography (southern Australian and northern Australian specimens, respectively). Kinghorn‘s (1956) account of the snakes of Australia continued to list brown snakes within the genus Demansia.

A new insular brown snake was heralded by Worrell in 1961(a). He diagnosed Demansia nuchalis (later to become Pseudonaja affinis) tanneri from islands in the Recherche Archipelago primarily due to its smaller size (AM: specimen R125973 and NMV: specimen D9819). He also separated Demansia nuchalis tanneri from Demansia nuchalis affinis by its smaller body size, from Demansia textilis inframacula by midbody dorsal scale row counts, and from Demansia textilis textilis by the smaller size at sexual maturity (as determined by hemipene morphology). Later that same year (1961b), Worrell separated Pseudonaja from Demansia on the basis of (undescribed) skull characters, and synonymised three taxa (Demansia nuchalis nuchalis, Diemenia carinata, and Pseudonaja nuchalis) with Pseudonaja nuchalis nuchalis. After Worrel‘s 1961(b) publication, McDowell (1967) supported the split of Pseudonaja and Demansia on the basis of venom gland musculature, and most authors have since recognised brown snakes as a monophyletic group called Pseudonaja (Mengden 1983, Mengden 1985b; for example, see the reviews of brown snakes in Cogger 1975, Cogger 1979, Gillam 1979, and Cogger 2000). Although the genus seemed to become more accepted


13

and better defined, individual species were not (Mengden 1982, 1985b). In his morphological review of Pseudonaja from the Northern Territory, Gillam (1979) identified two P. guttata variants, three P. textilis variants, five P. ingrami variants, and sixteen (of which 12 are described) P. nuchalis variants (―with numerous intermediate variations‖). Several of his P. nuchalis variants were given names such as ―pale head, grey nape‖ and ―southern with black bands,‖ all of which have continued to be used by Australian herpetologists. Cogger (1979, 2000) agreed with Gillam (1979) by stating that ―most [Pseudonaja] species are probably composite.‖

After almost 130 years of formal descriptions based solely on morphological characters (and occasionally, distribution), brown snake taxonomy finally entered the molecular age of science in the 1980s. From 1982–1987, Mengden published several times on Pseudonaja in the context of elapid genetics and taxonomy. As part of his Ph.D. thesis on elapid phylogeny, Mengden (1982) looked at the allozymes and karyomorphs of 38 brown snakes, including several of the P. nuchalis variants mentioned by Gillam (1979). He noted that Pseudonaja displayed the most variable chromosome number and species-specific chromosomal variation of any Australian elapid genus, that the three potential P. textilis species proposed by Gillam in 1979 possessed a single, typical karyomorph, and that a more thorough survey of multiple colour morphs from multiple locations is needed for P. affinis and P. nuchalis. Indeed, for the latter species, Mengden (1982) stated that further ―cytological data may well be of considerable importance in detecting distinct forms within species that appear, on overview, to be too variable and complex to delimit by conventional taxonomic procedures.‖ In the same volume, however, he also noted that the ―lability of sex chromosome morphology and composition implies that they are not likely to be of much value as markers of phylogenetic differentiation.‖ Nevertheless, Mengden summarised that the multiple karyomorphs attributable to P. nuchalis were also distinguishable by morphology and colour pattern, and though he did not offer any nomenclatural changes, thought they were distinct species. In an effort ―to stir others into [taxonomic] action‖ and despite Mengden‘s 1982 results, Wells and Wellington (1983) proposed a radical new taxonomy of Australian Reptilia. In terms of Pseudonaja, they resurrected most brown snake species from synonymy without presentation of any supporting data or analyses. Thus, the authors recognised


14

Pseudonaja affinis, P. aspidorhyncha, P. carinata, P. guttata, P. ingrami, P. inframacula, P. modesta, P. nuchalis, P. ramsayi, P. sutherlandi, P. tanneri, and P. textilis as full species. In a 1985(a) update of work from his Pseudonaja thesis, Mengden charged (and showed through example) that Wells and Wellington ―based their [taxonomic] decisions on type descriptions at most, and did not examine the specimens.‖ Mengden‘s 1985(a) manuscript did not contain information on sample sizes or geographic locations (except for ―over 40 specimens‖ of P. textilis from ―throughout its range‖ and an Australian map representing P. nuchalis specimens which he may have used in his analysis), but did include all commonly-recognised taxa (at the time) in his analysis. Mengden‘s 1985(a) results were similar to, but more specific than, his 1982 thesis. Of note, Mengden (1985a) stated that P. guttata showed the greatest genetic distance from all other Pseudonaja, P. textilis is chromosomally consistent throughout its range, P. inframacula is genetically distinct from P. textilis and should be recognised as a distinct species, and that P. nuchalis was composite. Within P. nuchalis, Mengden defined seven karyomorphs which correlated to adult colour pattern and stated that there were at least four taxa (three distinct species and one composite species) within P. nuchalis. Mengden also discussed results from (and the need for more) hybridisation experiments, and touched upon the conflicting nature of ontogenetic and seasonal colour changes (for examples of the latter, see Banks 1981, Mirtschin and Davis 1983, Bush 1989a, Bush 1989b, and Orange 1992). Mengden‘s 1985(a) work, containing observations on and interpretations of Pseudonaja, continues to be one of the best references on Pseudonaja taxonomy. His 1985(a) manuscript called for the morphological and genetic examination of Pseudonaja from all museum collections, continued hybridisation experiments, and the raising of young from females of each colour morph. Mengden (1985a) finished with, ―Until such [a multidisciplinary] approach is realised, the current practice of erecting or resurrecting names can only be judged premature.‖

While not as comprehensive in Pseudonaja species content as Mengden (1985a), Wallach (1985) also published a cladistic analysis of terrestrial Australian elapids using past morphological characters and new soft anatomy characters. Wallach (1985) observed that left lung presence is variable in every Pseudonaja species except P. nuchalis and that P. nuchalis is the only Pseudonaja species with tracheal lung development. Wallach (1985) also noted that P. guttata is comprised of at least two


15

species (based on respiratory system morphology) and that P. modesta is most likely to belong to the genus Hemiaspis. Wallach (1985) iterated the need for sufficient sample sizes, specifying a minimum of 4–6 specimens of ontogenetic extremes of each sex required for proper analysis. Undaunted by criticism from taxonomists and herpetologists alike, Wells and Wellington published a new taxonomy of Australian amphibians and reptiles in 1985. Wells and Wellington (1985) included all Pseudonaja species listed in their 1983 work and also erected six new species of brown snakes (P. imperitor [NTM: specimen R3352], P. jukesi [NTM: specimen R1186], P. kellyi [NTM: specimen R1689], P. mengdeni [NTM: specimen R1989], P. ohnoi [NTM: specimen R1970], and P. vanderstraateni [NTM: specimen R371]). P. ohnoi was pulled from the ―Pseudonaja textilis complex‖ while the others came from the composite P. nuchalis. No characters or justification were offered for their previous species delineations, and only rudimentary characters (mostly colour and pattern) were offered for the six new brown snake species recognised, with no means to differentiate the new species from their original complexes. An application was thereafter lodged with the International Commission on Zoological Nomenclature (the Commission) to suppress the names and type designations nominated by Wells and Wellington (1985). Though the spirit of the International Code of Zoological Nomenclature (the Code) was found to be violated, due to procedural shortcomings and the fact that adherence to the Code is voluntary, the Commission ruled in 1991 that it did not have the authority to suppress Wells and Wellington‘s work. And although they ignored Wells and Wellington‘s contributions to Australian taxonomy in a brief review of Pseudonaja, Mengden and Fitzgerald (1987) did offer the following sage advice: ―Colour is perhaps the single most unreliable character in identifying Brown Snake species...‖. Western Australia was host to the last described brown snake of the 20th century. A new taxon was described from Rottnest Island (as predicted by Loveridge in 1934) by Storr in 1989. Storr (1989) separated Pseudonaja affinis exilis (WAM: specimens 3294, 12794–12797, 14922, 15028, 15029, 19867, 19870, 23998, 28896, 48633, 56888, 83928, and 87904) from Pseudonaja affinis affinis by its smaller body size, shorter tail, fewer subcaudal scales, increased number of postocular scales, and darker coloration. Storr also hypothesised that the smaller size of Pseudonaja affinis exilis may be dependent on the size of its prey. The beginning of the 21st century ushered in a new period of Pseudonaja examination. Wells presented a revised version of Pseudonaja


16

taxonomy in 2002, in which he erected three new genera to accommodate a split of the brown snakes. Pulled out of the ―Pseudonaja nuchalis complex‖, he also conditionally described P. gowi (SAM: ―...largest specimen of this species from the vicinity of Lyndhurst, SA in the South Australian Museum‖). Wells‘ (2002) revised phylogeny included: Dugitophis affinis affinis, D. a. exilis, D. a. tanneri, Euprepiosoma inframacula, E. ingrami, E. textilis, Notopseudonaja modesta, N. ramsayi, N. sutherlandi, Placidaserpens guttatus, Pseudonaja acutirostris, P. aspidorhyncha, P. carinata, P. gowi, P. imperitor, P. kellyi, P. mengdeni, and P. nuchalis. No reasons were given for not including three species (P. jukesi, P. ohnoi, and P. vanderstraateni) previously erected by Wells and Wellington (1985). Many of the descriptions were based on colour or pattern, morphological characters presented were rudimentary and minimally presented, no keys or characters were provided to separate the species, and at least some of the types had not been examined. In 2003, two taxonomic works on Pseudonaja were published by Hoser (2003a, 2003b). Hoser (2003a) described a new subspecies of Pseudonaja textilis (pughi; AMNH: specimens R73949 and R73959) from New Guinea and listed the names of subspecies he considered to be valid (P. t. textilis, P. t. inframacula, P. t. bicucullata, and P. t. ohnoi). Hoser (2003b) provided another P. textilis subspecies list (which did not include P. t. inframacula or his previously named P. t. pughi) and erected a new species Pseudonaja elliotti (from P. textilis; AM: specimen R132991 and MV: specimen D71085) from south-eastern Australia. Although published within a few months of each other, both compositions included slightly different lists of P. textilis subspecies names that Hoser considered to be valid, and neither contained supporting data or analyses to justify the differences. Despite the constructive criticism of the value of Hoser‘s earlier taxonomic contributions offered by Wüster et al. (2001), such concerns and suggestions for improvement appear not to have been heeded during the preparation of both (Hoser 2003a, Hoser 2003b) manuscripts.

The most recently published forays into the taxonomical complexities of Pseudonaja have been those of Skinner (2003, 2009) and Skinner et al. (2005). Skinner‘s Master of Science thesis (2003) compared mitochondrial DNA sequences, allozymes, external morphology, and karyomorphs in an examination of the phylogenetic status of nominal Pseudonaja affinis, P. guttata, P. inframacula, P. modesta, P. nuchalis (including many of the variants described in Gillam [1979]), and P. textilis specimens. Allozyme and


17

karyomorph data were collected from a few snakes, but without details of the subsampling regime of specimens. Skinner et al. (2005) is a replication of the molecular analyses contained in Skinner‘s (2003) M.Sc. thesis, adding P. ingrami and several more individuals to the overall sample size. In both the thesis and subsequent molecular publication, Skinner was somewhat critical of the work contained in Mengden (1985a). Despite these criticisms, and though using newer techniques and a larger sample size (in some species) than Mengden (1982, 1985a), the results from both of Skinner‘s works (2003, 2005) are similar to those of Mengden (1982, 1985a), thereby providing increased stability for the most widely recognised species of Pseudonaja. For example, all four works discuss the chromosomal uniformity of P. textilis, the existence of at least three species within the P. nuchalis complex, the need for better diagnoses of species, and the need for further research to provide a definitive Pseudonaja taxonomy.

Finishing his systematic review of Pseudonaja, Skinner (2009) presented an expanded version of the morphological analyses and results from his (2003) M.Sc. thesis. As he considered them to be valid species without any need for review, Skinner (2009) did not present any data for P. guttata, P. ingrami, and P. modesta. Skinner (2009) instead redescribed and re-summarised morphological traits and species limits for adult snakes of four species (Pseudonaja affinis, P. inframacula, P. nuchalis, and P. textilis). Of note, P. nuchalis was formally split into three, previously-described species (P. aspidorhyncha, P. mengdeni, and P. nuchalis). Skinner (2009) presented the results of multivariate analyses of continuous and meristic morphological characters as evidence for his taxonomic reorganisation of Pseudonaja, yet diploid chromosome number was used as the primary diagnosis for three of the six species and as the secondary diagnosis for two of the six species Skinner (2009) re-described. Additionally, though it was not a character included in the multivariate analyses of his museum snakes and despite the warning of Mengden and Fitzgerald (1987), colour was the most common morphological character used to primarily or secondarily diagnose species. Also of interest from Skinner (2009) was that separate multivariate analyses were conducted for female and male snakes, and the resulting characters declared to be useful to separate species were not always consistent between genders.

One final manuscript on Pseudonaja taxonomy was published prior to the submission of this thesis. In a self-published, internet journal, Hoser (2009) newly named four


18

subspecies of P. textilis (P. t. cliveevattii [NTM: specimen R33952], P. t. leswilliamsi [NTM: specimens R5203 and R5205], P. t. rollinsoni [MV: specimen D73622 and FMNH: specimen 73532], and P. t. jackyhoserae [AM: specimens R147652 and R147659]), one subspecies of P. guttata (P. g. whybrowi; NTM: specimens R4646 and R33899–R33901), and one subspecies of P. affinis (P. a. charlespiersoni; ANWC: specimen R1968). Type specimens were not examined and all but one specimen appear to have been chosen from registration numbers available from online museum databases or previously-published accounts (such as Gillam 1979 and Skinner et al. 2005). The few diagnosable characters listed by Hoser (2009) are generally uninformative (i.e., common to most taxa and written in such a general way as to make it unlikely to differentiate the taxon) or else arise from the work of other authors (such as Gillam 1979), and no data are provided to validate the subspecies named. The subspecies identified by Hoser (2009) appear to have arisen from splitting gene clades presented within Skinner et al. (2005) and then applying subspecies names to clades of differing geographic distributions. It is difficult to determine intent, but given the lack of detail presented and the absence of any taxonomic investigation, Hoser‘s 2009 publication appears to be a case of nomenclatural ‗prospecting‘, similar to the previous publications of Hoser (2003a, b), Wells (2002), and Wells and Wellington (1983, 1985). That is, Hoser (2009) has proposed new taxa with a hope that at least some of his named groups would prove to be valid by future researchers.

A timeline of brown snake taxonomic nomenclature is included in Appendix I. Photographs of each existing type specimen are included in Figures 1.3a–hh.

History Of Oxyuranus Classification And Nomenclature

The first European publication on any taipan species was printed seventy-seven years after the first published brown snake account. In not much more than two paragraphs, Peters (1867) described a new species of black snake from coastal Queensland, Pseudechis scutellatus (ZMB: specimen 5883; later to become Oxyuranus scutellatus). A second species of taipan, collected near the junction of the Murray and Darling rivers in New South Wales, was described by McCoy in 1879, again in just slightly more than two paragraphs. This species, Diemenia microlepidota (MV: specimens D12353 and D12354; later to become Oxyuranus microlepidotus), was originally ascribed as a new


19

Type material is missing and presumed lost for the following snakes (Cogger et al. 1983, personal search): Cacophis Güntherii – P. textilis Demansia textilis inframacula – P. inframacula Furina textilis – P. textilis Pseudoelaps Kubingii – P. textilis Pseudoelaps Sordellii – P. textilis c) Demansia acutirostris – P. nuchalis

a) Brachysoma sutherlandi – P. modesta

b) Cacophis modesta – P. modesta

d) Demansia annulata – P. textilis

e) Demansia guttata – P. guttata

f) Demansia nuchalis tanneri – P. affinis

g) Diemenia aspidorhyncha – P. nuchalis

h) Diemenia carinata – P. nuchalis

Figures 1.3a–hh. Images of holotype material for all described Pseudonaja (sub)species. Species names are listed in the following format: as printed at time of first publication followed by the most stable name of past few decades. See Appendix I for species synonyms and collection information.


20

i) Diemenia ingrami – P. ingrami

j) Furina bicucullata – P. textilis

k) Furina Ramsayi – P. modesta

l) Pseudechis cupreus (part) – P. textilis

m) Pseudelaps bancrofti – P. nuchalis

n) Pseudoëlaps superciliosus – P. textilis

o) Pseudoelaps superciliosus Beckeri – P. textilis

p) Pseudonaja affinis tanneri – P. affinis

q) Pseudonaja affinis – P. affinis

Figures 1.3a–hh. Continued.


21

r) Pseudonaja affinis charlespiersoni – P. affinis

s) Pseudonaja affinis exilis – P. affinis

t) Pseudonaja elliotti – P. textilis

u) Pseudonaja gowi – P. nuchalis

v) Pseudonaja guttata whybrowi – P. guttata

w) Pseudonaja imperitor – P. nuchalis

x) Pseudonaja jukesi – P. nuchalis

y) Pseudonaja kellyi – P. nuchalis

z) Pseudonaja mengdeni – P. nuchalis



22 bb) Pseudonaja ohnoi – P. textilis

cc) Pseudonaja textilis cliveevattii – P. textilis

dd) Pseudonaja textilis jackyhoserae – P. textilis

ee) Pseudonaja textilis leswilliamsi – P. textilis

ff) Pseudonaja textilis rollinsoni – P. textilis

gg) Pseudonaja textilis Pughi – P. textilis

hh) Pseudonaja vanderstraateni – P. nuchalis

aa) Pseudonaja nuchalis – P. nuchalis



23

species of brown snake, due to similarities in outward appearance. Macleay (1881) also possessed and described a snake (Diemenia ferox [AM: specimen not found and presumed missing; Cogger et al. 1983, personal search]; later to become Oxyuranus microlepidotus) from near the junction of the Murray and Darling rivers, but thought it so different in many respects from other Diemenia that he placed it within the genus with reluctance. These latter two ‗species‘ would not be seen again (at least in published accounts) for nearly 100 years.

In an 1896 catalogue of the snakes of the British Museum, Boulenger redescribed the three taipan species listed above, placing them all within one genus, Pseudechis. This generic change also necessitated one grammatical change: Pseudechis microlepidotus (later to become Oxyuranus microlepidotus). Many of Boulenger‘s notes are similar to the original species descriptions, but he also provided information on additional morphological characters. Significantly, Diemenia ferox was noted to have a divided anal scale, a characteristic typical of the brown snakes (taipans are typically thought to have a single, complete anal scale). He also, without comment, listed the first P. scutellatus specimens from outside of Australia (Papua New Guinea). Waite‘s 1898 account of Australian snakes lists both P. microlepidotus and P. ferox as having a divided anal scale, based on the catalogue of snakes in the British Museum (no further information is given, but Boulenger [1896] was presumed to be the uncited reference upon which Waite relied).

A new species of taipan, Pseudechis wilesmithii (QM: specimen J201; later to become Oxyuranus scutellatus), was briefly and unremarkably described in 1911 by De Vis. De Rooij (1917) provided the second published account of Pseudechis scutellatus in Papua New Guinea but did not mention a need for distinctive nomenclatural recognition of snakes from this region. The penultimate description of a new species of taipan, Oxyuranus maclennani (AM: specimens R7900 and R7901; later to become Oxyuranus scutellatus), was written by Kinghorn in 1923. It was Kinghorn‘s (1923) inferences about skull structure and dental characters (which comprise most of the manuscript) which led him to erect Oxyuranus as a new genus. But Kinghorn (1923) also noted strong external similarities between O. maclennani and P. scutellatus, which he originally thought might be the same species. His instincts were hindered because the type of P. scutellatus was in Germany (and therefore couldn‘t easily be examined for its


24

skull characteristics), because the published accounts of the number of subcaudal scale pairs of P. scutellatus varied wildly (presumably because of tail damage, a fact not noted in most species accounts), and because O. maclennani possessed 21 mid-body dorsal scale rows (two less than any other published taipan description). A later author was able to rectify and further advance some of these ideas. Specifically, Thomson (1933) believed skull and morphological differences were enough to warrant retention of the generic name Oxyuranus, synonymised O. maclennani with O. scutellatus, recorded that lower subcaudal scale counts were a result of tail truncation (damage), made note that mid-body dorsal scale counts can vary between 21–23, and put forth ―taipan‖, an aboriginal term for the snake, as the common name for O. scutellatus.

Kinghorn would later erect another new genus mostly based on skull and dental characteristics. Kinghorn (1955) synonymised Diemenia microlepidota and D. ferox into Parademansia microlepidotus based on the examination of two additional specimens (both with a single anal scale). One year later, Slater determined that the Papua New Guinea populations of Oxyuranus scutellatus were deserving of sub-specific status (O. s. canni; MV: specimen D8614) mostly due to a vertebral stripe. Of note, Slater (1956) was the first to publish detailed, raw data for the characters he measured and counted. Unfortunately, although fifteen specimens were reportedly examined, data were presented from only one snake. In 1963, Worrell recognised O. s. canni and O. s. scutellatus as valid taxa, and although not mentioned by name, the distribution of Parademansia microlepidotus was included as part of the distribution of O. s. scutellatus, with the author presumably treating the two species as conspecific. In his guide to dangerous snakes of Papua, Slater 1968 provided a brief description of O. s. canni in which he reported the mid-body dorsal scale count being 21, two less than in his original account of O. s. canni, showing that Papuan populations, like their Australian counterparts, were bimodal within this character.

Parademansia microlepidotus was redescribed by Covacevich and Wombey (1976) and found to be a distinct species. Covacevich et al. (1980) subsequently examined the relationship between scutellatus and microlepidotus and held that Parademansia was a junior synonym of Oxyuranus, that both species possessed single anal scales, and confirmed the mid-body scale counts of O. scutellatus were variable between 21–23. In the first molecular studies of taipans, Covacevich et al. (1980) and Mengden (1982)


25

looked at the karyomorphs of both species, finding that both had the same diploid number and general chromosomal morphology, and that small differences in at least one centromere position was sufficient to differentiate the two species. Although different banding techniques were used in both studies and returned the same general results, both studies lacked sufficient numbers of samples overall and within each gender, as first mentioned by Covacevich et al. (1980).

In terms of taipan nomenclature, the mid-1980s witnessed a brief period taxonomic chaos. In their zoological catalogue of Australia, Cogger et al. (1983) listed two species of taipans as being valid: Oxyuranus scutellatus (from Pseudechis scutellatus, Pseudechis wilesmithii, O. maclennani, O. s. scutellatus, and O. s. canni) and Parademansia microlepidota (from Diemenia microlepidota and D. ferox). To this, Wells and Wellington (1983) without comment added a third species, elevating O. canni to specific status. In a review of data known to date about taipans, Covacevich (1987) reinforced the idea of two species of Australian taipan, both from the same genus (O. scutellatus and O. microlepidotus), but did not comment on the taxonomic status of the Papua New Guinea populations. These populations were relegated again to subspecific status in Strimple and Covacevich (1997).

Four more manuscripts on taipan taxonomy have been published since Strimple and Covacevich (1997). Hoser (2002) claimed that the West Australian populations of O. scutellatus were different enough from other populations of O. scutellatus to warrant sub-specific status (O. s. barringeri; [WAM: specimen 60666]). However, this distinction was based solely on the geographic distributions of the three subspecies (barringeri, canni, and scutellatus) and without benefit of any differentiating morphological or molecular characters. As such a diagnosis is not compliant with the Code, Wüster et al. (2005) determined O. s. barringeri to be a nomen nudum (―naked name‖ – a name proposed without satisfactory definition or description). Doughty et al. (2007) described a new species of taipan, Oxyuranus temporalis (WAM: specimen 166250), based on morphological and mitochondrial characters collected from a single snake found in south-eastern West Australia. Finally, Hoser (2009) newly named a second subspecies of O. scutellatus from Papua New Guinea: O. s. adelynhoserae (BMNH: specimen 1992.542 and CAS: specimen 133796). Hoser (2009) also ‗newly‘ described O. s. andrewwilsoni (WAM: specimen 60666), which was really a


26

redescription of Hoser‘s (2002) earlier O. s. barringeri, a name which had been made invalid based on the comments of Wüster et al. (2005). As with his accounts of brown snakes in the same, self-published article, the information presented in Hoser (2009) is uninformative and the subspecies hypothesised seem to have arisen from cladistic ‗prospecting‘.

A timeline of taipan taxonomic nomenclature is included in Appendix II. Photographs of each existing type specimen are included in Figures 1.4a–h.

Thesis Aims and Layout

As detailed above, there has been a long taxonomic history to Oxyuranus and Pseudonaja. The development of an accurate and comprehensive understanding of all taxonomic relationships within and between these two genera has progressed slowly, and this progression has also, at times, been tumultuous and controversial. Despite the benefit of modern analytical techniques and large numbers of specimens available within museums, many of the same taxonomic questions that existed over 80 years ago (when the last, now-commonly-recognised brown snake species was first described) still exist through to the present era (when the last species of Oxyuranus was first described). Some reasons for this include the inherent morphological complexities within and between these groups, the lack of sufficient numbers of specimens utilised in past taxonomic reviews, incomplete geographic coverage of specimens chosen for examination, characters included for measurement differed between studies, and few, if any, type specimens were examined by past researchers. Thus, the incomplete resolution of Oxyuranus and Pseudonaja taxonomy may, at least partially, be due to the methodological approaches taken by past workers in this field of science. The general aim of this study was to answer: ―What are brown snakes and taipans?‖ This question was addressed by employing a systematic approach to specimen selection, a near-comprehensive approach to character selection, and the use of morphological and genetic analyses to investigate the systematic and nomenclatural hypotheses associated with Oxyuranus and Pseudonaja. The results from these analyses were then used to determine which morphological characters could easily distinguish between resolved taxa, and to create taxon-specific distribution maps. A large amount of additional data


27 a) Diemenia microlepidota – O. microlepidotus

b) Oxyuranus maclennani – O. scutellatus

c) Oxyuranus scutellatus adelynhoserae (paratype) – O. scutellatus

d) Oxyuranus scutellatus andrewwilsoni and Oxyuranus scutellatus barringeri (same snake) – O. microlepidotus

e) Oxyuranus scutellatus canni – O. scutellatus

f) Oxyuranus temporalis – O. temporalis

g) Pseudechis scutellatus – O. scutellatus

Type material is missing and presumed lost for the following snake (Cogger et al. 1983, personal search): Diemenia ferox – Oxyuranus microlepidotus

h) Pseudechis wilesmithii – O. scutellatus

Figures 1.4a–h. Images of holotype material for all described Oxyuranus (sub)species. Species names are listed in the following format: as printed at time of first publication followed by the most stable name of past few decades. See Appendix II for species synonyms and collection information.


28

was collected for use outside of this thesis if, as predicted, brown snake and taipan systematics were able to be more fully resolved. This has proven to be the case and these additional data will be used in the future to describe and update ecological correlates (diet, habitats, ectoparasites, and endoparasites) for each taxon recognised. This thesis is organised in the following manner:

Chapter 1 presents a review of published literature dealing with the taxonomy of Oxyuranus and Pseudonaja. Chapter 2 examines how different sampling methods can affect the results and interpretations of taxonomic research. A random, grid-based sampling approach—utilised during this thesis—is introduced, and an example of its efficacy (as compared with techniques used in past surveys) is demonstrated by the ability of each technique to differentiate the seven most commonly-accepted species of Pseudonaja. Chapter 3 details the current knowledge of the extraction and replication of DNA from formalin-fixed tissue (FFT). Over forty commonly-cited methods for DNA extraction from FFT were tested and a summary of their effectiveness is presented. Chapter 4 presents the results of phylogenetic analyses of DNA sequences extracted from tissue of live or recently deceased snakes, extracted from tissue of formalin-fixed museum samples (using methods recommended in Chapter 3), and available online (GenBank) as part of past molecular studies (Benson et al. 2008). A brief appraisal of the usefulness of currently measured morphological characters within phylogenetic analyses is also included. Chapter 5 presents the results of univariate and multivariate analyses of morphological characters measured from over 1,400 specimens of Oxyuranus and Pseudonaja, summarises the evidence for all taxa recognised and past systematic hypotheses, and updates the geographical distributions of all taxa recognised. Chapter 6 provides a general discussion and overview of the results obtained in this thesis, as well as offers suggestions for future research on this diverse group of snakes.

CHAPTER 2 – CAN SYSTEMATIC SAMPLING METHODS IMPROVE SYSTEMATIC TAXONOMY? AN EXAMPLE USING SNAKES

OF

THE

GENUS

PSEUDONAJA

(SERPENTES:

ELAPIDAE)

Abstract

Published taxonomic research can seem less rigorous than other scientific disciplines. In part because of the descriptive nature inherent to taxonomy, systematic research and taxonomic results can be based on small, often localised numbers of specimens relative to the full geographic distribution, and they may only include a relatively small number of characters to be measured. As seen in Chapter 1, Pseudonaja taxonomy has had a long, often controversial history. Much of this controversy may have been the result of methodological choices made by past researchers. If this is the case, then an improved research design should lead to a variety of improvements, such as the ability to detect operational taxonomic units or the characters used to define them. Presented here are results of tests of these assumptions based on measurements obtained from 982 Pseudonaja specimens collected from throughout their geographic distribution (including all existing type specimens) as well as a comparison of past identification guides to the seven currently and most widely recognised species of Pseudonaja. The use of a simple and unbiased protocol led to an improved key to the genus as it currently stands, and is presented here. Finally, this chapter concludes with ten suggestions (derived from trends noted in published taxonomic literature) to researchers planning to conduct future taxonomic reviews. These recommendations (including the principles behind the research protocol detailed in this chapter) will help to improve the quality of future taxonomic research.

Keywords: Identification Guide, Pseudonaja, Research Design, Systematic Taxonomy.

Chapter 2: Systematic Taxonomy

30

Introduction

Taxonomy is an important branch of science and, like all scientific sub-disciplines, should include hypothesis generation, careful methodological design, systematic data collection from a sample size large enough to capture the full range of natural variation in order to afford confidence in any statistical measures, thorough data analysis, and a full presentation of results. However, most published taxonomic work is still largely descriptive in nature and, whether the work has described new or revised existing taxa, is frequently based only on a small number of specimens relative to the characters used and the geographical area covered by the taxa. Though it makes sense that a taxon, newly presented to the world, needs an accompanying diagnosis and description, the research behind the description is not held up to the same standards as those of other scientific disciplines. Taxonomic work frequently lacks detailed information documenting the full range of variation within each morphological character presented, or information which may help to differentiate new taxa with other, closely related taxa, or does not present the raw data enabling a reader to repeat or conduct comparable analyses in order to confirm the results.

Because minimal description is all that is required to formally recognise new taxa, there can be a rush to publish taxonomic work, aspects of which may include substandard descriptions and non-informative characters (International Commission on Zoological Nomenclature 1999, Godfray 2002). An equally important consideration for any taxonomical endeavour is the choice and quality of methods employed as part of the research design. If the methods behind any description are inadequate, hastened publication can lead to presumed evolutionary relationships which are untenable, nomenclature that is not consistently used, and increased levels of time, effort, and money required to re-examine specimens and correct inaccurate or incomplete results. As detailed in Chapter 1, an example of a taxon in need of review for reasons mentioned above is that of the Australasian brown snakes, Pseudonaja (Günther 1858).

Beginning with the first published description of Furina textilis by Duméril et al. in 1854 (the genus Pseudonaja would not appear for another four years), individual species of Pseudonaja have been placed and re-sorted into no less than eighteen different genera (Appendix 1). The number of extant species is also a source of debate


31

among herpetologists, though it is generally agreed that there are more than the seven species currently and most widely recognised (Cogger 2000): P. affinis (Günther 1872), P. guttata (Parker 1926), P. inframacula (Waite 1925), P. ingrami (Boulenger 1908), P. modesta (Günther 1872), P. nuchalis (Günther 1858), and P. textilis (Duméril et al. 1854). Efforts to help clarify the taxonomy within this genus have tended to utilise small and/or regionally-biased sample sizes (see Mengden 1982, Skinner et al. 2005), have lacked scientific rigour (see Wells and Wellington 1983, Hoser 2003a, Hoser 2009), or have not examined all species commonly associated with Pseudonaja (see Skinner 2009). Though some past taxonomic investigations (see Gillam 1979, Mengden 1982, Skinner et al. 2005) have helped to advance our understanding of Pseudonaja taxonomy, the lack of a thorough analysis of the genus limits the reliability of current field guides and our knowledge of Pseudonaja taxonomy.

Despite their common name, brown snakes are variable in colour and pattern, and individual colour and pattern may change seasonally or ontogenetically (Mengden and Fitzgerald 1987, Cogger 2000). Pseudonaja are found throughout mainland Australia and the range of at least one species (P. textilis) continues northward into Papua-New Guinea and Indonesia (Longmore 1986, O‘Shea 1996, Cogger 2000, Kuch and Yuwono 2002, Williams et al. 2008). Utilising most terrestrial habitats, brown snakes are the most widely distributed venomous snake genus in Australia (Greer 1997, Cogger 2000), a factor that further contributes to difficulties in unravelling their taxonomy. With a cosmopolitan distribution—widely overlapping that of human distribution in Australia—and highly toxic venom, it is not surprising that brown snakes are responsible for the majority of Australia‘s fatal and life-threatening human and domestic animal snakebites each year (White 1987, Sutherland 1992, Sutherland and Leonard 1995, Mirtschin et al. 1998). Due to their medical and economic importance to humans, most research on this genus has been and continues to be laboratory- and venom-based. Fewer scientists have examined Pseudonaja systematics, and most researchers have attempted to do so in greatly different ways (see Chapter 1 for complete overview).

Most of the publications reviewed in Chapter 1 have helped to resolve Pseudonaja taxonomy, especially those of Mengden, Skinner, and their co-authors. There may be two main reasons past researchers have been unable to achieve comprehensive


32

resolution of this genus: the effects of recent or rapid evolutionary events, as well as the methods chosen for analysis of these events. Examples of the latter include insufficient sample sizes, the exclusion of certain age/size classes, the potential misclassification of individual specimens, incomplete geographic coverage of specimens chosen for examination, unstructured selection of individual snakes and morphological characters chosen for analysis, and the under-emphasis of morphological variation. Some of these issues were present in a review of Pseudonaja mitochondrial genetics (Skinner 2003), which noted that ―the species level systematics of Pseudonaja is perhaps not as poorly resolved as previous authors have supposed‖. In a manuscript on the phenotypic and molecular evidence for the phylogeny of Australasian venomous snakes, Scanlon and Lee (2004) ended with: ―Increased reliance on genetic data alone may be seen as avoiding problems due to morphological convergence, but would also entail neglect of much of the currently available phylogenetic evidence, as well as much of the data of biological and evolutionary interest.‖ A subsequent manuscript—which detailed morphological variation of selected brown snakes (Skinner 2009)—underscored the genetic results of Skinner (2003) but also contained some previously-described methodological issues. However, methodological concerns are not restricted to the works listed above.

To date, studies have differentiated Pseudonaja species from other Australian elapids and from each other using a variety of techniques, including external morphology, soft anatomy, osteology, hemipene morphology, karyology, genetics (mitochondrial DNA, allozymes), and ecology (Mengden 1982, Baverstock and Schwaner 1985, Mengden 1985a, Mengden 1985b, Schwaner et al. 1985, Wallach 1985, Shea et al. 1993, Slowinski et al. 1997, Keogh et al. 1998, Keogh 1999, Cogger 2000, Scanlon and Lee 2004, Skinner et al. 2005, Skinner 2009). However, successfully matching mutually exclusive results from these studies with perceived or hypothesised species delineations has proved troublesome, perhaps because most Pseudonaja species may be composite and the use of reduced sample sizes with incomplete geographic coverage has prevented examination of the full range of variability found within each species (Cogger 2000). As a consequence, field guides and taxonomic reviews of this genus continue to use colour and pattern as primary and/or secondary characters to differentiate individual species of brown snakes, despite the observations of Mengden and Fitzgerald (1987): ―Color is perhaps the single most unreliable character in identifying Brown Snake species...‖ If


33

their comment is correct, there is a need for a new assessment of the genus, without using characters involving colour or pattern, before a more accurate morphological key to Pseudonaja species can be constructed. Furthermore, any assessment should involve a systematic approach to sample selection.

This chapter presents comparative results of meristic and continuous measurements (excluding colour and pattern) obtained from 982 Pseudonaja specimens collected from regular intervals throughout their geographic distribution (including all existing type specimens). Through the use of this simple method, presented here are selected aspects of morphological variation within the genus, an appraisal of past identification guides to the seven currently and most widely recognised species of Pseudonaja, and the introduction of an improved key to the genus as it currently stands. The new key does not constitute a complete or final revision of the genus, as it does not incorporate additional lines of evidence such as molecular or ecological data (Eernisse and Kluge 1993, Sanders et al. 2006). Instead, the new key is the product of a comparative morphological exercise which tested the suitability of using a systematic sampling technique designed for use with taxonomic reviews or analyses (see Chapters 4 and 5). Finally, this chapter concludes with ten suggestions (derived from trends noted in published taxonomic literature) to researchers planning to conduct future taxonomic reviews.

Materials and Methods

The seven species (Pseudonaja affinis, P. guttata, P. inframacula, P. ingrami, P. modesta, P. nuchalis, and P. textilis) included in this study were chosen for their relative taxonomic stability, the quality of their original descriptions, and their acceptance as valid taxa by most herpetologists (Cogger 2000, Wilson and Swan 2003). The recent decision by Skinner (2009) to split P. nuchalis into three separate species is not addressed here (see Chapters 4 and 5) as Skinner (2009) failed to examine three of the seven species in this genus (P. guttata, P. ingrami, and P. modesta) and because all Pseudonaja species have been surmised to be composite (Cogger 2000). Information (e.g., species name, collection date, and collection location) on 9,087 brown snakes held in museums or natural history collections in Australia, Europe, and North America was obtained and plotted with ArcGIS 9.3 geographical information systems software


34

(Chapter 1: Figure 1.1; ESRI 2005). Museums were then visited and all snakes found were examined. Museum designations were initially used to guide species identifications. Snakes with potential registration errors (e.g., a P. affinis record from north-eastern Queensland, though the distribution of this species is restricted to southern South and Western Australia) were brought to museum staff for consultation and species designations were updated accordingly. Each snake was subsequently given a unique identifying number in an ArcGIS database. Maps of updated records were overlaid with a 1° x 1° grid and, using a random number generator (Haahr 2007), one snake from each of the seven nominative species from each grid square was randomly chosen for detailed ecological, genetic, and morphometric examination (Figure 2.1). If a given snake was either missing from a collection or too damaged to take most measurements, it was replaced if possible by another individual of the same species randomly chosen from the same grid cell. Snakes selected for detailed measurement were not preferentially chosen nor analysed separately according to their size, age, or gender as has been reported in other studies (such as Werner et al. 1999 or Skinner 2009). Hence, the snakes utilised in this study can be assumed to be a random assortment of genders, sizes, and ages taken from available museum specimens.

A randomised, grid-based approach is a simple and easy way to conduct a systematic review of any taxon, especially those that are well-represented in museum collections. One need only to optimise the size of each grid cell so as to allow a large enough sample size to capture the majority of natural variation in a population yet minimise the number of specimens surveyed in order to avoid unnecessary data collection. Utilising a one specimen per species per cell, grid-based sampling strategy ensures all geographic areas are surveyed and most likely prevents over-representation (pseudoreplication) of morphological variants, haplotypes, etc., from major populated areas (from where many museum specimens will most likely have been collected). As one of the purposes of using this method is to determine the scale at which variation occurs, grid cell sizes are easily scalable in future studies. For example, areas of distributional overlap between species or morphological variants could be re-examined at a finer scale (smaller-sized grid cells) to determine boundaries more accurately. Conversely, initial studies which showed no variation could lead to the use of larger-sized grid cells in future studies in order to save time and resources.


35

Ideally, grid cell sizes will be related to the natural history of the study organism. In the case of Pseudonaja, little is known about habitat use for any brown snake. In the only published study about their movements, Whitaker and Shine (2003) documented that the average home range size for adult, radio-telemetred P. textilis at one location in south-eastern Australia was 5.8 hectares (ha; with larger home ranges for larger snakes) and the longest recorded one-day, round-trip movement was 2.32 kilometres (km). It was determined that a 5.8 ha or 2.32 km2 grid cell size was too small, as the majority of the 9,087 museum snakes would be selected in grid cells of those sizes, and analyses would thus take an inordinate amount of time to complete. As the genus Pseudonaja has a continental distribution, and as continents have typically been mapped in one degree increments of latitude and longitude since at least the 1500s (Pohl 1944), a one degree2 grid cell size was chosen for use. This provided a potential of just over 1,000 unique grid cells across the full geographic distribution of Pseudonaja, allowing a large enough sample size for statistical analysis and an attainable number of snakes to measure in a timely manner.

Although becoming more prevalent in modern taxonomy, it was decided not to use multivariate analyses (such as principal components analyses, perhaps the most common multivariate analyses used in the field of taxonomy) in this chapter for statistical and methodological reasons. Principal components analyses assume linear relationships among characters, and though tests of this assumption are rarely presented in taxonomic literature, complete linearity is extremely unlikely, especially when including a high number of characters for analysis (Magnusson and Mourão 2000, Quinn and Keogh 2002, Raykov and Marcoulides 2008). Principal components analyses also transform characters into new components; the variation of each component is influenced (but not equally so) by the variation present in all characters (that is, all characters contribute somewhat to every component; Quinn and Keogh 2002, Raykov and Marcoulides 2008). Principal components are ranked by the amount of overall variation in the data set they explain (Quinn and Keogh 2002, Raykov and Marcoulides 2008). These components (usually the first two or three) are then plotted in two (or three) dimensions and the resulting pattern of data points are interpreted for their amount of overlap or exclusivity. However, determining the relationship between the original variables and their derived components is not always straightforward (Magnusson and Mourão 2000).


#

36

#

#

#

# # #

# # #

# # # # # # # # # # # # ## # # # # ## ## ### # # # # # # # ## # # ## ## # ## # # # ### # # # # # # # ## # # # # # # # ## # # # ## ## # # # ## # # # ## # # # # # # # # ## ## # # # ## ## # # #### # # ### # # # # ## # # ## ## # # # # # # # # ## # ## # ## # ## ## # ## # ## # ## ## # ## # # # # # ## # # # # # # # ### #### ## # # # ## # # # # ## # # # # # ## # # # ## # # # ### # # # ## # ## # ## ## ## # # # ## # ## # # # # # # ## # # ## # # # ## # # # # # # ## ### # ## # # # # # # # # ## ### ### # ## ### # # # # # ## # #### ## # # # # # ## # # ### ## ### ## #### # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # # # ## # # # # # # # # ## # # ## # ## ## # # # # ## ## # # # # ## ## # # # # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # #### ## # ## # # ## # # ## # # ## # # # ## # # ## ## #### # # # # ## # #### ## # ## # # # # ## ## # # ## # ## # # ## ### # ## # # # # # # # # # # # # ## # ## # ## ## # ## # ## # # # ### # # # # # ## # # # ## # # # # ## # # ##### ## # # # # # # # ## ## ## # ## ## # ## # ### # # # # # # # # # # # # # # # # # # # # ## # # ## # # # # # ## # ## # # # ## # ### ## ## ### ## # ## # ## # # # # # # # # # # # ## # # # # # # ## # # # # # # # # ## # ### # ### ### # # ## ### # ### # ## # # # # # ## # # ### # # ## # # # ## ### ## #### ## ## # # # ## # ## # # # # # # # # # # ## # # # ## # # # ## # # # # #### # ## ## ## # # ## # # ## # ## # ## # # ## # # ## # # # ## # # ## # ## ## # # # #### ## ## ## # # # ## # # # # # # ### # # # # # # ## # #### ## ## # # # # # # # # ## # # ## ### # # ## # ## ## # # ## # # # ## # # # # # ## # # # # # # # # ## # # # ### # # # # ## # ######## # # # # # ## ## ### # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # # # ## # ## # # # # ## # # ## # # # # ##### ## # # # # ## # # # # ## # # # # # # ## # # # # # # # ### # # ## # ## ## ## ### # ## ### ## # # ## # # ### # # # ## # # # # # ## # ## ## #### ## # # ## # # # # ### # ## ## # #### # # # # # # # ### ## # # # # # # ## # # # # # # # # # # # ## # # # # # ## ## # # # ## # # #### # ## # # # # ## ## # # # # ### # # ## # # ## ## # # # # ## # # # # # # # ## ## # # # ## ## # # # ## # # ## # # # ## ## # # # ## # ## # # ## # # # # # # ## ### ## # # ## # # # # # ### ## # # # ### ## ###### ### # # # ### # # # ## # # # # # # # # # # # # # # # # ## # # # # # # ## # # # # # # ### # # # # ## # # # # # # # # # ## ## # # ## ####### # # # # ## # ## ## # # # # # # # # ## ## # # ## # ### ## # # # ### ## ## ## ### # # # # # # # # # # # ## # # ## ## # # # # # # ## # ## ## # # # # # # # ## # ### # ## # # # # # ## # # # # # # # # # # ### # ## # # ## # ## # # # #### ## # # ## # # # ### ## # # ## # # ## # # ## # # # # # ## # ## # ## # # # ### # # ## # # # ### # # # # ## # # # ## # ## ##### # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ## # # ## ## # ## # # ### # # ## # ## ### # # # ## # # # # # ## ####### ## # ## # ## # # ### # # # # ### # #### # # ### # # # # # # # ## # # # #### # ## ### # # ## ### # # # # # # ## ## # ## #### ### # #### # # # ### # # #### ### ## ## ### ### ## # ### ## # ## ## # # # ## # ######## # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ### ## ## # # ## # # ## #### ### # # # ## # # # ### ## # # # # ## # # ## # ### ## # ## #### # # ## # # ## ### # # # # # # ###### # ### # ##### ## ### # # # # # ## # # # ## ## # # # # # ## ## # # ## ### #### # # # # ### # ## # # # # ## # # # # # # # ## # # # # # # # # # # # ## ######### # #### # ###### # ### ## ## ## ## ## # ## # ## # # # # ## ## ## # # # ### # ## # # # #### # # ## ## ## # # # # # # # # # # ## # # # # # # ## # # # # ## # # # # # # # # ## # # # # # ## ### # ###### ## # # # # ## # ### ### # #### ## ## # ## # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # # # # # # # # # ####### # # ## # # # ### # # # # ## ## # # # ## # ## # ### ## # # # ## ## # ###### ## ### ## # ### # # # ## ## # # # # # ## ## # ## # # # # ## # ## ## ######## # ## # # # # # # ## # ## # # # # ## # # # # # # ## #### # # # # ### ### # ## ## # # # ### #### # # # ## # ## ## ## # # ## #### ### # # # ###### ## ####### # # # # # ## # # ## # # # # # # ## ## ## # ## # ## # # ## ## ## # # ### ## # # # ## ### # # # ## # # ## # ## # #### # # # # ## ## # ## ## # # # ## ### # ## # ## #### # # ### ## ## ####### # # #### # ## #### ## # ###### ### # # ## # # # # # # ### # ## ## # # ## ## ## # # # # # ## # ## ## ## # # ## # # # ##### ## # # # # # ## ##### # # ## # # # # ## ## # # # # # # ## ## ### # # # # # # ###### ## ## # ## # # # # # #### ## # # # # # ### ##### # ## # ######## # # # # # # # # # # # # ### # # # #### # ### ## # ## # ### # # # # # ## # # # ### # # # ## # ##### ## # # # #### # # # # ## ### # ## #### ## # #### # # # # #### # ### # ## # # # ## ## # ## # ## # ## # #### ## # ### # # # # # # # # # # # # ## # # # # # # # # ## # ####### # ### ## ##### # # # # ## # #### # # # # # ## # # # ## # # # # # ### # ### # # # # # # # # # ## ## ## # # ## # ##### # # # # ### # # # ## # # ## # # ## # # # ### # ### ### # ## # # # # # # # # # # ######## ## # ## ## # # # # ## # # #### # # # # # # # ### ## ## # ## # # # # ### ## ## # # ###### # # ## # # # # # # # # #### ## ## ## ## # # # # ## ## # # # # # ## ## ## ## # ## ## # # # # # # ### # ## ## # # # # ## # # ## # # # # # ## ## # ## # # # ##### # # ## # # #### ## # # # # ## # # #### # # ### # ## ### # # ## ## # ## ## ## # # # # # # # # # # # # ## # # # ### # ## # # # #### ## # # ### ## # ## ## ### # ## ### # ## # # # # ##### ## # ## # # ## # # # ## # # ## # # ## ## # # ## # # ## # # # ### # # ## ### # # ## # #

# # # # # # # # # # # # ## # # # # ## ## ### # # # # # # # # # # ## ## # ## # # # ### # # # # # # # ## # # # # # # # ## # # # ## ## # # # ## # # # ## # # # # # # # # ## ## # # # ## ## # # #### # # ### # # # # ## # # ## ## # # # # # # # # ## # ## # ## # ## ## # ## # ## # ## ## # ## # # # # # ## # # # # # # # ### #### ## # # # ## # # # # ## # # # # # ## # # # ## # # # ### # # # ## # ## # ## ## ## # # # ## # ## # # # # # # ## # # ## # # # ## # # # # # # ## ### # ## # # # # # ## ## # # ## ### ### # ## # # # # # # ### #### # # # # # # # ### ## ## ### ## #### # # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # # # ## # # # # # # # # ## # # ## # ## ## # # # # ## ## # # # # ## ## # # # # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # #### ## # ## # # ## # # ## # # ## # # # ## # # ## ## #### # # # # ## # #### ## # ## # # # # ## ## # # ## # ## # # ## ### # ## # # # # # # # # # # # # ## # ## # ## ## # ## # ## # # # ### # # # # # ## # # # ## # # # # ## # # ##### ## # # # # # # # ## ## ## # ## ## # ## # ### # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # ## # ## # # # ## # ### ## ## ### ## # ## # ## # # # # # # # # # # ## # # # # ## # ## # # # # # # # ## # ### # ### ### # # ## ### # ### # ## # # # # # ## # # ### # # ## # # # ## ### ## #### ## # # # ## # ## # # # # # # # # # # # ## # # # ## # # # # # # # # #### # # ## ## ## # # ## # ## # # ## # ## # ## # # # # ## # # # ## # # ## # ## ## # # # #### ## ## ## # # # ## # # # # # # ### # ## # # ## # #### # ## ## # # # # # ## # ## # # ## # ### # # ## # ## ## # # ## # # # ## # # # # # ## # # # # # # # # ## # # # ### # # # # ## # ######## # # # ## ## ### ## # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # # # ## # ## # # # # ## # # ## # # # # ##### ## # # # # ## # # # # ## # # # # # # ## # # # # # # # ### # # ## # ## ## ## ### # ## ### ## # # ## # # ### # # # ## # # # # ## # ## ## #### ## # # ## # # # # # ### # ## ## # #### # # # # # # # ### ## # # # # # ## # # # # # # # # # # ## # # # # # # ## ## # ## # # #### # ## # # # # # ## # # # ### # # ## # # ## ## # # # # ## # # # # # # # # ## # ## ## # # # ## ## # # # ## # # ## # # # ## ## # # # ## # ## # # # # # # # # ## ### ## # # # ## # # # # # ### ## # # ###### ### # # # ## ## ### # # # ## # # #### # # # # # # # # # # # # ## # # # # # ## # # # # # # ### # # # # ## # # # # # # # # # ## ## # # ## ####### # # # # ## # ## ## # # # # # # # # ## ## # # ## # ### ## # # # ### ## ## ## ### # # # # # # # # # # # ## # # ## # ## # ## # ## ## # # # # ### ### # # # # # # # # # # # # # # # ####### # # # # # # # ### # ## # # # ##### ## # # ## # # # ### ## # # ## # # # ## # # # # # # # ## # # # # ## # ## # # # ### # ## # # # # # ### # # # ## ## # # ## # ## ##### # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ### ## ## # # ## # # # ####### # ## ## # # ## ## # # ### # # # ## ## # ### # # # # # # # ## ####### ## # ## # ## # # ### # # # # ### # #### # # ### # # # # # # # # ## # # # #### # ## ### # # ## ### # # # # # # ## ## # ## # ### # # # # ###### # # #### ### ## ## ### ### ## # #### ### ## # ## # ## # # # ## # ######## # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ### ## # ## #### ### # # # ## # # # ### ## # # # # #### # # # # ## # # ## # ### ## # ## # ##### ## #### # # ## # # ## ### # # # # # # # # ###### # # # # # # ## # # # ## ## # # # # # ## ## # # ## ### #### # # # # ### # # ## # # # ## # ## ## # # # # # # ## # # # # # # # # # # # ## ######### # ## # # ### ## ## ## ## ## # ## # ## # # # # # # ## ## ## ## # ## ## # ### # ## # # #### ## # # ## ## ## # # # # # # # # # ## # # # # # # ## # # # # ## # # # # # # # # ## # # # # # # ## ### # # ## # # # # ## # ## # ### ### ### # #### ## ## # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ####### # ## # # # ### # # # # ## ## # # # # ## # ## # # ### ## # # # ## ## # ###### ## ### ## # ### # # # ## ## # # # # ## # ## # # # ## # # ## # ## ## ######## # ## # # # ## # # ## # ## # # # ## # # # # # # ## #### # # # # ### ### # ## ## # # ### #### # ## # # ## ## # # ## #### ### # # # ######## ####### # # # # # ## # # ## # # # # # # ## ## ## # ## # # ## ## ## # # # # ## # # # ## ### # # # ## # # ## # ## # #### # # # ## ## ## # ## # ## ## # # ### # ## # ## #### # # ### ## # ####### # # ######## # # ## #### ## # ###### ### # # ## # # # # # # # # ## ## # # ## ## ## # # # # # # ## # ## ## ## # # ## # # # ##### ## # # # # # ## ##### # # # # # # # # ### # ## ## # # # # # # ### # # # # # # ###### # ## ## # ## # # # # # # #### ## # # # # # # # ### ##### # ## # ######## # # # # # # # # # # # ### # # # # # ## # ### ## # ## # ### # # # # # # ## # # # ### # # # ## # # # # ##### ## # # # #### # # # # ## ### # ## #### ## # # # #### # ### # ## # # # ## ## # ## # ## # ## # #### ## # ### # # # # # # # # # # # # ## # # # # # # # # # ## # ######## # ### ## ##### # # # # ## # #### # # # # ## # # # ### # # ### # ### # # # # # ## # # # # # # ## ## ## # # ## # ##### # # # # # ## # # # ## # # ## # # # # # # ### # # ### # # # # # # # # # # ######## ## # ## # # # ## # # # # # # ## # ## # ### ## ## # # # # # ### # # # # ## ### ## ## # # # ## # # # # ###### # # # # # ### # # ## # # # # # # ## # # # # # ## ## ## # # ## ## ## ## # ## # # # # # ### # ## ## # # ## # ## # # # # # ## # # # ## # # # ## # ## # # # ##### # # #### ## # # # # ## # # #### # # ### ## # ## # ## ## ## # ## ## ## # # ## # # # # # # # # # #### # ## # ## # # ## # # # #### ## # # ### ## # ## ## # # ## ### # ## # # # # ##### ## # ## # # ## # # # ## # # ## # # ## # ## # # ## # # ## # # ### # ### # ## # # # ## # #

Figure 2.1. Image series showing process of museum snake selection. Coloured dots represent snake species as in Chapter 1: Figure 1.1. Green cells represent areas where museum snakes were located and measured successfully. Red cells represent areas where museumregistered snakes had either been lost or destroyed.


37

Though the first few components often may correlate with gender or age and may have very little to do with taxonomic distinctness, it is these components that are often graphically presented (without explanation or further testing). The seemingly apparent geometric relationships perceived on a principal component graph are real only if a geometric measure (such as Euclidean distance) is used in the analysis, if the original characters are not transformed, and if all the original characters are truly measurable on the same scale (Magnusson and Mourão 2000). Some multivariate analyses are put forward as an unbiased presentation of data that has led researchers to uncover new taxa. However, given that ‗clouds‘ of data points representing different taxa almost always overlap (sometimes considerably) in a principal components graph, and given that there is usually no accompanying explanation as to how the researchers differentiated between overlapping clouds/taxa, researchers are able to promote unsettled taxonomic hypotheses (as an example, see Figure 3 [page 683] in Keogh and Smith 1996). If there are enough data and if the pattern in the data is strong, raw data (with or without accompanying simple statistics) will yield similar conclusions to more complicated statistical methods (Magnusson and Mourão 2000). This is not to say that multivariate analyses should be avoided in taxonomy—these analyses can be useful to find groups (cluster analysis), to determine which characters differentiate groups (discriminant function analysis), to explain the relationships between characters (canonical analyses), or to detect structure between characters or reduce the number of characters (principal components and factor analyses; Quinn and Keogh 2002, Raykov and Marcoulides 2008). However, one should keep multivariate assumptions and limitations in mind when reviewing taxonomic literature.

For this exercise, given that the purpose of this assignment was neither to uncover the existence of new taxa nor determine group membership or relationships, and given that the purpose was specifically to look for the presence of specific characters to help differentiate widely accepted taxa, univariate analyses were used in this study. Univariate statistics have their own assumptions as well, such as assuming that selected individuals comprise a random sample from all possible individuals, assuming individuals are selected independent of each other, and assuming measurement data fit a normal distribution (Magnusson and Mourão 2000, Quinn and Keogh 2002, Raykov and Marcoulides 2008). These assumptions can be tested mathematically or easily met through a carefully designed research plan. Using this study as an example, individual


38

snakes were chosen from separate 1° x 1° locations (to insure independence), each snake chosen from a 1° x 1° grid cell was selected randomly from all possible snakes in that grid cell (as described earlier in this chapter), and the use of large sample sizes without the omission of certain size, age, or gender classes helped to obtain normal distributions of all continuous characters measured (central limit theorem; see Figure 2.3, for example). With a large scale, systematic sampling regime in place, the selection of measureable characters commenced.

An external morphological character list was created consisting of novel features which showed variation in initial pilot studies as well as most characters referred to in Pseudonaja field guides and original species descriptions (n = 313; Appendices IV and V). These characters were then measured on 982 snakes selected for detailed examination. Univariate graphs of measured values from each character were examined for variability between species and were used to detect any strong morphometrictaxonomic dichotomies appropriate for species-level clarification. After reviewing the ability of a given character to differentiate the seven currently recognised taxa from each other, six characters (three previously published in original species descriptions, three presented here for the first time) were used to create a new identification key to the genus.

Existing regional (Gillam 1979 [Northern Territory], Storr et al. 1986 [Western Australia], Coventry and Robertson 1991 [Victoria], and Wilson 2005 [Queensland]) and distribution-wide (Kinghorn 1964 and Cogger 2000) brown snake identification keys were tested using measurements from non-type specimens. These keys were chosen as they were each published subsequent to the identification and publication of types associated with the seven currently and most widely recognised species of Pseudonaja. Snakes included for analysis were appropriate for each key: regional comparisons utilised snakes from relevant areas, while distribution-wide comparisons utilised all snakes. Accuracy was assessed for all keys as follows: 

Individual Line Accuracy – percentage of correct identifications at a particular line of a couplet. In other words, percentage of individuals known to be species X, Y, ..., N that are correctly identified as species X, Y, ..., N at a particular line of the key.

Chapter 2: Systematic Taxonomy 

39

Individual Couplet Accuracy – percentage of correct identifications at a particular couplet within the key. In other words, the total number of correct identifications from both lines of a couplet divided by the total number of individuals possible from both lines of a couplet.



Total Key Accuracy – percentage of correct identifications, summarised together from all stages of the entire key. In other words, the total number of correct identifications from all couplet lines divided by the total number of individuals possible from all couplet lines.

A simplified, illustrated example on how the keys are scored (with the accompanying raw data) is presented in Tables 2.1 and 2.2. Scoring in this way (as opposed to simply counting the number of individuals correctly identified out of the total number of individuals) not only allows the entire key to be evaluated, but also allows for identification of weakly effective lines or couplets within a key. Unquantified language was omitted when testing the identification keys (for example, ―usually broadly contacting the preocular‖ was changed to ―broadly contacting the preocular‖). In addition, non-specific words or characters (for example, ―broadly‖) were trialled at a variety of levels (for example, > 5%, > 10%, > 25%, > 33%, > 50%, > 67%, > 75%, etc.) and results from the value that yielded the most ‗correct‘ answers were used for testing. As the majority of published keys are regional, to extrapolate these keys outward would lower their accuracy (due to encountering additional species for which the key was not designed). Accordingly, regional results of the new key are also presented for direct comparison. Finally, each distribution-wide key was applied to data collected from all located type specimens associated with this genus.

Four assumptions were made for all tests. First, it was assumed species-level identification of each specimen was correct prior to using each key (for rationale of this assumption, see Discussion). Second, it was assumed that a user of any of the keys or field guides presented would be able to identify Pseudonaja to genus but require help with species-level identifications. Third, it was not assumed that the keys cited here for comparative purposes were compiled haphazardly by their authors, nor was it assumed that these keys were products of detailed morphometric and taxonomic analyses. No criticism of the authors or their work should be inferred by the comparisons presented here. Due to the individual anomalies found within most living taxa, no key can be


40

expected to work one hundred per cent of the time. However, the character(s) and key(s) with the highest levels of accuracy should be used to help identify brown snakes and to help resolve Pseudonaja taxonomy. Fourth, it was assumed better resolution and more accurate results would come from studies with full, systematic sampling designs rather than those that were geographically limited or opportunistic in their design.

Table 2.1. Sample identification key to differentiate between fish, mammals, reptiles, and birds. Sample species chosen (three individuals each per taxonomic group) are illustrated in Table 2.2. Explanations for accuracy levels throughout the key are explained in the Materials and Method section.

Total Key Accuracy: 19/25 = 76%

Sample Key

Character

Go to / Group

Individual Line Accuracy

1) Animal possesses wings

Bird

2/3 = 67%

Animal lacks wings

2)

8/9 = 89%

2) Animal possesses scales

3)

5/6 = 83%

Animal lacks scales

Mammal

1/2 = 50%

3) Animal is aquatic

Fish

2/2 = 100%

Animal is terrestrial

Reptile

1/3 = 33%

Individual Couplet Accuracy

10/12 = 83%

6/8 = 75%

3/5 = 60%


41

Table 2.2. Raw data for analysis as presented in Table 2.1. Each species is listed with a photograph, characteristics used to score within the sample key, how the species should key out, and how the species actually keyed out. Character abbreviations are: W = winged, nW = no wings, S = scaled, nS = no scales, A = aquatic, and T = terrestrial.

Eel – nW, nS, A

Piranha – nW, S, A

Bass – nW, S, A

Actual: Fish

Actual: Fish

Actual: Fish

Key: Mammal

Key: Fish

Key: Fish

Chameleon – nW, S, T

Sea Snake – nW, S, A

Sea Turtle – nW, S, A

Actual: Reptile

Actual: Reptile

Actual: Reptile

Key: Reptile

Key: Fish

Key: Fish

Kiwi – nW, nS, T

Magpie – W, nS, T

Penguin – W, nS, T

Actual: Bird

Actual: Bird

Actual: Bird

Key: Reptile

Key: Bird

Key: Bird

Bat – W, nS, T

Cheetah – nW, nS, T

Pangolin – nW, S, T

Actual: Mammal

Actual: Mammal

Actual: Mammal

Key: Bird

Key: Mammal

Key: Reptile


42

Results

A total of 916 non-type and 66 type brown snakes were selected for detailed measurement (type material listed in parentheses in order of: measured/not found): Pseudonaja affinis = 58 (20/–), P. guttata = 48 (3/–), P. inframacula = 15 (–/2), P. ingrami = 17 (1/–), P. modesta = 233 (7/–), P. nuchalis = 315 (13/–), and P. textilis = 231 (22/4). Of the 982 snakes presented here for analysis, 279 were identified as (sub)adult females, 485 as (sub)adult males, and 218 as gender-unknown (typically hatchling or young snakes less than 400 millimetres in total length). As mentioned above, snakes were excluded from the study only on the basis of overall physical damage, not for reasons of gender, size, or age. However, it has been documented that field surveys or museum collections may be gender-biased due to an increased frequency of encountering (and collecting) a particular gender in the field—usually males searching for females during breeding seasons (Shine 1994, Keogh et al. 2007). The skewed sex ratio presented here is thus due to specimen availability and the systematic randomness of the study design, and not due to a preferential selection of males at each museum. As separate gender- and body length-specific analyses produced virtually identical results to analyses where genders or sizes were pooled together, only the pooled results are presented here.

Five characters were notable in their ability to demarcate each of the currently recognised Pseudonaja taxa. The utility of these attributes in identifying each of the species are illustrated in Figures 2.2–2.5. Analyses of these five characters (and a sixth to facilitate easier separation between the affinis–nuchalis and inframacula–textilis ‗groups‘) led to the development of a new key to the seven currently recognised species of Pseudonaja. Presented below and in Table 2.3, this key does not include colours or patterns to differentiate between brown snake species, allowing the user to successfully identify live snakes in the field (where colour and pattern variation is high) as well as snakes preserved for long periods of time in ethanol (where colours and patterns may fade or disappear). Figures 2.6–2.11 describe and illustrate the characters used in the new key. Note that infralabial counts listed in the new key are given for both sides of the head and the key will perform equally well if differing infralabial scale counts are processed as right,left or left,right.


43

1a) 6 infralabial scales on both sides of head; or, 17 dorsal scale rows at mid-body if 6 infralabial scales on one side of head and not 6 on the other (Figures 2.6–2.7).....Go to 2 1b) ≥ 7 infralabial scales on both sides of head; or, ≥ 19 dorsal scale rows at mid-body if ≥ 7 infralabial scales on one side of head and < 7 on the other...............................Go to 3 2a) < 185 ventral scales (Figure 2.8).................................................Pseudonaja modesta 2b) ≥ 185 ventral scales...........................................................................................Go to 4 3a) 17 dorsal scale rows at mid-body (Figure 2.7).............................................P. ingrami 3b) ≥ 19 dorsal scale rows at mid-body..............................................................P. guttata 4a) Frontal-rostral distance/Parietal suture length ≥ 0.60 (Figure 9).......................Go to 5 4b) Frontal-rostral distance/Parietal suture length < 0.60......................................Go to 6 5a) Posterior frontal width < Supraocular-upper postocular width (Figure 10)...P. textilis 5b) Posterior frontal width > Supraocular-upper postocular width.............P. inframacula 6a) Lowest edge of postoculars ≤ Lower edge of eye orbit (Figure 11)...............P. affinis 6b) Lowest edge of postoculars > Lowest edge of eye orbit.............................P. nuchalis

Non-type Specimens

The overall accuracy of the preceding key is 96% (that is, any brown snake examined from throughout the range of Pseudonaja has a 96% chance of being correctly identified). Individual couplets within the new key are all accurate more than 90% of the time, as are most lines of the key (Table 2.3). For comparison, the overall accuracy of the two distribution-wide keys were 88% and 62% (Tables 2.4 and 2.5) and four regional keys were 76%, 95%, 81%, and 95% (Tables 2.6–2.9). There is typically at least one couplet and at least two couplet lines that are less accurate than 90% in each of the six comparative keys. The two most accurate regional keys (from Western Australia and Queensland; Tables 2.7 and 2.9) utilise the same characters and rely much less on colour or pattern than do the other comparative keys. Table 2.10 summarises results from the four regional keys and the results of the new key (using regional data). As with the distribution-wide keys, the regional keys are less accurate than the new key. Among the comparative keys, regional and more recently published keys were generally more accurate than distribution-wide and earlier published keys, respectively. No published keys were found for the brown snakes of the Australian Capital Territory, New South Wales, or South Australia (Pseudonaja have not been found in Tasmania). It is important to note that, when reading Tables 2.3–2.10, sample sizes may vary between


44

Figure 2.2. Bubble plot combining infralabial counts with counts of mid-body dorsal scale rows (MDSR) for the seven currently recognised species of Pseudonaja. The majority of both P. guttata and P. ingrami specimens have higher infralabial scale counts than do the other four Pseudonaja species. P. guttata can be distinguished from P. ingrami by the number of dorsal scale rows at mid-body (> 17 vs. 17, respectively). The number of individuals per category per species is listed above each bubble and is also equivalent to the bubble volume.


45

Number of Ventral Scales

235

185

135

P. affinis

P. guttata

P. inframacula

P. ingrami

P. modesta

P. nuchalis

P. textilis

Figure 2.3. Mirrored jitter plot (appropriate for graphs containing points with identical values) of ventral scale counts for the seven currently recognised species of Pseudonaja. With the exception of one snake, all species except P. modesta have more than 184 ventral scales.


46

PFW/So-UPoW Ratio

2

1

0

P. affinis

P. inframacula

P. nuchalis

P. textilis

Figure 2.4. Random-scatter jitter plot (appropriate for graphs containing points with similar, but not identical, values) of ratios of the posterior frontal scale width (PFWSo) compared to the width to the side of the head (UPoW) for the remaining four species of Pseudonaja. This ratio for P. inframacula is greater than 1.0 and less than 1.0 for the majority of P. textilis.


47

Figure 2.5. Bubble plot comparing the position of the lowest part of the postocular scales in relation to the position of the lowest eye orbits between P. affinis and P. nuchalis. The lower postocular scale of P. nuchalis normally ends before becoming level with the bottom of the eye orbit, while for P. affinis, the lowest postocular scale ending point is typically in line or lower than that of the lowest part of the eye orbit. The number of individuals per category and species is listed above each bubble and is equivalent to the bubble volume.


48

Table 2.3. Identification key to the seven currently recognised species of Pseudonaja, presented here for the first time. Accuracies listed here summarise non-type data and are explained in the Materials and Method section. Sample sizes possible (n) are listed after each species. For explanations of characters 1–6, please see Figures 2.6–2.11.


Gregory (2010), Distribution-wide Character

Go to // Species (n)


1) 6,6 infralabial scales (IL); 17 mid-body dorsal scale rows (MDSR) if 6,not 6 IL

2)

823/846 = 97%

≥ 7,≥ 7 IL; ≥ 19 MDSR if ≥ 7,< 7 IL

3)

57/65 = 88%

P. modesta (233)

228/228 = 100%

4)

578/579 = 99%

3) 17 MDSR

P. ingrami (17)

15/15 = 100%

≥ 19 MDSR

P. guttata (48)

41/41 = 100%

4) Frontal-rostral distance (FRD)/Parietal suture length (PSL) ≥ 0.6

5)

204/224 = 91%

FRD/PSL < 0.6

6)

314/346 = 91%

5) PFW/So-UPoW ≤ 1.0

P. textilis (230)

177/192 = 92%

Posterior frontal width (PFW)/Supraocular-upper postocular width (So-UPoW) > 1.0

P. inframacula (15)

8/9 = 89%

6) Lowest edge of postoculars ≤ Lowest edge of eye

P. affinis (58)

35/37 = 95%

Lowest edge of postoculars > Lowest edge of eye

P. nuchalis (315)

2) Ventral scales < 185 Ventral scales ≥ 185


880/911 = 97%

806/807 = 99%

56/56 = 100%

518/570 = 91%

185/201 = 92%

297/308 = 96% 262/271 = 97%


49

Figure 2.6. Infralabial scales (IL) were measured on both sides of the head and were denoted (if, for example, there were seven IL on both sides of the head) as 7,7. Some keys use ‗+‘ in notation, such as 7+7. IL counts began with the scale lateral to and contacting the mental scale and continued to the scale that encompassed the corner of the mouth (indicated by arrow) The corner of the mouth is best seen when mouth is open, or felt with a probe when the mouth is closed.

Figure 2.7. The number of dorsal scales at mid-body was determined by folding the snake in half, tail tip to snout end, and then counting the number of dorsal scales at the midpoint of the body. The count begins with a scale adjacent to the ventral scales, continues around the body dorsally in a diagonal or zigzag direction, and ends on the opposite side of the body at another scale adjacent to the ventral scales. In pilot studies, the number of dorsal scales at mid-body as described above was always equivalent to the number of scales found at the midpoint between the anal scale and snout tip (the method utilised by some authors). For the minority of snakes that were rigidly fixed in coils, the mid-body was determined by winding a string along a dorsal midline (approximately corresponding to the vertebral line of the snake) and then winding half the length of string along the snake‘s dorsal midline.


50

Figure 2.8. The ventral scale count started at the first ventral scale that touched both first (non-reduced) rows of dorsal scales (as per Dowling 1951) and finished with the anal scale. In this example, the ventral scales are numbered from 1 (the first ventral scale) to n (the final ventral scale). Infrequently, individual snakes possessed one or more ventral scales (usually just one) that did not cross from one side of the body to the other. These ‗mini-scales‘ are not included in the ventral scale count.


51

Figure 2.9. Couplet 4 is a comparison of the ratio of the distance between the frontal and rostral scales by the length of the parietal suture. Frontal-rostral distance (FRD) was taken from the anterior midpoint of the frontal scale (dark green) to the posterior midpoint of the rostral scale (brown). The parietal suture length (PSL) was measured along the common suture of both parietal scales (light green). Each distance was measured to the nearest 0.01 millimetre with a Mitutoyo digital caliper (model CDS6‖C). The left image is of a P. textilis and the right image is of a P. affinis.


52

Figure 2.10. Couplet 5 is a comparison of the ratio of the posterior width of the frontal scale by the width (at roughly the same plane) from the frontal scale to the edge of the head. The posterior frontal width (PFW) was measured across the frontal scale (dark green) between the junctions of the frontal, Supraocular (orange), and parietal scales (light green). The supraocular-upper postocular width (So-UPoW) can be taken from either side of the head, or from both sides and an average calculated. So-UPoW was measured from the junction of the frontal, supraocular, and parietal scales across the supraocular scale until it met the anterior edge (when looking directly from above) of the uppermost postocular scale (purple). Each distance was measured to the nearest 0.01 millimetre with a Mitutoyo digital calliper (model CD-S6‖C). The left image is of a P. inframacula and the right image is of a P. textilis.


53

P

E

P

E

Figure 2.11. Taken from a lateral view of the head, couplet 6 is a comparison (indicated by lightly dashed lines in the figure) of the lowest edge of the lower postocular scale (P) with the lowest edge of the eye orbit (E). This character can be measured on either side of the head. In uncommon cases where one side of the head possessed a third, or only one, postocular scale, the side of the head with the two postocular scales was used. The top image is that of a P. affinis and the bottom is of a P. nuchalis.


54

couplets or between tables. This is due to differing numbers of snakes available for analysis, as in the case of regional keys, or when minor damage to certain specimens precluded measurement of a particular character or characters (at which point the specimen could no longer progress through the analysis).

In addition to the six keys that are reviewed here, there are other guides and scientific publications which discuss Pseudonaja species (e.g., Worrell 1970, Gow 1976, McPhee 1979, Mirtschin and Davis 1983, O‘Shea 1996, Wells 2002, Skinner 2003, Wilson and Swan 2003, Skinner 2009). All typically differentiate the various species on the basis of colour and pattern as primary or secondary characters. Further, none present their synopses in key form and many of the descriptions found in each lack characters which differentiate one species from another. Given these reasons, a full-scale comparison of these references is not presented here.

Type Specimens

Overall accuracy for the three distribution-wide keys when assessing type specimens were generally consistent with the accuracy of corresponding keys to non-type specimens (Table 2.11). However, there were still species-level problems when using each key with type specimen data. Kinghorn‘s (1964) key failed to identify three species and identified only a small minority of the P. affinis and P. modesta type specimens. The key of Cogger (2000) was more successful, but recognised neither P. ingrami nor more than half of the possible P. nuchalis and P. textilis type material. Similarly, the new key could not accurately validate roughly one-half of the existing P. affinis types. This may be due to the high number of P. affinis type specimens belonging to P. a. exilis, an island subspecies which often possesses skewed measurements and abnormal scale counts. Two type specimens for P. inframacula and four specimens traditionally synonymised with P. textilis (Furina textilis, Pseudoelaps kubingii [Jan 1859], Pseudoelaps sordelli [Jan 1859], and Cacophis güntherii [Steindachner 1867]) were not found. Because their original descriptions did not incorporate all characters mentioned in the three distribution-wide keys, these species were not evaluated using any key. Table 2.12 lists the results of using the new key with every available type specimen.


55

Table 2.4. Identification key to the seven currently recognised species of Pseudonaja, as presented by Cogger (2000). Accuracies listed here summarise non-type data and are explained in the Materials and Method section.


Cogger (2000), Distribution-wide

Character



1) 17 or 19 mid-body dorsal scale rows (MDSR)

2)

844/868 = 97%

P. guttata (48)

34/48 = 71%

3)

611/612 = 99%

P. modesta (233)

209/232 = 90%

3) 17 MDSR; neck and head in adults uniform in colour or with scattered black scales tending to be concentrated along the vertebral region; young, if banded, usually with very regular, broad cross-bands

4)

222/249 = 89%

17 or 19 MDSR; if in 17 rows, adults regularly or irregularly banded, or with at least a few dark scales on the neck; young, if banded, usually with narrow, irregular cross-bands

6)

240/362 = 66%

4) Nasal not or only partially divided, usually broadly contacting the preocular; buccal cavity flesh-coloured

5)

181/203 = 89%

Usually 21 MDSR 2) Ventral scales > 175 Ventral scales < 175

Nasal completely divided, usually not or in point contact with the preocular; buccal cavity black


878/916 = 96%

820/844 = 97%

462/611 = 76%

186/214 = 87% P. ingrami (17)

5/13 = 38%


56

Table 2.4. Continued. Total Key Accuracy: 2637/3009 = 88%

Cogger (2000), Distribution-wide

Character 5) Adults uniform pale to dark brown above



P. textilis (230)

167/172 = 97%

Adults with numerous scattered black scales, usually concentrated along the vertebral region, but sometimes almost covering the dorsum

P. inframacula (15)

3/9 = 33%

6) Normally 17, sometimes 19, MDSR; rostral large and strap-like, higher than broad, and conspicuous when viewed from above

P. nuchalis (315)

82/190 = 43%

Normally 19 MDSR; rostral normal, about as broad as high, and scarcely visible from above

P. affinis (58)


170/181 = 94%

118/238 = 50% 36/48 = 75%


57

Table 2.5. Identification key to the seven currently recognised species of Pseudonaja, as presented by Kinghorn (1964). Accuracies listed here summarise non-type data and are explained in the Materials and Method section. Sample sizes possible (n) are listed after each species. Kinghorn still considered P. inframacula to be a subspecies of P. textilis in 1964 and thus does not include P. inframacula in his key.

Kinghorn (1964), Distribution-wide


Character




1) 17 to 21 mid-body dorsal scale rows (MDSR)

2)

879/882 = 99%

879/882 = 99%

2) Rostral deeper than broad

3)

190/751 = 25%

Rostral broader than deep

4)

107/122 = 88%

3) A dark patch on head, another on nape

P. nuchalis (315)

22/138 = 16%

Head with black and yellow bands, a yellow and black collar, and frontal broader than supraocular

P. modesta (233)

24/30 = 80%

No collar, frontal narrower than supraocular, and with or without dark on head

P. textilis (230)

8/22 = 36%

4) 21 MDSR, colour brown with dark blotches

P. guttata (48)

5/45 = 11%

17 to 21 MDSR, brown with a few scattered dark scales

P. affinis (58)

19/47 = 40%

17 MDSR, uniform brown ventral scales dark edged

P. ingrami (17)

12/15 = 80%

297/873 = 34%

54/190 = 28%

36/107 = 34%


58

Table 2.6. Identification key to the five currently recognised species of Pseudonaja found in the Northern Territory, as presented by Gillam (1979). Accuracies listed here summarise non-type data and are explained in the Materials and Method section. Sample sizes possible (n) are listed after each species.


Gillam (1979), Northern Territory

Character

1) Buccal cavity predominantly flesh pink



P. textilis (12)

10/11 = 91% 68/120 = 57%

Buccal cavity predominantly bluish-black

2)

58/109 = 53%

2) 19 mid-body dorsal scale rows (MDSR); Iris colour reddish yellow (7.5 yr 6/6), inner boundary narrowly edged contrasting white

P. guttata (9)

9/9 = 100%

17 MDSR; Iris colour not reddish yellow (7.5 yr 6/6)

3)

47/48 = 98%

3) Infralabials 7+7; superficially eye appears to be completely black, under close examination iris inconspicuous dull orange brown

P. ingrami (10)

1/1 = 100%

4)

39/45 = 87%

4) Ventral and subcaudal scales < 177 and 45, respectively

P. modesta (29)

4/7 = 57%

Ventral and subcaudal scales > 191 and 49, respectively

P. nuchalis (64)

Infralabials 6+6; iris prominent


56/57 = 98%

40/46 = 87%

35/39 = 90% 31/32 = 97%


59

Table 2.7. Identification key to the three currently recognised species of Pseudonaja found in Western Australia, as presented by Storr et al. (1986). Accuracies listed here summarise non-type data and are explained in the Materials and Method section. Sample sizes possible (n) are listed after each species.


Storr et al. (1986), Western Australia

Character



1) 17 mid-body dorsal scale rows (MDSR)

2)

243/244 = 99%

P. affinis (46)

42/46 = 91%

3)

113/114 = 99%

P. modesta (129)

129/129 = 100%

4)

96/105 = 91%

Buccal cavity fleshcoloured

P. textilis (–)

0/0 = 0%1

4) 6+6 Infralabials

P. nuchalis (116)

71/93 = 76%

19 MDSR 2) Ventral scales > 190 Ventral scales < 190

3) Buccal cavity blackish


285/290 = 98%

242/243 = 99%

96/105 = 91%

71/93 = 76%

1

7+7 Infralabials P. ingrami (–) 0/0 = 0% 1 Listed as 0% instead of N/A to denote that Storr et al. (1986) recognised P. ingrami and P. textilis as occurring in Western Australia, though no specimens were found to confirm this (see Discussion)


60

Table 2.8. Identification key to the two currently recognised species of Pseudonaja found in Victoria, as presented by Coventry and Robertson (1991). Accuracies listed here summarise non-type data and are explained in the Materials and Method section. Sample sizes possible (n) are listed after each species.

Coventry and Robertson (1991), Victoria Go to // Species (n)


1) Rostral scale enlarged

P. nuchalis (4)

2/4 = 50%

Rostral scale normal

P. textilis (23)

20/23 = 87%

Character

Total Key Accuracy: 22/27 = 81% Individual Couplet Accuracy

22/27 = 81%


61

Table 2.9. Identification key to the five currently recognised species of Pseudonaja in Queensland, as presented by Wilson (2005). Accuracies listed here summarise non-type data and are explained in the Materials and Method section. Sample sizes possible (n) are listed after each species.


Wilson (2005), Queensland Go to // Species (n)


P. guttata (37)

37/37 = 100%

2)

168/170 = 99%

P. modesta (31)

31/31 = 100%

3)

136/137 = 99%

3) Buccal cavity fleshcoloured

P. textilis (93)

74/82 = 90%

Buccal cavity blackish

4)

37/50 = 74%

P. ingrami (6)

3/5 = 60%

Character

1) 21 (rarely 19) mid-body dorsal scale rows (MDSR) 17 MDSR

2) Ventral scales < 185 Ventral scales > 185

4) Infralabials 7+7; iris very dark and difficult to determine Infralabials 6+6; iris a clearly visible (sometimes broken) circle


205/207 = 99%

167/168 = 99%

111/132 = 84%

33/36 = 92% P. nuchalis (51)

30/31 = 97%


62

Table 2.10. Comparison of accuracies for four regional keys with accuracy of the new key (using regional data). Accuracies listed here (explained in the Materials and Method section) summarise non-type data and are reported from the terminal couplet line and for the overall key. Sample sizes possible (n) are listed above the results of each regional key. P. inframacula was not found in any of the four regions examined.

Species // Author/ Location

P. P. P. P. affinis guttata inframacula ingrami

P. modesta

P. P. nuchalis textilis

Overall

n

–

9

–

10

29

64

12

Gillam 1979/NT

N/A

9/9 = 100%

N/A

1/1 = 100%

4/7 = 57%

31/32 = 97%

10/11 = 91%

199/262 = 76%

Gregory 2010/NT

N/A

8/8 = 100%

N/A

8/8 = 100%

25/25 = 100%

54/56 = 96%

10/11 = 91%

352/366 = 96%

n

46

–

–

–

129

116

–

Storr et al. 1986/WA

42/46 = 91%

N/A

N/A

0/0 = 0%1

129/129 = 100%

71/93 = 76%

0/0 = 0%1

694/731 = 95%

Gregory 2010/WA

27/28 = 96%

N/A

N/A

N/A

128/128 = 100%

101/103 = 98%

N/A

830/859 = 97%

n

–

–

–

–

–

4

23

Coventry and Robertson 1991/VIC

N/A

N/A

N/A

N/A

N/A

2/4 = 50%

20/23 = 87%

22/27 = 81%

Gregory 2010/VIC

N/A

N/A

N/A

N/A

N/A

4/4 = 100%

19/21 = 90%

102/106 = 96%

n

–

37

–

6

31

51

93

Wilson 2005/QLD

N/A

37/37 = 100%

N/A

3/5 = 60%

31/31 = 100%

30/31 = 97%

74/82 = 90%

514/540 = 95%

Gregory 2010/QLD

N/A

33/33 = 100%

N/A

6/6 = 100%

30/30 = 100%

39/40 = 98%

70/76 = 92%

633/654 = 97%

1

Listed as 0% instead of N/A to denote that Storr et al. (1986) recognised P. ingrami

and P. textilis as occurring in Western Australia, though no specimens were found to confirm this (see Discussion)


63

Table 2.11. Comparison of results from three distribution-wide keys using data from all available type specimens. Accuracies listed here (explained in the Materials and Method section) are reported from the terminal couplet line and for the overall key. Sample sizes possible (n) precede the summary of results. Reasons for differences in sample sizes are provided in the Results section. The type specimens for P. inframacula were not found and thus not included in this analysis.

Species // Author

P. affinis

P. guttata

n Kinghorn 1964

20 3/15 = 20%

3 2/3 = 67%

Cogger 2000

15/17 = 88%

2/3 = 67%

P. P. inframacula ingrami – N/A

N/A

1

P. modesta

P. nuchalis

P. textilis

1 0/1 = 0%

7 1/1 = 100%

14

21 0/2 = 0%

0/1 = 0%

6/7 = 86%

0/7 = 0% 3/9 = 33%

11/11 = 100%

Overall

99/142 = 70% 186/206 = 91%

Gregory 8/9 = 3/3 = 1/1 = 7/7 = 13/13 = 16/17 184/203 N/A 2010 89% 100% 100% 100% 100% = 94% = 91% 1 Includes NTM 33952, a P. nuchalis which Hoser (2009) has incorrectly labelled as Pseudonaja textilis cliveevattii


64

Table 2.12. List of type specimen designations after being identified using the new key. The table lists the original species name at first publication, the author and museum registration number for the specimen, the commonly accepted species name, and the species name as determined by the new key. As per the rules of the Code (International Commission on Zoological Nomenclature 1999), the species names listed below do not constitute an official taxonomic revision and are used for illustrative purposes only. Type specimens which could not be found (Cogger et al. 1983, personal search) are denoted as ―presumed lost‖.

Original Species

Author, Museum

‗True‘ Species

Name

Registration

Name

Pseudonaja affinis

Demansia nuchalis tanneri Demansia nuchalis tanneri Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis

Günther 1872, Holotype: BMNH 1946.1.19.77 Worrell 1961a, Holotype: NMV D47286 Worrell 1961a, Paratype: AM R125973 Storr 1989, Holotype: WAM 19870 Storr 1989, Paratype: WAM 3294 Storr 1989, Paratype: WAM 12794 Storr 1989, Paratype: WAM 12795 Storr 1989, Paratype: WAM 12796 Storr 1989, Paratype: WAM 12797 Storr 1989, Paratype: WAM 14922 Storr 1989, Paratype: WAM 15028

Pseudonaja affinis

Key Species Name Pseudonaja nuchalis

Pseudonaja affinis

Pseudonaja inframacula

Pseudonaja affinis

Damaged, cannot complete key (termination at couplet 5)

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja affinis

Pseudonaja affinis

Pseudonaja affinis

Pseudonaja affinis

Pseudonaja nuchalis

Pseudonaja affinis

Pseudonaja affinis

Pseudonaja affinis

Pseudonaja nuchalis

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja nuchalis


65

Table 2.12. Continued.

Original Species

Author, Museum

‗True‘ Species

Name

Registration

Name

Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis exilis Pseudonaja affinis charlespiersoni Demansia guttata Demansia guttata Pseudonaja guttata whybrowi Demansia textilis inframacula

Demansia textilis inframacula

Diemenia ingrami

Storr 1989, Paratype: WAM 15029 Storr 1989, Paratype: WAM 19867 Storr 1989, Paratype: WAM 23998 Storr 1989, Paratype: WAM 28896 Storr 1989, Paratype: WAM 48633 Storr 1989, Paratype: WAM 56888 Storr 1989, Paratype: WAM 83928 Storr 1989, Paratype: WAM 87904 Hoser 2009, Holotype: Australian National Wildlife Collection R1968 Parker 1926, Holotype: BMNH 1946.1.20.67 Parker 1926, Paratype: BMNH 1946.1.20.68 Hoser 2009, Holotype: NTM R4646 Waite 1925, Holotype: SAM, unknown registration, presumed lost Waite 1925, Syntype: SAM, unknown registration, presumed lost Boulenger 1908, Holotype: BMNH 1946.1.20.32

Key Species Name

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Pseudonaja guttata

Pseudonaja affinis

Head and tail only, cannot complete the key (termination at couplet 2)

Pseudonaja guttata

Pseudonaja guttata

Pseudonaja guttata

Pseudonaja guttata

Pseudonaja guttata

Pseudonaja guttata

N/A

N/A

N/A

N/A

Pseudonaja ingrami

Pseudonaja ingrami


66


Original Species

Author, Museum

‗True‘ Species

Name

Registration

Name

Cacophis modesta

Cacophis modesta

Cacophis modesta Brachysoma sutherlandi Furina Ramsayi Furina Ramsayi Furina Ramsayi Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis Diemenia aspidorhyncha Pseudelaps bancrofti Diemenia carinata Demansia acutirostris Pseudonaja imperitor

Günther 1872, Lectotype: BMNH 1946.1.17.46 Günther 1872, Syntype: BMNH 1946.1.18.42 Günther 1872, Syntype: BMNH 1946.1.18.44 De Vis 1884, Holotype: QM J190 Macleay 1885, Lectotype: AM R131724 Macleay 1885, Syntype: AM R131725 Macleay 1885, Syntype: AM R131726 Günther 1858, Lectotype: BMNH 1946.1.20.41 Günther 1858, Syntype: BMNH 1946.1.20.33 Günther 1858, Syntype: BMNH 1946.1.20.57 McCoy 1879a, Holotype: NMV D12352 De Vis 1911, Holotype: QM J187 Longman 1915, Holotype: QM J1508 Mitchell 1951, Holotype: SAM R3133 Wells and Wellington 1985, Holotype: NTM R3352

Key Species Name

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja modesta

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Head only, cannot complete the key (termination at couplet 2)


67


Original Species

Author, Museum

‗True‘ Species

Name

Registration

Name

Pseudonaja jukesi

Pseudonaja kellyi Pseudonaja mengdeni Pseudonaja vanderstraateni

Pseudonaja gowi

Furina textilis Pseudoëlaps superciliosus Demansia annulata

Pseudoelaps Sordellii

Pseudoelaps Kubingii Pseudoelaps superciliosus Beckeri Cacophis Güntherii

Wells and Wellington 1985, Holotype: NTM R1186 Wells and Wellington 1985, Holotype: NTM R1689 Wells and Wellington 1985, Holotype: NTM R1989 Wells and Wellington 1985, Holotype: NTM R371 Wells 2002, Holotype: SAM R40497 (―...largest specimen of this species from the vicinity of Lyndhurst, SA in the SAM.‖) Duméril et al. 1854, Holotype : MNHP 3944, presumed lost Fischer 1856, Holotype: ZMH R04434 Günther 1858, Holotype: BMNH 1946.1.17.54 Jan 1859, Holotype: MSNM, unknown registration, presumed lost Jan 1859, Holotype: Pesth, unknown registration, presumed lost Jan 1863, Holotype: ZMH R01261 Steindachner 1867, Holotype: unknown museum / registration, presumed lost

Key Species Name

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

Pseudonaja nuchalis

N/A

N/A

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

N/A

N/A

N/A

N/A

Pseudonaja textilis

Pseudonaja nuchalis

N/A

N/A


68


Original Species

Author, Museum

‗True‘ Species

Name

Registration

Name

Furina bicucullata

McCoy 1879b, Lectotype: NMV D1832

Pseudonaja textilis

Pseudonaja textilis

Furina bicucullata

McCoy 1879b, Paralectotype: NMV D4610

Pseudonaja textilis

Missing part of head, cannot complete the key (termination at couplet 4)

Pseudonaja textilis

Pseudonaja nuchalis

Pseudonaja textilis

Pseudonaja nuchalis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja inframacula

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja nuchalis

Pseudonaja textilis

Pseudonaja textilis

Furina bicucullata

Furina bicucullata

Furina bicucullata

Furina bicucullata Pseudechis cupreus (part.) Pseudonaja ohnoi Pseudonaja textilis Pughi Pseudonaja textilis Pughi Pseudonaja elliotti

Pseudonaja elliotti Pseudonaja textilis cliveevattii Pseudonaja textilis leswilliamsi

McCoy 1879b, Paralectotype: NMV D8939 McCoy 1879b, Paralectotype: NMV D8940 McCoy 1879b, Paralectotype: NMV D8941 McCoy 1879b, Paralectotype: NMV D8942 Boulenger 1896, Syntype: NMV D12711 Wells and Wellington 1985, Holotype: NTM R1970 Hoser 2003a, Holotype: AMNH R73959 Hoser 2003a, Paratype: AMNH R73949 Hoser 2003b, Holotype: AM R132991 Hoser 2003b, Paratype: NMV D71085 Hoser 2009, Holotype: NTM R33952 Hoser 2009, Holotype: NTM R5205

Key Species Name


69


Original Species

Author, Museum

‗True‘ Species

Name

Registration

Name

Pseudonaja textilis leswilliamsi Pseudonaja textilis rollinsoni Pseudonaja textilis rollinsoni Pseudonaja textilis jackyhoserae Pseudonaja textilis jackyhoserae

Hoser 2009, Paratype: NTM R5203 Hoser 2009, Holotype: NMV D73622 Hoser 2009, Paratype: FMNH 73532 Hoser 2009, Holotype: AM R147652 Hoser 2009, Paratype: AM R147659

Key Species Name

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Pseudonaja textilis

Discussion

Some taxonomic studies have largely escaped the level of scrutiny nominally applied to other scientific endeavours. When reviewing past taxonomic literature on Pseudonaja, publications were found in which hypotheses were not tested, methodologies which were not described in full, listings of specimens examined which were not provided, and where vague and confusing phrasing effectively concealed the fact that no specimens had actually been examined. Unfortunately, this is not a situation unique to Pseudonaja taxonomists. Taxonomy is governed voluntarily through a code of ethics (the Code; International Commission on Zoological Nomenclature 1999) which specifies, among other things, rules for the formation and treatment of names of new or revised taxa, rules for criteria of publication, and rules on how to cite authorship. But nowhere in the Code are minimally accepted standards of research addressed. This does not make taxonomy unique, but the ability of taxonomists to publish work seemingly conducted with low standards and without peer review is one of the reasons taxonomy stands apart from other forms of science.


70

The results of any large-scale study—whether it be ecological, taxonomic, or censusbased—will be influenced most critically by the sample size included in analyses and the geographic coverage of those samples. The determination of an adequate, minimum sample size has both a mathematical basis and a personal component. If the idea of a study is to quantify patterns seen in natural populations or systems, then increasing the number of samples will increase the likelihood of quantifying the full range of any observable pattern (Scheiner and Gurevitch 1993). This is illustrated simply within any statistics textbook which provides tables of confidence intervals (a numerical range within which we have confidence that a population parameter will be found, based on the values obtained from measurements taken from subsamples of the population). A researcher should hope to minimise the range of any confidence interval. For example, an average calculated from measuring five specimens will have an interval range of ± 44% (at the 95% level of confidence; Florey 1993). Similarly:

Sample Size

Confidence Interval

20

± 22%

80

± 11%

225

± 6.5%

1000

± 3.1%

Mathematical formulae can provide the expected limits to any confidence interval as well as provide the number of samples needed to reduce those limits (Fairweather 1991), but it is the researcher who ultimately chooses the number of samples to include (and by extension, how believable the results are to the reader). There are also other, less-traditional ways (based on the familiarity of an author with their data) to determine if a study has an adequate sample size. Wallach (1985) advocates including a minimum of eight to twelve samples for every character measured while Magnusson and Mourão (2000) advocate a minimum of ten samples for every continuous character measured and at least four to ten samples for every level of categorical character measured. Regardless of which of the above guidelines are followed, it is clear that the sample sizes included in past Pseudonaja work have been low (see Chapter 5: Figure 5.2 and Table 5.1).


71

Would the results of past studies have benefited with increased numbers of specimens? Only if the additional specimens had been chosen in a geographically random or systematic fashion. Disregarding original species descriptions which arose out of necessity from opportunistic sampling, larger-scale reviews of the genus have employed non-random and non-systematic sampling. Despite a continental distribution (see Chapter 1: Figure 1.1), most samples included in past surveys were collected originally in and around state and territory capital cities, or were chosen due to the availability of non-formalin-fixed tissue from which to extract DNA (Figures 2.12a–f). Increasing the number of samples collected from these locations would only improve results if all variants (and all taxa) were present at these locations. Alternatively, the use of systematic, random sampling allows work to be conducted which is unbiased and geographically comprehensive. Recent studies confirm that the most accurate and robust survey design is one that includes a higher sample size, samples systematically, and includes environmental information into the research design (Hirzel and Guisan 2002, MacKenzie and Royle 2005). Furthermore, the accuracy of phylogenetic results is improved with the addition of more taxa (Graybeal 1998, Rydin and Källersjö 2002, Zwickl and Hillis 2002). As with increasing the numbers of samples, systematic, geographic sampling ensures that specimens chosen for analysis are more likely to be representative of the overall population from which they came and more likely to include all existing taxa.

Does that mean that minimal research standards should be regulated by the Code? Again, not necessarily. Many people would find repellent the idea of legislating work ethic and standards. Yet many people would also become dismayed when others take advantage of one of the quirks of the Code: the idea of principle of priority (International Commission on Zoological Nomenclature 1999). A species name published by someone—even if no work has been done, no samples seen, and an incorrect description given—has priority over subsequent authors who actually conduct valid research. In the context of Pseudonaja literature, Richard Wells and Raymond Hoser have erected or elevated (sub)species names in self-published journals without justification, allowing one to question the validity of their ‗work‘. It is highly unlikely that the ideas and content presented by Hoser and Wells would have been accepted by an independent, peer-reviewed journal. Regardless, in taxonomy the ‗honour and glory‘


72

of naming taxa can belong to speculators, not researchers who systematically work to describe taxa.

It seems then that a decision is necessary: either the taxonomic community can choose to update and change its legislation (the Code) to either provide an updatable list of acceptable peer-reviewed journals in which new or revised names can be published or the Code should include additional rules as to what is methodologically acceptable for any nomenclatural work. The first option would seem to be the easiest and most acceptable recommendation, but given the slow nature of the International Commission on Zoological Nomenclature (the Commission), legislative changes are not likely to take place quickly. To help clear up unresolved taxonomic issues and provide little room for taxonomic speculators to publish, perhaps it would be easier if researchers could self-regulate and make sure that the work they undertake is of a high enough standard to convincingly resolve any taxonomic hypotheses being tested. For example, despite the presumed composite and difficult taxonomic nature of Pseudonaja, using a rigorous and thorough systematic research protocol has allowed the development of a strong identification key that can be applied with 96% accuracy throughout its range. As has been shown, taxonomic keys can be easily tested for accuracy, contrasted with each other, and presented in a way which is similar to statistical testing found in most scientific papers. For example, when identifying a snake with any key, mistakenly precluding an individual from advancing through the correct couplets would be equivalent to committing a type-I error: rejecting that a snake is species A when it is, in fact, species A. The new identification key to Pseudonaja can be thought to work below an alpha level of 0.05 and individual couplets below alpha levels from 0.05 to 0.1.

But how does one know if the groups being tested are valid evolutionary taxa? This is a question common to all taxonomic endeavours. In this chapter, it was assumed that there were only seven species from which to choose; these seven were the most stable species names from the past century. Unfortunately, stable species names or morphometric groups may not actually match evolutionary groups. As presented here, accuracy and ‗correctness‘ were based on communal ideas of how many and what types of groups were in existence. Thus, accuracy for the presupposed groups may be high, but these groups may not reflect the evolutionary groups found in nature. There are also issues concerning the independence of the pre-existing identification keys. Six editions


73

# *

# * # *

# *

# *

# *

# * # * # * * ## # * *

# *# # *

# * # * # * # * ### # ##

* ## # # * # # # # ### # # ## ## #

# # # ### # ### #

# # # # #### ## # # # # ## # ## ## # #### # # ##### # # # ### ###### # # ## ## ## # # # # # # # # # # # # ### # # # # ### # ## ## # # ## # ## # # # # # # ## # # # # # # # ### # # ### # # ### # # ### # ### ## # ## # # # # # # # # # ## # # # ### # # # # # ## # # ## ## # # # # ## ## # # # # ## #### ## ### # # # # ## # # ### ## # # ## # *# ## # # ## ## # # # # # ## ## # ### # # ## # # # ## ## # # # # ## # ## ## # # ## # # # # # # # ## ## ## # # # ## # # # # # # ## # # ### # # # ## # ## # ## ## # ### # # # ### # # ## ## # ###### # # # ##### # # ## # # ## # # # ## # ## ## # # ## # # # ######## ## ### # # ### ##### # ##### # # # # # # # ### # ##### # ## ## # # ## # ## # ## #### # ## # ## ## # # # # # # # # # # # # # # # # # ## # ## # ##### # # # ## ## # ## # # # #### # # # ## ## # # ## ####### ## ## # # # # #### # ### ## # #### # # ### # ## ## # ### ## # # # # # # # ### # ### # # ## ### # # ## ##### # # # ## ###### #### # # ### # ## ###### ## # ## #### # # ## ## # ## ## ## # # ## # # ###### # # ### # ## # ## ## # # # # ## # # # # # # ## ## # ## ## ########### # ## ## # # # # ## ## # ### ## ## ## ## # # # # # # ## # # # ## ### # ## # # # # ## # # ## #### # # # # # ## # #### # ## # ### # # ## # ## ## ## # # # # # # ## ## # # # # # ####### ######### ### ### ## ## ## # ####### ## # # # # ## ### # ## #### #### ### # # ## ## # # # ## ## # # ##### # # # # ## ## ## # # ##### ### # ## ####### ### # # ### # ## # ## ### ## # # ####### ##### ##### #### # ## # # # # # # # # # ### # # # # # # # # #### # ## ## # # ### # # #### # # # # # # # # # ##

# *

# *

# *

# *# * # *

# * # * # *# # # * * * # # * *

# *

# *

# *

# *

# *!

#

# *

# *

!

# *

# # #

# # * # # * # * # # * # # # ## # * # # * # # # ## ### # # # # # # * ## # # # ## # *## * # * *### ## # *# *# ## ## # # # * # # * # # # *# *# # # * # # # ## # # * # # # *# * # # # ## # # # * # # # * * # # * * # # * # # # # # # *# * # # # # ## * * ## # # * # * # *# * # * # *# ## # * # * # # * * * ## # # * # # *# *## # * # * #*# ## # # ### ## * ## # *# *## # # # #* * # * * # *# * # # # # # # # ####### # # * # # # # # ## *# ## # # # * * # # * *# # # # * # # # *# # # # * # * # # # ## # # ### # ## # # *# # # *# * # # # # ## ### # ## ** # ## # # * # # # ### # ### ## # ## ### # ## # * # # # ## # # # # * ## ## # # # # # # # # ### ## # # # # # # # ## ## # ## * *# # *# ## # * ## * # # # # # # # # ## # # # # ## # *# # # # # * # ## # # # # # ### # # ##### ## # # # * ## # ## # # ## # ## # # ## *# ## # # * * # # # # # * ## # # # # # # ### # # # # # # # # * # # ## # ## ## # * *# * # ## ## # # ### # # # * # ## # ## # # # # #* # ##### # # # ## ## # # #### # #### # # ## * ## *# # # # * # # # # # # *# # # # # ## # # * ### *# # *# ## * # #### # # # ## # # ## # # # # #### ## ### # # #* ### # # ## ### ## # # # ## ## # # ## # # # # # ## # ### # # * ## # # ## # # # ### # # # # # # ## # # # # ### #* # # ## # # # * # ## ## * ## ## * # # # ### #### # *# ### *# # # ## # # # ## # *# * # # # *## ## * # # # # ## # # * # * * # # ## # * # # * * *## ## # *# * # # # *### * ## # ## # # # ## # ## ### ## # ## # * # # # #### * # # # # ## * # # # # ## * # ## ### # # # # ### * # ## # * ## # # ## # # # # #### # ### * # # # # ### # # * # *# # * # * # # ### # # * # # # # # # # # # # # # ### ## * # *## # # # *# # ## # # # ### # * ## # # ## # ## # * # ### ### *# # # * # # ## # # # # # # # ##### * * # # # # # ## # # ## # # ## ### # * # # ## ## ## *# # # # ### ### ## # # * # # # ## # ## # # * * # * ## ## * # ## ### # # *# # # # # ## ## ## # # # ## # ### ## ## # * ## #### ## # ## # # # ## ## # * ## # # ## # # ## # ## ## # ##### # ## * # ## # # # ## ## # * # # # # # ## # * * # # # # ## # *# # ## # ## # # # # ## # ## # ## # # # # ### # # # # # ## ### # # # ## #### # ## # ### # ## # # ## # ## # # ### # # # # # * # ## # # * # # ## # # ## ### # ## # # ### # ### # ## ### #### ## ## # # ### ## # # ## ## # # # #### # # # # ## ## # ## # # # # # ## # # # # # # # # # # # # # # # # # # # # ## # # ## ## # ## # # # ## ## # # # ## ## ### # # # ## ### ## ## # # ## # # # ## ### ### # # # ## # #### # # # ## # # #### # # ## # # # #### ## ## ## ### ## ### # ## # # ### # # # # ## ## # # # # # # # # #### # ## # # # # # ## ### # ## ## ### #### ## ## # ### ## #### ## ### ## ## ## # # ## # # # ### ## ### # # ## # ###### ## # ### # ## # # ### # # ## # ### # ## # ## # ## # # # # ## ## # ## # # # # # ## # ## # # ## ### # # ## ### # ## # ## ###### ##### # ## # # # ## # ##### ### # ## ## #### # # ## # # # ## ## # ## # ## # # #### # ##### # # # ## #### ######## # # # ## # # ### ## # ## # ## # # ## # # # # # # # ### # ### # ## # # ## ### # ### ### ### #### # ## ## ## # # # # # ## # # ### # # ## # # *# ## # # ## # ## ### ## *## # ### # # # # #### # # # ## ### ## # # # ## ## # ## ### ## ## ## ### # ## # ## # # ### ## # ### ## ### ##### # ## # # # #### # # # ###### # # # ####### # ### # ## ## # # ## # # # # # ## # # # ### # ### #### ## # ## ## # # # # # # # ## # # ## ## # # # ## ## ### # # # # # # ## ### ## ## ## # # # #### ## # ### ## ## ## # # # ## ## ####### # # # # ## # # # # #### ## ## ## #### ### ## ## # # # ## # # ## ## # ### # # # # # # ### ## ## ## # ## # # ## # # # # # ## # # # ## ## # # # # # # #### # # ## # ## # ### ### # # ### ### # ## # #### # ## ## # # # ## # ## ## #### # # # # # ## ## # ## # ## # ## # ## #### # ## # # ## # ## # ## # ## ###### ### # # # # # ## # # # ## # # ## # ## # # ## # # # # # # # # # ### # ### ### # # ## # #

# * * # !

# * ! # * # * # *

!

! ! !! # *

!!

!! !

# *

! # *

!

# * !! ! !! # *! *! !#

# * # *

!! !!

! # * ! ! * # * !#

!

!

!

# *

# * ! # *# ! * # * ! ! # * # * # * ! * !# # * ! ! ! !! !!# ! * # * *# ! ! ! ! ! !! ! ! # * ! ! ! ! ! !! ! ! !! !! !* ! # * # * ! ! # ! ! *# ! ! ! ! ! ! ! ! !! ! ! ! !! ! !! ! ! ! ! !! ! ! !! ! ! ! !!! ! !! ! # * !!!! !!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! # ! ! ** ! ! ! ! ! !# ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! ! ! ! ! ! ! !! ! !! ! ! !# * ! ! ! # * ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! * * ! ! !! ! ! ! # !# ! !! !!! ! ! ! * # !! ! ! ! !! ! ! ! ! # ** ! *# ! ! !! ! ! ! ! ! !!! # #! ! * !# ! ! !! * ! ! ! ! ! ! !! ! !# ! ! !! ! ! !! ! * ! ! ! ! !! ! # # * !! * ! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! # *# *!# ! ! ! # * !! ! *! ! ! ! ! ! # ! ! * !# * !! ! ! *# ! ! !! ! * !# ! !! ! # * # ! ! ! * ! ! ! ! # * * !# # ! ! *# ! ! ! ! ! * ! ! ! ! ! !! ! * ! ! ! # ! !! # ! * !! ! !! !! ! ! ! # ! ! * ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! !! # # * *!! !! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! # * ! !! ! ! ! !! ! ! ! ! ! ! ! ! # ! * ! ! ! !! ! !# # ! *! ! ! ! *! ! ! !! ! ! ! ! ! ! ! ! ! *! ! # !! ! ! !! ! *# ! ! ! ! ! ! #! ! ! ! ! ! ! ! ! ! *# ! * ! ! ! ! ! ! !! ! ! ! ! ! ! !! ! !! ! ! !! ! ! ! !! ! ! # *# ! ! ! !! !! ! ! ! !! ! ! ! *! !! ! ! ! !! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! !! !! ! ! ! !! !! ! ! ! ! ! ! ! ! ! ! ! # ! * ! ! !! ! ! ! !! ! ! ! ! ! ! !! ! ! ! !!! ! ! !! ! !! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! ! ! ! ! ! ! ! ! ! !! ! ! ! !!! !! !! ! !! ! ! ! !! ! ! ! ! ! ! !! ! ! !! ! ! !! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! ! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! !! ! ! !!! !! ! ! ! !! ! ! ! ! ! !! ! ! !!!!! !! ! ! !! ! ! ! ! ! ! ! !! ! ! ! !! ! !! ! !!! ! ! ! ! ! !! !! ! ! ! !!! !!! ! ! ! ! !!!!! ! ! ! ! ! ! ! ! ! ! ! ! !! ! !!! !! ! !! ! ! !! ! ! !!! ! ! ! ! ! !! ! !! !! ! ! ! ! !# ! !! ! !! ! ! ! !! ! * !! !! ! ! !# ! !* ! !! ! ! ! ! ! ! !! !! ! ! !!! !! ! !!! ! ! ! ! !! ! !! ! !! ! ! !! ! ! ! ! !! ! ! ! ! !! !! !!!! ! ! ! !! !!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! ! !! ! ! ! ! ! ! !! ! ! !! ! ! ! !

!

* !#

!!! !!

! !

! !

! ! ! !

!

!

!!

!

!

!! ! !

!!

! ! !

!

a) Total Snakes Available

!

! ! ! !! ! ! !

! ! ! !

!

!

b) This Thesis

! ! ! ! !

!

!

! !!

!!

! ! !

!

!! !

! !

!! ! ! ! ! ! ! ! !

! ! ! !

! !! ! !

!

!!! ! !

! ! !

!! !!

! !

! !

!

! !!

! !! ! !! ! ! ! ! !!! !! !! ! !! ! !! ! ! !! ! ! ! !

!

!

!

!

!

!

!

!

! !

# *

!

!

!

!

!

! !!

! !

!

!

! !

!

! # *

!

! !

!

!

!

!

! !

! ! ! !

c) Gillam 1979

!!

!!

d) Mengden 1982–1985 ! # *

# *

# *

! !

!

!!! !

! # *

!

! !

!

! ! !

!!

! ! # * !

!

!

!

!

# *

! !!

! # *

! !

!

! ! !! !

!

!! !

! !

!

! !! !! ! ! ! ! ! !! ! !

!

!

!

!

!

!!! !

!! !!! !

! !! ! !

!

# *

!

# * !

!

! * ! !#

!

!

!

! ! !! !

!

# *

!

!

!

!

!

!

!

!

! !

! !!

!

!

! ! !! ! ! ! !!

! !

! ! ! !

! !

! ! !!

! !!!!!! ! ! ! ! ! !! ! ! ! !! ! ! ! ! ! ! !! !! !!! !!! ! !! ! ! !! ! ! ! ! ! !!!!! ! ! ! ! !

!

!! !

! !

!

!

!

!

!

!

! ! !

e) Wells (and Wellington) 1983–2002

f) Skinner (et al.) 2003–2009

Figures 2.12a–f. Comparison of potential effort (snakes possible to analyse) and actual effort (snakes analysed) made by authors of modern-day taxonomic reviews of Oxyuranus and Pseudonaja. Coloured symbols represent snake species as in Chapter 1: Figure 1.1. Due to the use of a personal numbering system with no corresponding museum information (Mengden) or the omission of a list of specimens examined (Wells and Wellington), the number of specimens depicted in Figures 2.12d and 2.12e are most certainly underestimated.


74

of ‗Reptiles and Amphibians of Australia‘ have been published between 1975 and 2000 (Cogger). In herpetological circles, this book is affectionately known as ―the Bible‖. Although some of the keys pre-date Cogger (2000), it may be fair to assume that authors of the other keys may have been influenced by the work of Cogger. Not only are the groups chosen here for analysis potentially not valid (issues discussed in more detail in Chapters 4 and 5), but a series of comparisons have been made against potential variations of the same key. That said, no two keys are the same, from which it can be inferred that regional and personal experience would have helped shape the construction of each key, allowing improvement of keys over time and space. This was seen in the results presented here.

The precision of Pseudonaja identification keys has improved over time but they are still generally more accurate at regional levels. These two facts indicate that there has been a synthesis of accumulated knowledge about the morphological variability inherent to Pseudonaja in the development of each subsequent key, but also that we have neither measured the full range of this variation nor identified characters which most accurately reflect this variation. No key has been shown to work perfectly, especially when evaluating type specimens. The new key failed to ‗correctly‘ identify 18 out of the 66 type specimens found, three of which were collected in the 1800s. Long term dehydration and storage in a variety of preservative fluids may cause tissue shrinkage (see below) and consequently distort the ratios used in the new key. Additionally, 10 type specimens that the new key ‗incorrectly‘ identified were subspecies of P. affinis, taken from small islands off the coast of West Australia. It has been documented that the morphology of insular snakes may differ from that of mainland snakes (Greer 1997, Keogh et al. 2005). Insular P. affinis subspecies normally possess erratic scale counts and scale arrangements, as well as a smaller body size and length than their mainland counterparts. As very few mainland specimens have been found displaying similar morphology or have been collected in the 1800s, these reasons may explain the inability of the new key (and others) to ‗correctly‘ identify these type specimens.

Although individual physical anomalies or the inclusion of poor characters may prevent the attainment of perfection with any identification key, the reliance on preserved specimens to help construct and test keys may make key development slightly more


75

difficult. Not only have live Pseudonaja been documented to change colour and pattern seasonally and ontogenetically, but these characteristics, as well as morphometric measures of specimens, may also change over time when stored in preservative fluids (Krefft 1862a, Smith 1955, Banks 1981, Taylor 1981, Lee 1982, Bush 1989a, 1989b, Orange 1992, Reed 2001). As touched upon above, this may be part of the reason all keys were unable to ‗correctly‘ identify all type specimens. Another issue when using museum specimens is that of misnomers. Snakes were found in every museum collection which had been incorrectly classified (for example, at least 14% [7/49] of P. ingrami specimens available in all museums were misidentified). Such misnomers, if trusted without error-checking, may introduce variation into a key—variation which may not be present in all taxa represented in a key. Despite any complexities of using museum samples, it would be unrealistic to attempt the present study with live specimens as the time, expense, and mortal risks to researchers involved with the capture of a large number of snakes would be prohibitive. It is not assumed that the new key is the best possible key, only that keys should be replaced as they are improved and that improvement will only occur with a corresponding improvement in research design.

Even after accounting for museum misidentification and preservative-generated changes, the three most probable reasons for past confusion within this genus are 1) problems with past research methods, 2) the lack of sampling throughout their range, and 3) the variable colour and pattern exhibited by members of Pseudonaja. Of studies where a list of snakes examined was provided (or could be deduced), sample sizes were low (anywhere between two and two hundred) compared to the numbers of museum specimens available (see Chapter 5, Table 5.1), and the distribution of snakes examined was also biased, often occurring around large population centres or only from areas where fresh tissue was available for analysis (see Figure 2.12). Unfamiliarity with brown snakes has also led to errors in the literature not only in regard to the existence of valid species, but also their distributions. For example, after viewing most brown snakes housed in zoos, public reptile collections, and museums, no Western Australia (WA) specimens of either P. ingrami or P. textilis were found, despite several publications alluding to their presence (e.g., Storr et al. 1986, Wilson 2005). That is not to say that they do not exist there, but genetic tests and ecological evaluations (such as the assessment of dietary items present in the digestive system) of specimens examined for this thesis (see Chapter 5) confirm the morphometric determination that these two


76

species are likely absent from WA. To reiterate and paraphrase the sentiments of Mengden and Fitzgerald (1987): colour and pattern are not necessarily the best primary or secondary characters for definitively identifying species within this genus.

The intentions for this chapter were twofold. First, after documenting the dynamic taxonomic history of the genus (see Chapter 1) and identifying the probable reasons for past taxonomic difficulties within the genus (this chapter), it was important to test and determine the suitability of a particular research method for use with Pseudonaja taxonomy and systematics research. The research design chosen is strong as it led to the development of an improved, unambiguous key to identify the seven currently and most widely recognised species of Pseudonaja, applicable for use at any geographic scale. This systematic design was utilised for specimen and tissue selection in Chapters 4 and 5, which document the genetic and morphometric variability, respectively, of Oxyuranus and Pseudonaja. In the hope of increasing the possible amount of snakes for genetic analysis, a separate methodological examination is presented in Chapter 3, in which multiple protocols designed for DNA recovery from formalin-fixed tissue are tested and compared. The use of the best research methods, large numbers of samples, and multiple lines of evidence should lead to high quality data and results. But as has been documented above, these practices are not always undertaken. Thus, the second intention was to put forth a number of recommendations—each of which was formulated by reading taxonomic literature—for future taxonomic studies. These ten recommendations will help to improve the quality of future taxonomic research: 

(Sub)sample systematically from throughout the known range of the species, and include sufficient specimens in order to incorporate the full range of ontological, sexual, and regional variation of a taxon. This should not be a problem for most taxa stored in museum collections because such institutions can be easily visited and/or specimens loaned for analyses. When just one or a few specimens (especially after returning from a field survey) have been recognised as a potentially new taxon, this recommendation may become problematic. However, it would then be important for researchers to ask themselves how much analyses of data taken from small sample sizes can be trusted to help delineate taxa. As sole ‗owners‘ of the knowledge of the existence of a new taxon, there should be no need to hurry publication and leave


77

the taxonomic clean-up to other researchers. Overall time, effort, and money would perhaps be better spent searching for additional specimens before results are presented. Increasing samples sizes would also improve manuscripts presenting distributional or ecological data by augmenting the amount of information and reducing the amount of supposition (Hirzel and Guisan 2002, MacKenzie and Royle 2005). 

When dealing with previously described taxa, each character previously diagnosed should be treated as a hypothesis and addressed in a scientifically appropriate manner. Publication is all that is needed to formally reset or introduce new taxonomic nomenclature regardless of the quality of the work or whether the authors have interpreted and discussed the results of previous researchers. This is a fundamental flaw in taxonomic methodology and procedure. If ―taxonomy is a matter of consensus...‖, as Golay et al. (1993) suggested it should be, then there needs to be a review of all previous work on a taxon—and not solely a presentation of new work—before a consensus can truly be reached.



Taxonomic

descriptions

should

clearly

specify

characters

which

differentiate the taxon from closely related taxa, and include identification keys with any multi-taxa review. This is concordant with the previous recommendation: as they are the strongest hypotheses as to what constitutes a taxon, only those characters listed in the diagnosis would need to be formally checked. A longer description that further documents within- and betweenspecies variation of the taxon should follow the diagnosis and these characters could be subject to future testing depending on the questions being asked (such as tests of taxonomic, ontogenetic, or sexual differences). Characters chosen need not only describe the morphology of a taxon but can include genetic and ecological attributes as well. Identification keys included with multi-taxa revisions should provide accuracy information not only to gauge their effectiveness, but also to help determine the variation present within evaluated characters.


78

Illustrations or pictures for all characters, precise character definitions, unambiguously-explained methodological procedures, and a list of specimens examined should all be included to ensure consistency with future analyses. Taxonomic literature rarely mention, especially for ‗common‘ practices, the precise way in which data were collected, analyses were undertaken, or results interpreted. Researchers use a variety of techniques for determining common scale counts (e.g., ventral scale count), yielding differing results for the same measure. Typically, authors rely on techniques previously published. In such cases, a citation to the original source should be included. Failure to list specimens examined was not uncommon in the past; thankfully, this trend is reversing. But specimens are sometimes recorded as being kept in the possession of the author(s) (Teynié and David 2005, Pollock 2009). All specimens (especially type material) should always be lodged in regional or national museums to help provide adequate preservation and open access for examination.



Include multiple lines of evidence. A review of 147 papers published since 2000, each of which revised or newly described snake genera, species, and/or subspecies, showed most authors rely on a single line of evidence to support their taxonomic proposals. Within those papers, 256 taxa out of 350 described (73%; new species descriptions only: 142/172 = 83%) were found to be unique solely with the use of morphological characters—usually colour, pattern, or simple scale counts. This is surprising, because as molecular analyses have become more common and widely used, the costs of conducting such analyses have decreased over time (to approximately $10 per sample for this study). Additionally, researchers are no longer limited by access to fresh or frozen specimens as it is possible to recover genetic material from specimens kept or fixed in formalin and other chemicals which degrade DNA (see Chapter 3). Those without access to a genetics lab should collaborate with those with molecular experience and facilities. Including as much ecological and behavioural data (e.g., diet lists, parasite loads, or hours of activity) as possible to help describe taxa is also simple and inexpensive, especially when dealing with only a few specimens.


79

Avoid jargon. Terminology used as short-hand to communicate with (and normally only understood by) colleagues is jargon and obscures the true meaning of what the authors are trying to communicate (Carraway 2006). Article 8.1.1 of the Code—a work must be issued for the purpose of providing a public and permanent scientific record—is somewhat devalued if the majority of the population cannot comprehend what is being written (International Commission on Zoological Nomenclature 1999). Taxonomic descriptions should be clearly written for the understanding (and appreciation) of both nonspecialists and specialists.



Results and raw data should be lodged electronically as well as with the appropriate museums. Published studies should be repeatable and readers should be able to examine actual results rather than just summaries, but this is often difficult without access to the raw data (Altman and Cates 2001). Some research is also destructive; future researchers would thus benefit greatly from being able to access past data collected, not merely published results. As museum specimens are public material, data collected from these specimens should be considered public material as well. However, it is important to recognise the costs, time, and effort put in by researchers to collect such data. It is therefore recommended that after allowing a suitable period of time for data collection, analysis, and publication (say, five years), all data collected from museum specimens should be lodged electronically with the corresponding museums (see Nagelkerke et al. 2007 for alternative sites for electronic data lodgement). Journals (as they are increasingly doing) should make available online supplements for raw data. To reword Altman and Cates (2001), not having access to the raw data suggests some suspicion is appropriate where none had existed previously.



Results should be presented in approved, independent, peer-reviewed journals. One unforeseen consequence of the digital age is the onset of desktop publication. It is now a matter of ease for an overly zealous taxonomist to quickly start a new journal and self-publish, all within the letter (but not spirit) of the Code. As described by Minelli (2003), bacteriologists have solved the problem of ‗unethical‘ naming practices: they may publish where they wish, but


80

any new name is only recognised if it is published in the International Journal of Systematic Bacteriology. Vertebrate taxonomists will need either to adopt a similar solution or else establish a list of journals which are acceptable for publication of taxonomic research. 

Articles submitted/published should be reviewed on merit, not prejudiced by the scientific standing of the authors or any sense of entitlement to a particular taxon by other researchers. If any individual or group publishes data supporting a scientifically sound argument (as detailed in the previous recommendations) for recognition or revision of a (new) taxon, they should not be suppressed by others with similar taxonomic interests. Until formal rules are agreed upon as to where and how someone may publish their results (see above), or the issue of principle of priority redressed, judgment should be made solely on the quality of the research and not on the authors or their affiliations.



Update and augment International Code of Zoological Nomenclature rules expediently and regularly (as necessary). Many of the perceived issues in taxonomy are due to problems various researchers have with the present version of the International Code of Zoological Nomenclature. Indeed, some of the recommendations listed above would entail changes or additions to the Code‘s regulatory framework, last published in 1999. The Commission should consider the suggestions and concerns raised by their constituents and make timely updates to the Code. The combination of better taxonomic practices supported within a regulatory framework may help ensure fairness and consistency amongst researchers, protect the money and time researchers invest into their work, and alleviate the need to rush publication.

CHAPTER 3 – ALL PROTOCOLS ARE NOT CREATED EQUAL: A TEST OF PUBLISHED METHODS USED TO EXTRACT AND AMPLIFY DNA FROM CHEMICALLY-TREATED, ARCHIVAL TISSUE

Abstract

Significant insights of systematic relationships have been confirmed or made possible by analyses of DNA, typically extracted from ‗fresh‘ tissue (tissue prior to chemical fixation conducted by most museums). Yet reliance on fresh tissue may hinder the type or breadth of analyses undertaken, often due to incomplete coverage of available fresh tissue and collection costs typically associated with broad, geographic sampling. Inclusion of archival material in phylogenetic analyses could alleviate these issues, but comprehensive implementation is uncommon due to a number of factors which can hinder DNA extraction and amplification from chemically-treated tissues. Many techniques have been published which document the successful use of such tissues, while only a few studies have attempted to compare protocol efficacies (and they only compare a small number of protocols). To determine if there were any differences between published methods for obtaining DNA from formalin-fixed, archival tissue, 47 extraction methods (41 techniques and 6 modifications) were tested. Additional investigations were performed on the efficacy of using selected polymerase chain reaction (PCR) additives, several Taq-replacements, different sizes of targeted gene fragments, and different sizes of starting tissue, as well as on how the time of storage after extraction affected PCR success. The best results came from extraction protocols which included a high heating step (≥ 90° C) or which took several days to wash and digest tissues, and PCRs which amplified short fragment sizes or were supplemented with bovine serum albumin or dithiothreitol. Though not without its drawbacks, including DNA extracted from chemically-treated tissue in phylogenetic analyses is an appropriate option and may allow more robust analyses to be conducted.

Keywords: Archival Tissue, DNA Extraction, Formalin-fixation, Museum, PCR.

Chapter 3: Optimising DNA recovery

82

Introduction

Direct and meaningful analyses of genetic material are possible due to the advances in molecular science over the past few decades. Indeed, it is now commonplace to utilise mitochondrial or nuclear deoxyribonucleic acids (DNA) in examinations of higher-order taxonomic relationships, speciation, movements between populations, paternity, and forensic material (Killian et al. 2001, Doughty et al. 2007, Pierson et al. 2006, Van Eenennaam et al. 2007, Phillips 2008). Most phylogenetic studies of vertebrates have utilised lengths of DNA obtained from blood, bone, or tissues collected from live or recently-dead individuals (hereby referred to as fresh tissue), have subsequently stored the sub-sampled material in 95-100% ethyl alcohol (EtOH) or at sub-zero temperatures, and have then processed and analysed these materials within a few months or years after collection. These methods reduce the effort needed to extract and amplify DNA, as well as maximise the number of high-quality, undamaged DNA fragments present after extraction. These methods also reduce time and monetary costs associated with laboratory research and, coupled with the ease with which some samples can be collected in the field (especially from common or widely-distributed taxa), provide an important avenue of research for a modern scientist (Douglas and Rogers 1998).

However, sole reliance of DNA obtained from fresh tissue has potential drawbacks. Most taxa have localised distributions or are not genetically identical throughout their geographic ranges, entailing increased costs in time, effort, and money allocated to travel in order to collect samples in the field. Higher field costs reduce the likelihood of collecting and analysing adequate numbers of samples from throughout the full extent of distribution (especially for rare or widely-distributed taxa). Additionally, a freshtissue research focus precludes working with material from extinct taxa or the examination of historically recent changes to the genotypes of extant taxa (Caramelli et al. 2007, Lahnsteiner and Jagsch 2005). To help ameliorate these problems, there is a growing interest in and body of research devoted to the utilisation of DNA obtained from archival tissue and specimens held in museums and natural history collections (Gugerli et al. 2005, Austin and Melville 2006, Tang 2006, Friedman and DeSalle 2008).


83

Museums provide the largest repository of tissue and specimens available for laboratory analysis. In addition to the sheer amount of available archival material, specimens are likely to be available from throughout an entire range of distribution and from decadesor centuries-old collecting expeditions. Material can either examined at facilities in the host institution or, through loan agreements, can be delivered directly to a researcher for local study. Conversely, travel costs may be high (if many museums are to be visited), there is no central database of all museum collections to know what is available for study, and access to specimens and their tissues is not guaranteed. But the greatest problems associated with the use of archival material in phylogenetic research are the ability to successfully recover DNA from chemically-treated tissue and the normally low-quality of any DNA recovered. As part of the archival process, most vertebrate material is fixed and stored in chemicals such as formalin and ethyl alcohol (hereby referred to as formalin-fixed tissue, or FFT). These chemicals (along with the ensuing length of time of storage before analysis) have been demonstrated to affect DNA integrity due to problems such as depurination and depyrimidation, strand nicks and breaks, and cross-linkage between DNA and proteins or between DNA strands (De Giorgi et al. 1994, Hofreiter et al. 2001, Schander and Halanych 2003, Willerslev and Cooper 2005, Tang 2006). These (and other) problems also can negatively affect the process of DNA extraction, amplification, and sequencing, limiting or excluding the use of archival material in most phylogenetic research.

Trying to successfully PCR and sequence DNA obtained from chemically-treated tissue can be a frustrating and time-consuming endeavour, primarily due to the number of biochemical and -mechanical factors which can affect the condition of archival DNA, mostly during the fixation process. Chemical fixation of specimens is meant to slow the morphological decay associated with death and to stabilise the appearance of an organism in death as it was in life, a task accomplished by cross-linking the proteins found within an organism‘s tissues (Schander and Halanych 2003). At least 24 different fixatives are used throughout the world, but most vertebrate specimens which have undergone chemical fixation in the last one hundred years have typically been injected with and placed within a 10% formalin solution (~40% formaldehyde solution diluted by ninety percent; Bramwell and Burns 1988, Vachot and Monnerot 1996, Douglas and Rogers 1998, Srinivasan et al. 2002, Hunt 2008, Sawada et al. 2008). Formalin can diffuse ~2.5 mm during the first 24 hours and ‗complete‘ fixation of most vertebrates is


84

usually accomplished within 24–48 hours, a time range that many museums set as a goal to end the fixation process (Fox et al. 1985, Start et al. 1992). These standards are not always maintained as, other than the potential for a specimen to become rigid, there is no morphological penalty for ‗over-fixing‘ a specimen (Vachot and Monnerot 1996, Aaron Bauer personal communication, personal observation). Increasing the length of exposure to or storage time within most fixatives has been shown to negatively influence (and after eight months in fixative, completely preclude) the chances of obtaining a successful PCR result (Ben-Ezra et al. 1991, Greer et al. 1991, Díaz-Viloria et al. 2005, Sawada et al. 2008). Although many of the genetic problems associated with formalin-fixation are minimised if the fixation process ends within 48 hours (up to twice the time needed for adequate fixation), a separate study has reported that material fixed (regardless of the formalin concentration) for less than 70 days is acceptable for use with phylogenetic analyses (Fox et al. 1985, Bramwell and Burns 1988, Start et al. 1992, Wiegand et al. 1996, Sung et al. 2000, Srinivasan et al. 2002, Sompuram et al. 2004, Díaz-Viloria et al. 2005, Sawada et al. 2008). If true, most archival material would be appropriate for molecular analyses. However, successful genetic recovery also appears to be dependent on the time taken until the fixation process is begun, the pH and concentration of the fixative, and the temperature at which fixation takes place (Bramwell and Burns 1988, Cross et al. 1990, Ben-Ezra et al. 1991, Douglas and Rogers 1998, Williams et al. 1999, Sung et al. 2000, Sompuram et al. 2004, Sawada et al. 2008). Thus, one goal of the preservative process is to completely fix specimens under the appropriate conditions and in the shortest possible time since specimen death. Temperature and pH can be monitored easily by the researcher, while the rate of fixative diffusion can be increased and the amount of time needed for complete fixation decreased through techniques such as sonication or microwave radiation (Hsu et al. 1991, Srinivasan et al. 2002, Fracasso et al. 2009). Due primarily to the carcinogenic nature of formalin and not because of the negative effects of formalin on DNA, specimens are usually rinsed after fixation and then stored in a 70% ethyl alcohol solution.

Exposure to fixatives does not appear to modify the overall morphological structure of most vertebrates but can cause morphological distortions at the cellular level and, as mentioned above, can negatively impact the condition and availability of DNA within a specimen over time (Fox et al. 1985, Vachot and Monnerot 1996, Reed 2001, Kerns et


85

al. 2008). Although the exact processes of all deleterious formalin effects are unknown, many of the effects have been previously described. These bio-chemical or -mechanical phenomena include, but are not limited to, base losses, base substitutions, strand nicks or shears, blocked fragment 3‘ ends, and cross-linkage between bases, molecules of DNA, or DNA and proteins (Lindahl 1993, De Giorgi et al. 1994, Williams et al. 1999, Schander and Halanych 2003, Willerslev and Cooper 2005, Tang 2006). Additionally, even if long-length, high quality DNA has survived degradation by naturally-occurring endogenous nucleases after the death of an organism, and is still available for extraction after fixation and storage, the presence of trace amounts of fixative chemicals carried over into extracts can inhibit PCR and successful sequencing (Graham 1978, Lindahl 1993, Hofreiter et al. 2001). As more is learned about each of the problems associated with retrieving archival DNA, further solutions are put forth to the scientific community. Several examples of potential solutions include long soaking and rinsing of tissues (typically in EtOH) prior to extraction in order to remove most fixative chemicals, long digestion steps (often with surfactants such as SDS [sodium dodecyl sulfate], Triton-X® [Dow Chemical Company], or Tween® [ICI Americas, Inc.]) to help reduce the number of proteins and maximise available DNA, the application of high temperatures during extraction to help break DNA-protein and DNA-DNA crosslinks, the introduction of pre-PCR cocktails and specialty PCR polymerases which have corrective potential (such as the replacement of missing or incorrect bases), and the addition of reagents (such as BSA) to a PCR mix in order to bind with potentially inhibitive fixative chemicals (Filichkin and Gelvin 1992, Shedlock et al. 1997, Shi et al. 2004, Moore 2005).

Each new technique has been published in the attempt to provide insights, recommendations, and solutions to the problems of obtaining DNA from archival FFT (see Appendix VI for multiple examples of protocols). However, much of the literature documenting successful extraction and amplification of archival DNA comes from analyses of ancient material which had never been fixed chemically, such as from bones, dried skin or tissue, insects, and microsporidia (e.g., Higuchi et al. 1984, Pääbo 1985, Yang et al. 1997, Su et al. 1999, Hyliš 2005). Among those publications which specifically detail success working with FFT, some techniques appear to have worked only in isolated instances, based on the number of subsequent studies which use and cite these techniques. In addition, most do not compare their efficacy with other methods


86

used for similar purposes. This may simply be a result of many novel methods which work equally well, thereby mitigating the need of any direct comparisons. Or, given the paucity of phylogenetic analyses utilising FFT, one may conclude that many methods work equally poorly.

This is a concern when utilising a large-scale, systematic approach to specimen selection—such as the research design tested and selected for this thesis (Chapter 2)— within phylogenetic studies, which may include FF specimens as part of the analyses (Chapter 4). As with deciding upon the best research design for specimen selection, it would be important also to choose the ‗best‘ method able to recover amplifiable DNA from FFT rather than to arbitrarily choose one protocol from the available scientific literature. But as described above, FFT researchers have few published resources to consult when trying to determine the adequacy of extraction and amplification methods. In this chapter, results from a comparison of 47 methods (41 techniques and 6 modifications) developed for the extraction of FFT-DNA are presented. Specific tests were performed to determine the method(s) which could consistently recover DNA from FFT, maximise the lengths of recovered sequences, and optimise the success of polymerase chain reactions (PCRs), regardless of the length of storage time. Results are also provided from further tests on the physical sizes and ages of FFT samples, the sizes of targeted DNA sequence lengths, the use specialty ingredients in PCRs, and the use of additives to PCRs (to facilitate DNA amplification). This chapter also includes a brief summary of the effects of curatorial preparation on DNA and presents general recommendations for the future use of FFT-DNA in phylogenetic analyses.

Materials and Methods Specimens – Tissue (ventral scales with their associated musculature and integument) from two unregistered brown tree snakes (Colubridae: Boiga irregularis) was obtained from the Queensland Museum (QM). These specimens were unregistered due to missing or incomplete information available to the curators at the time of donation to the QM. However, both specimens were brought to the QM at least 10-20 years before the onset of this study. Both specimens were assumed to have been prepared for storage as per normal QM protocols: fixation in neutral buffered formalin for 12-24 hours and then stored continuously at room temperature in 70% ethyl alcohol (Andrew Amey


87

personal communication). Tissue collected from the snakes was stored at room temperature in 70% EtOH until used in the trials described below. DNA Extraction – Method descriptions, either as stand-alone publications or reported as part of larger taxonomic studies, were located by standard literature searches. After eliminating nearly-identical protocols (i.e., spinning tissues at 12,600 rpm vs. 12,500 rpm), 38 methods were chosen for further investigation. An additional six protocols, modifications of six of the original 38 methods, were also tested. These modifications were primarily included to examine differences in heating apparatuses. All 44 techniques are detailed in Appendix VI. The instructions for each protocol were followed as published, although authors were contacted for clarification or corrections as needed (such as to confirm scalability of chemical volumes used to extract DNA from micrometre slices of tissue [as published] to volumes necessary to extract DNA from cubic millimetres (mm) of tissue [as used within this study]). The techniques chosen for analysis do not include all possible combinations of extraction methods, chemicals (types, brands, and concentrations), machine equipment, and recipe-specific thermocycles found throughout the literature on this subject. The scope of such a comparison was beyond the functional time and monetary possibilities of this thesis. Instead, each technique was chosen due to its emergence as a potential advancement within this field of science, for its prevalence in the literature, the distinctiveness of its methods, its described ease or rapidity of use, or as a result of freely available kits left over from past research or donated from molecular biological companies. The research presented here was undertaken to optimise the laboratory component of the genetics analyses detailed in Chapter 4 and to provide guidance for other researchers working with FFT. The work presented here was neither commissioned nor paid for by any of the authors or corporations referenced in this chapter.

During all laboratory activities, common protocols were used to avoid or detect contamination (Lindahl 1993, Cooper and Poinar 2000, Gilbert et al. 2005, Willerslev and Cooper 2005). These protocols included the use of separate, dedicated areas for extraction and amplification, thorough cleaning (including bleach and alcohol scrubs) or autoclaving of work areas and equipment between analyses, varying the workspace areas and start times for each method, the inclusion of positive and negative controls in all PCR reactions, and the replication of results. Each method was tested using two


88

different sizes of sub-sampled tissues: 1 mm3 and 3 mm3. These sizes were chosen because they mimic sizes typically extracted from fresh tissue for use in phylogenetic analyses and because they represent sizes one could realistically expect to obtain from museums allowing access to type material. Some methods were tested an additional number of times as tissue and kit supplies lasted. However, as results from these extra tests did not differ from the first two extractions or subsequent PCRs, they are not reported here.

Immediately after extraction, one month after extraction, and two months after extraction, five microlitres (L) of extracts were added to starting wells located in one percent agarose gels stained with 0.05 micrograms per millilitre (g/mL) of ethidium bromide. The gels were electrophoresed at 100 volts for twenty minutes and then viewed under ultraviolet (UV) light to quantify the presence and size of DNA fragments. Further quantification was performed with a spectrometer (UV-1800®, Shimadzu) using the ‗Spectrum‘ and ‗Point Pick‘ functions, recording absorbance values of light at wavelengths between 200–350 nanometres (nm). Specifically, absorbencies at 230 nm, 260 nm, 280 nm, and 320 nm were recorded to characterise turbidity, phenol contamination, protein contamination, salt contamination, and to estimate DNA concentration and purity. All DNA extracts were stored in light-free containers and refrigerated at +4° Celsius (C) unless otherwise instructed. DNA Amplification – For reasons explained in Chapter 4, attempts were made to amplify approximately 900 base pairs of a mitochondrial fragment encompassing parts or all of the ND4 and neighbouring Histidine-, Serine-, and Leucine-tRNA genes. This fragment was amplified using forward and reverse primers originally published by Arévalo et al. (1994) and Forstner et al. (1995). Due to a body of evidence describing the shearing and breaking of DNA strands subjected to formalin fixation (see Discussion), additional, internal primers were designed in order to test the efficacy of each method on smaller fragment lengths. Targeted sequence lengths included ND4– M246 (~900 base pairs), ND4-1aF–M246 (~800 base pairs), ND4-3F–M246 (~550 base pairs), and ND4–ND4-H1 (~350 base pairs). Specific primer information is contained in Table 3.1 and the location of each primer within a typical elapid mitochondrial genome is illustrated in Figure 3.1. At least four separate PCRs were performed on extractions (two each immediately after extraction and two months after extraction) using in-house


89

PCR and sequencing protocols (see following two paragraphs) for all methods. Additional PCRs and sequencing were performed on extractions derived from methods which provided full instructions from initial DNA extraction through to final sequencing reactions. In those cases, all instructions were followed—within reasonable limits (i.e., each particular PCR recipe was followed, but the brand and model of the PCR machine used may have differed from the brand and model mentioned in each publication). Each polymerase chain reaction was carried out in a total volume of 12.5 L according to the following recipe: 0.50 L 10 millimolar (mM) forward primer 0.50 L 10 mM reverse primer 0.25 L 10 mM deoxyribonucleotide triphosphates 1.00 L 25 mM magnesium chloride 1.25 L 10 mM Fischer DNA polymerase reaction buffer 0.05 L 0.275 mM Fischer DNA polymerase Taq 0.30 L DNA extract 8.65 L double-distilled, deionised water

The PCR program was originally optimised for use with DNA obtained from fresh tissue and modified for DNA from FFT. The program consisted of one cycle of +94° C for ten minutes, followed by 40 cycles of: (+94° C for 45 seconds, annealing temperatures [see Table 3.1] for 45 seconds, and +72° C for 90 seconds), and finishing with one cycle of +72° C for seven minutes on a GeneAmp® 2700 machine. The number of cycles typically used for PCRs of fresh tissue is often 25–35 cycles (Sambrook 2001, Bartlett and Stirling 2003, Dieffenbach and Dveksler 2003). More cycles may increase the chances of non-specific amplification, but this risk is balanced by research showing that forty is approximately the optimal number of cycles necessary to create enough amplicons of DNA (regardless of fragment size) from FFT (Lehmann and Kreipe 2001). Five L of PCR products were added to starting wells in one percent agarose gels stained with 0.05 g/mL ethidium bromide. The gels were electrophoresed at 100 volts for twenty minutes and the presence and size of PCR products was


90

Table 3.1. A list of mitochondrial primer pairs used in this chapter. Left-aligned primer names indicate use with forward direction/light DNA strands while right-aligned primer names indicate use with reverse direction/heavy DNA strands. Primers without superscript annotation were designed for this study. Base positions (at the 5‘ end) correspond to the mitochondrial genome map published by Kumazawa et al. (1998). Nucleotides include: A = adenine, C = cytosine, G = guanine, T = thymine, D = A + G + T, R = A + G, and Y = C + T. The relative location of each primer within the mitochondrial genome is illustrated in Figure 1.

Name 1

ND4

Sequence

Melting Temperature ( C) 65.3 60.5 54.8 60.5 63.3 60.5 65.3 69.2

Base Position (5‘ end) 11677 12569 11758 12569 12034 12569 11677 12032

GC%

Approximate Sequence Length

TGACTACCAAAAGCTCATGTAGAAGC 42.3 892+ M246 TTTTACTTGGATTTGCACCA 35.0 ND4-1aF GGYATTATCCGYCTATCCC 52.6 811+ 2 M246 TTTTACTTGGATTTGCACCA 35.0 ND4-3F TACGAACGYACACAAACCCG 52.5 535+ 2 M246 TTTTACTTGGATTTGCACCA 35.0 1 ND4 TGACTACCAAAAGCTCATGTAGAAGC 42.3 355+ ND4-H1 CGGGTTTGTGTRCGTTCGTAGG 52.1 1 From Forstner et al. (1995) 2 From Skinner (2003), a modification (by reduction of the initial six bases of the primer Leu) of Arévalo et al. (1994) 3 This primer pair has an optimal annealing temperature range of 58.5–64.0 C 2

Annealing Temperature ( C) 58.5 53.5 56.1 64.03


91

Figure 3.1. Relative location and directionality of each primer used to test the efficacy of various DNA extraction methods as presented in this chapter. Primer compositions, melting temperatures, and base positions are located in Table 3.1. Full genome map modified and reprinted from Dong and Kumazawa (2005).


92

confirmed visually under UV light.

Polymerase chain reactions of extracts of selected methods (both successful and unsuccessful) were re-run with the inclusion of several additives previously described as potentially helpful with the extraction of DNA from FFT: bovine serum albumin (BSA, 1%), dimethyl sulfoxide (DMSO, 1–10%), dithiothreitol (DTT, 10 mM), and glycerol (5–10%). An equivalent amount of double-distilled, deionised water was replaced in the PCR mixture by the volumes of the additives (0.125–1.250 L). Electrophoresis gels of these new PCR products (as described above) were examined for comparative efficacy and influence on the success of the PCR. Successful PCR products were cleaned on a GeneAmp® 2700 machine in a total volume of 4.25 L according to the following recipe: 0.25 L Exonuclease I 1.00 L shrimp alkaline phosphotase 3.00 L PCR product

The cleaning program of successful PCR products was run on a GeneAmp® 2700 machine and consisted of one cycle of +37° C for 35 minutes, followed by one cycle of +80° C for 20 minutes. All original and cleaned PCR products were stored in light-free containers at +4° C unless otherwise directed. DNA Sequencing – A sequencing reaction for cleaned, successful PCR products was run on a GeneAmp® 2700 machine in a total volume of 10 L according to the following recipe: 2.00 L 5x BigDye® V3.1 terminator buffer 2.00 L BigDye® terminator dye 0.32 L 10 mM primer (only one primer per sequencing reaction) 0.50 L cleaned, successful PCR product 5.18 L double-distilled, deionised water


93

The sequencing reaction program was run for one cycle of +96° C for one minute, followed by 30 cycles of: (+96° C for 10 seconds, +50° C for 5 seconds, and +60° C for four minutes). Sequencing clean-up involved a total of ten steps. First, the following recipe was created in a 1.5 mL tube: 10.0 L contents of each sequencing reaction 10.0 L double-distilled, deionised water 5.0 L 125 mM ethylenediaminetetraacetic acid 60.0 L 100% EtOH

This mixture was left to precipitate at room temperature for 15 minutes, then spun at 13,500 rpm for 40 minutes at +4° C. All fluid was removed and replaced with 250 L 70% EtOH. The tube contents were gently inverted three times and then spun at 13,500 rpm for 30 minutes at +4° C. All fluid was again removed before each tube was left to dry at room temperature in a light-impermeable vacuum bowl for no more than 30 minutes. Dried tubes were then transported in light-impermeable containers to the Griffith University Sequencing Facility for final sequencing on an Applied Biosystems® 3130 machine. Original sequences were edited using BioEdit 7.0.9.0 (Hall 1999) and CodonCode Aligner 2.0.6 (CodonCode 2007). Individual, edited sequences were submitted to the NCBI BLAST database (Altschul et al. 1990) to compare with identical or similar sequences with known species designations. Additional Comparisons – Three additional, kit-based protocols (Appendix VI: protocols 40, 41, and 42) were supplied after the exhaustion of the original museum tissue and result analyses. As these three techniques could not be directly compared with the other protocols, they were compared relative to two of the more promising techniques (Appendix VI: protocols 3a and 18). Pieces of tissue 3 mm3 in size were subsampled from three Pseudonaja textilis specimens, one each from the following museums: Australian Museum (Sydney), Australian National Wildlife Collection (Canberra), and Museum Victoria (Melbourne). UV spectrometry analyses and agarose gel comparisons of these five (three new and two reference) protocols were conducted as described above. In all, 41 protocols (and six modifications thereof) were directly or indirectly compared for their efficacy in extracting DNA from formalin-fixed tissues. A


94

Fisher‘s Exact Test with a two-tailed distribution was used to compare two separate results obtained from extractions of DNA from 1 mm3 and 3 mm3 tissue. Specifically, tests were conducted on the ability to recover DNA and on the total amount of DNA recovered from differing sizes of tissue.

Results

Amongst unique protocols that showed any differences when comparing the size of tissue used for extractions (n = 20), extractions from 3 mm3 tissues were significantly more likely to have fluorescent DNA visible within the agarose gel (immediately and one month after extraction—no comparisons were made two months after extractions) than extractions from 1 mm3 tissues (Fisher‘s Exact Test, with a two-tailed distribution: p = 0.0001; Tables 3.2 and 3.3). The presence of (precipitated) DNA within extracts immediately after extraction, one month after extraction, and two months after extraction is illustrated in Figures 3.2, 3.3, and 3.4, respectively. These figures show that although DNA is able to migrate through the gel, undigested proteins and other cellular material are still visible within the wells of certain protocols. Most of these protocols do not include a step to centrifuge away such particles. Amongst the original 44 extracts from 3 mm3 tissue, fluorescent DNA was visible in 23 extracts immediately after extraction, in 25 extracts one month after extraction, and in 17 extracts after two months (Tables 3.2 and 3.4). The fluorescence of most protocols, including both the largest visible fragment lengths and the most fluorescent (most common) fragment lengths, appears to remain stable over time (Tables 3.2 and 3.4).

The UV spectrometry results listed in Table 3.5 were collected one year after extraction. Although a few of the protocols list their extracts as being stable only up to a month, the readings taken after one year (along with the information provided within the earlier agarose gel checks) provide a relative basis to compare extraction success. Extractions from 3 mm3 tissues were significantly more likely to show a greater DNA concentration than extractions from 1 mm3 tissues (23 protocols vs. 12 protocols; Fisher‘s Exact Test, with a two-tailed distribution: p = 0.0287; Table 3.5). Of the twelve protocols showing a greater DNA concentration from 1 mm3 tissues, nine of the measurements taken from 3 mm3 tissues came from extracts rehydrated due to storage tubes being empty (or nearly so) after extensive testing done during the previous year. Given the results of


95

Table 3.2. Comparisons of relative efficacy of DNA extraction protocols at the time of extraction, one month after extraction, and two months after extraction, as determined by viewing DNA within an ethidium bromide-stained, one percent agarose gel under UV fluorescence. Extracts from 1 mm3 tissue sections were not tested two months after extraction.

Immediately After Extraction Protocol ID

Extract Visible On Gel?

1

1 mm3 – No 3 mm3 – No

2a (autoclave)

1 mm3 – No 3 mm3 – No

2b (heat block)

1 mm3 – No 3 mm3 – No

3a (autoclave)

1 mm3 – Yes 3 mm3 – Yes

3b (heat block)


4a (autoclave)

1 mm3 – No 3 mm3 – Yes

4b (heat block)


5a (autoclave)

1 mm3 – No 3 mm3 – No

6

1 mm3 – No 3 mm3 – No

DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 500 2500; 1000 3 mm3 – 1 >10000; 1250 1 mm3 – 750 1250; 1000 3 mm3 – 1 >10000; 1000 1 mm3 – N/A 3 mm3 – 1 300; 200 1 mm3 – N/A 3 mm3 – 1 400; 200 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A

One Month After Extraction Extract Visible On Gel? 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No 1 mm3 – Yes 3 mm3 – Yes 1 mm3 – Yes 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No

DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 500 1100; 900 3 mm3 – 1 >10000; 900 1 mm3 – 500 2000; 1000 3 mm3 – 1 >10000; 1000 1 mm3 – N/A 3 mm3 – 1 1000; 150 1 mm3 – N/A 3 mm3 – 1 1500; 150 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A

Two Months After Extraction Extract Visible On Gel?

DNA Fragments: Size Range; Mode (in base pairs)

3 mm3 – No

3 mm3 – N/A

3 mm3 – Yes

3 mm3 – 1 250; 125

3 mm3 – Yes

3 mm3 – 1 250; 125

3 mm3 – Yes

3 mm3 – 1 >10000; 1250

3 mm3 – Yes

3 mm3 – 1 >10000; 1250

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A


96




7

1 mm3 – No 3 mm3 – No

8


9


10

1 mm3 – No 3 mm3 – No

11

1 mm3 – No 3 mm3 – No

12

1 mm3 – No 3 mm3 – No

13

1 mm3 – No 3 mm3 – No

14

1 mm3 – No 3 mm3 – No

15bl (blood kit)

1 mm3 – No 3 mm3 – No

15t (tissue kit)

1 mm3 – No 3 mm3 – No

3

16

1 mm – No 3 mm3 – No

DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – 1 300; 200 1 mm3 – 250 >10000; 1500 3 mm3 – 250 >10000 1500 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A

One Month After Extraction Extract Visible On Gel? 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – Yes 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No 1 mm3 – Yes 3 mm3 – Yes

DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – 1 250; 125 1 mm3 – N/A 3 mm3 – 1 300; 150 1 mm3 – 1 >10000; 1000 3 mm3 – 1 >10000; 1250 1 mm3 – N/A 3 mm3 – 1 2500; 625 1 mm3 – N/A 3 mm3 – 1 2500; 500 1 mm3 – N/A 3 mm3 – 1 2500; 500 1 mm3 – N/A 3 mm3 – 1 2500; 1250 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 1 >10000; 2500 3 mm3 – 1 >10000; 250



3 mm3 – Yes

3 mm3 – 1 250; 125

3 mm3 – No

3 mm3 – N/A

3 mm3 – Yes

3 mm3 – 1 >10000; 900

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

Not Tested

Not tested

Not Tested

Not tested

3 mm3 – No

3 mm3 – N/A


97




DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – 500 1750; 1250 1 mm3 – 1 >10000; 1000 3 mm3 – 1 >10000; 1000 1 mm3 – N/A 3 mm3 – 1 300; 150 1 mm3 – 1 >10000; 650 3 mm3 – 1 >10000; 650 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – 0 250; 125 1 mm3 – N/A 3 mm3 – 1 650; 200

One Month After Extraction Extract Visible On Gel?

17q (short)

1 mm3 – No 3 mm3 – No

1 mm3 – No 3 mm3 – No

17l (long)


18


19


20


21

1 mm3 – No 3 mm3 – No

22


24


25


1 mm3 – 1 >10000; 650 3 mm3 – 1 >10000; 650


26


1 mm3 – 350 2000; 1000 3 mm3 – 1 >10000; 1000


1 mm3 – Yes 3 mm3 – Yes 1 mm3 – Yes 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – Yes 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – Yes

Two Months After Extraction

DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 750 3000; 1400 3 mm3 – 1 8000; 1500



3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

1 mm3 – 1 10000; 1750 3 mm3 – 1 >10000; 1500

3 mm3 – Yes

3 mm3 – 1 >10000; 1400

3 mm3 – No

3 mm3 – N/A

3 mm3 – Yes

3 mm3 – 1 >10000; 1000

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

1 mm3 – N/A 3 mm3 – 1 500; 300 1 mm3 – N/A 3 mm3 – 1 >10000; 250 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – 1 650; 250 1 mm3 – 1 >10000; 1150 3 mm3 – 1 >10000; 1150 1 mm3 – N/A 3 mm3 – 1 >10000; 1250

3

3 mm – Yes

3

3 mm – Yes

3 mm3 – 1000 >10000; >10000 3 mm3 – 3000 >10000; >10000


98



27





1 mm3 – N/A 3 mm3 – 1 >10000; 750


3

28


29


30


31


32

1 mm3 – No 3 mm3 – No

33


34

1 mm3 – No 3 mm3 – Yes 3

35

One Month After Extraction

1 mm – No 3 mm3 – Yes

1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – 1 400; 250 1 mm3 – 1 >10000; 1000 3 mm3 – 1 >10000; 1000 1 mm3 – 1 2000; 550 3 mm3 – 1 >10000; 550 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 1 >10000; 1000 3 mm3 – 1 >10000; 1500 1 mm3 – N/A 3 mm3 – 1 >10000; 2000 1 mm3 – N/A 3 mm3 – 1 >10000; 2000

1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – Yes 3

1 mm – Yes 3 mm3 – No

3

1 mm – No 3 mm3 – No 1 mm3 – No 3 mm3 – No

3


3


3


DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – N/A 3 mm3 – 750 >10000; 1750 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – 1 500; 350



3 mm – Yes

3 mm3 – 5000 >10000; >10000

3 mm3 – No

3 mm3 – N/A

Not Tested

Not tested

3 mm3 – Yes

3 mm3 – 1 >10000; 2000

3 mm3 – No

3 mm3 – N/A

3 mm3 – Yes

3 mm3 – 1 300; 250

1 mm3 – N/A 3 mm3 – 1 >10000; 1000

3 mm3 – Yes

3 mm3 – 1 500; 250

1 mm3 – N/A 3 mm3 – N/A

3 mm3 – No

3 mm3 – N/A

1 mm3 – N/A 3 mm3 – 1 >10000; 2500

3 mm3 – Yes

3 mm3 – 1 500; 250

1 mm3 – 1 >10000; 1500 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A

3


99




36


37

1 mm3 – No 3 mm3 – No

38a (autoclave)


38b (heat block)

1 mm3 – No 3 mm3 – No

39

1 mm3 – No 3 mm3 – No

DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – 2000 3000; 2500 3 mm3 – 2000 3000; 2500 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 500 4000; 1000 3 mm3 – 1 >10000; 1000 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A

One Month After Extraction Extract Visible On Gel? 1 mm3 – Yes 3 mm3 – Yes 1 mm3 – No 3 mm3 – No 1 mm3 – Yes 3 mm3 – Yes 1 mm3 – No 3 mm3 – No 1 mm3 – No 3 mm3 – No


DNA Fragments: Size Range; Mode (in base pairs) 1 mm3 – 2000 3000; 2500 3 mm3 – 2000 3000; 2500 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 300 3000; 375 3 mm3 – 1 >10000; 1000 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A



3 mm3 – Yes

3 mm3 – 1 >10000; 2750

3 mm3 – No

3 mm3 – N/A

3 mm3 – Yes

3 mm3 – 1 >10000; 1100

Not Tested

Not tested

3 mm3 – No

3 mm3 – N/A

Table 3.3. Summary of protocols showing visible DNA under UV fluorescence. Results are arranged showing comparisons between the time since extraction and the size of tissue samples. Symbols include: + = visible fluorescence; and - = fluorescence absent.

Timing Tissue Size and Success Number of Protocols

Immediately After Extraction

One Month After Extraction

1 mm3 +

3 mm3 +

Both +

Both -

1 mm3 +

3 mm3 +

Both +

Both -

0

11

12

21

1

16

9

18


100

Figure 3.2. Images of ethidium bromide stains of DNA extracts (taken immediately after extraction) run electrophoretically through a one percent agarose gel. Alphanumerical codes are as follows: L = one kilobyte DNA ladder (GeneRuler®, Fermentas); E = empty well; and 1–39 = DNA extraction methods (as described in Appendix VI). The letter ‗m‘ denotes in-house modifications of the relevant protocol. Each pair of lanes per protocol represents one extraction from approximately 1 mm3 and 3 mm3 of tissue (left and right lanes, respectively). Each lane contains 5 L of extract.


101

Figure 3.3. Images of ethidium bromide stains of DNA extracts (taken one month after extraction) run electrophoretically through a one percent agarose gel. Alphanumerical codes are as follows: L = one kilobyte DNA ladder (outer lanes; GeneRuler®, Fermentas) or MspI-HpaII ladder (inner lanes; pUC19 DNA®, Fermentas); E = empty well; and 1–39 = DNA extraction methods (as described in Appendix VI). The letter ‗m‘ denotes in-house modifications of the relevant protocol. Each pair of lanes per protocol represents one extraction from approximately 1 mm3 and 3 mm3 of tissue (left and right lanes, respectively). Each lane contains 5 L of extract.


102

Figure 3.4. Images of ethidium bromide stains of DNA extracts (taken two months after extraction) run electrophoretically through a one percent agarose gel. Alphanumerical codes are as follows: L = one kilobyte DNA ladder (taller ladders; GeneRuler®, Fermentas) or MspI-HpaII ladder (shorter ladders; pUC19 DNA®, Fermentas); E = empty well; and 1–39 = DNA extraction methods (as described in Appendix VI). Each lane per protocol represents one extraction from approximately 3 mm3 of tissue. Each lane contains 5 L of extract. Extraction lanes marked with an asterisk (*) contained extract spilled over from the lane immediately preceding them to the left.

Table 3.4. Summary of protocols showing visible DNA (extracted from 3 mm3 tissue) under UV fluorescence. Results are arranged showing differentiation between the time since extraction and the size of extracted fragments.

Fragment Timing Number of Protocols Mean Size (base pairs) Standard Deviation (base pairs)

Most Common Fragment After 1 After 2 Immediate Month Months

Largest Fragment After 1 After 2 Immediate Month Months

23

25

17

23

25

17

942

917

2516

6684

6029

6591

665

694

3642

4526

4318

4758


103

Table 3.5. Comparison of DNA extraction protocols as determined by UV spectrometry (DNA yield and purity one year after extraction) and UV fluorescence within an ethidium bromide-stained, one percent agarose gel (PCR outcomes immediately after extraction and two months after extraction). Italicised DNA yields are taken from rehydrated, previously empty (or nearly so) storage tubes due to extensive testing done during the previous year.

Protocol ID

One Year After Extraction


DNA Yield (g/mL)

DNA Purity 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A

800: 1 smear 1000: 4 smears

2a (autoclave) 2b (heat block)

1 mm3 – 0 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0

3a (autoclave)

1 mm3 – 413.8 3 mm3 – 885.9

1 mm3 – 1.31 3 mm3 – 1.26

400, 600, 800, 1000: 4 smears

1 mm3 – 1.24 3 mm3 – N/A

400: 3 smears 600, 800, 1000: 4 smears No bands or smears

1

3b (heat block) 4a (autoclave) 4b (heat block) 5a (autoclave) 6 7 8 9 10 11 12 13 14 15bl (blood kit) 15t (tissue kit)

1 mm3 – 1588.6 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 33.2 3 mm3 – 9.7 1 mm3 – 361.3 3 mm3 – 1077.7 1 mm3 – 9.8 3 mm3 – 22.5 1 mm3 – 11.6 3 mm3 – 24.0 1 mm3 – 15.4 3 mm3 – 30.0 1 mm3 – 9.8 3 mm3 – 69.9 1 mm3 – 30.7 3 mm3 – 21.0 1 mm3 – 0 3 mm3 – 0 1 mm3 – 27.4 3 mm3 – 8.7

1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 1.57 3 mm3 – 1.76 1 mm3 – 1.25 3 mm3 – 1.31 1 mm3 – 1.69 3 mm3 – 1.63 1 mm3 – 1.97 3 mm3 – 1.79 1 mm3 – 1.83 3 mm3 – 1.72 1 mm3 – 2.28 3 mm3 – 1.62 1 mm3 – 1.72 3 mm3 –1.81 1 mm3 – N/A 3 mm3 – N/A 1 mm3 – 1.83 3 mm3 – 2.23


Sequence Lengths (base pairs): Successful PCR Test(s)

1000: 4 smears 800: 2 smears

400: 3 smears 400: 3 smears 1000: 4 smears 400, 800: 3 smears 600: 4 smears 400: 2 bands, 2 smears 1000: 4 smears 400, 600: 4 smears 400: 3 smears 800: 2 smears

800: 3 smears

400: 4 smears

1000: 4 smears

400: 4 smears

1000: 4 smears

400: 2 smears

No bands or smears No bands or smears 400: 1 smear 600, 800, 1000: 4 smears

400: 4 smears 600: 1 smear 400: 4 smears 400, 600, 1000: 4 smears

1000: 4 smears

400: 4 smears 800: 4 bands

400: 1 smear 1000: 3 smears

400: 1 smears

1000: 4 smears

400: 3 smears

1000: 4 smears

400: 3 smears

1000: 4 smears

400: 2 smears

1000: 4 smears

400: 2 smears

1000: 4 smears

400: 2 smears


104


Protocol ID


DNA Yield (g/mL)

DNA Purity

1 mm3 – 106.1 3 mm3 – 322.7 1 mm3 – 22.5 3 mm3 – 6.0 1 mm3 – 32.5 3 mm3 – 20.6

1 mm3 – 0.59 3 mm3 – 0.65 1 mm3 – 1.5 3 mm3 – 1.62 1 mm3 – 1.48 3 mm3 – 1.53

18

1 mm3 – 226.4 3 mm3 – 14.1

19



Sequence Lengths (base pairs): Successful PCR Test(s) 1000: 4 smears

400, 800: 4 smears

1000: 4 smears

400: 3 smears

1000: 4 smears

400, 1000: 4 smears

1 mm3 – 1.15 3 mm3 – 1.04

400: 3 smears 600, 800: 4 smears

400: 4 bands 600, 800: 4 smears

1 mm3 – 14.8 3 mm3 – 52.4

1 mm3 – 1.41 3 mm3 – 1.73

400: 4 bands 1000: 4 smears

20

1 mm3 – 858.2 3 mm3 – 375.6

1 mm3 – 0.43 3 mm3 – 0.59

21

1 mm3 – 14.1 3 mm3 – 32.0

1 mm3 – 1.88 3 mm3 – 1.64

400: 4 bands 600: 1 smear 1000: 4 smears No bands or smears

22

1 mm3 – 147.0 3 mm3 – 435.2

1 mm3 – 28.27 3 mm3 – 22.2


24

1 mm3 – 21.8 3 mm3 – 55.8

1 mm3 – 2.12 3 mm3 – 1.95

1 mm3 – 314.6 3 mm3 – 800.0 1 mm3 – 154.6 3 mm3 – 557.0 1 mm3 – 104.7 3 mm3 – 342.4 1 mm3 – 1365.5 3 mm3 – 815.6 1 mm3 – 8.8 3 mm3 – 74.6 1 mm3 – 257.8 3 mm3 – 632.0 1 mm3 – 5.9 3 mm3 – 936.0 1 mm3 – 6.2 3 mm3 – 4.4 1 mm3 – 7.4 3 mm3 – 22.9

1 mm3 – 0.83 3 mm3 – 0.88 1 mm3 – 1.42 3 mm3 – 1.03 1 mm3 – 1.75 3 mm3 – 1.11

400: 3 bands, 1 smear 1000: 4 smears 400: 4 bands 1000: 4 smears

16 17q (short) 17l (long)

25 26 27 28 29 30 31 32 33 34 35 36 37

400: 4 smears No bands or smears

1 mm3 – 51.72 3 mm3 – 58.26

400: 4 smears 1000: 4 smears

1 mm3 – 2.2 3 mm3 – 1.68 1 mm3 – 2.28 3 mm3 – 1.32 1 mm3 – 1.31 3 mm3 – 1.42 1 mm3 – 2.70 3 mm3 – 7.33 1 mm3 – 1.17 3 mm3 – 1.43

400: 4 bands 1000: 4 smears No bands or smears 400: 3 smears 1000: 4 smears 400: 4 bands 1000: 4 smears 400: 4 bands 1000: 4 smears

1 mm3 – 11.4 3 mm3 – 166.5

1 mm3 – 1.43 3 mm3 – 1.49


1 mm3 – 42.6 3 mm3 – 25.6 1 mm3 – 21.2 3 mm3 – 26.5 1 mm3 – 14.1 3 mm3 – 4.0

1 mm3 – 1.53 3 mm3 – 1.5 1 mm3 – 1.57 3 mm3 – 1.67 1 mm3 – 1.32 3 mm3 – 1.18

400: 4 bands 400: 4 bands 1000: 4 smears 400: 4 bands 1000: 1 smear

400: 4 bands 600: 4 smears 800: 1 band 400: 4 bands 600, 800, 1000: 4 smears 400: 4 bands 600: 3 smears 400: 1 band, 3 smears 800: 1 smear 400: 4 bands 400: 4 bands 600: 2 smears 400: 4 smears 1000: 3 smears 400, 1000: 4 smears 400: 1 band, 2 smears 600: 1 smear 400: 1 band, 3 smears 1000: 4 smears 400: 4 smears 400: 4 bands 400: 4 bands 400: 4 bands 600: 4 smears 800: 1 smear 400: 4 bands 1000: 1 smear 400: 4 bands 800: 4 smears 400: 4 bands


105

Table 3.5. Continued. Protocol ID

38a (autoclave) 38b (heat block) 39


DNA Yield (g/mL)

DNA Purity

1 mm3 – 124.5 3 mm3 – 495.2 1 mm3 – 3.7 3 mm3 – 21.7 1 mm3 – 7.2 3 mm3 – 19.8

1 mm3 – 0.88 3 mm3 – 1.00 1 mm3 – 1.48 3 mm3 – 1.62 1 mm3 – 1.16 3 mm3 – 1.42



Sequence Lengths (base pairs): Successful PCR Test(s) 400: 4 bands

400: 3 bands

Not Tested

Not Tested

No bands or smears

No bands or smears

comparisons between non-rehydrated extracts, it is likely that these nine extracts had higher original concentrations and showed a similar pattern of tissue size-dependent DNA yields. Comparative DNA yields and purities from three final protocols tested (along with two previous reference protocols) are listed in Table 3.6, while Figure 3.5 shows the results of the three final and two reference protocols immediately after extraction. Of these final methods trialled, protocol 42 (Invitrogen ChargeSwitch® kit) produced the best results.

PCR success was affected by the size of the targeted sequence length and the amount of time between extraction finish and PCR onset. Although all primer pairs produced at least some smearing, clear bands were produced 51 times (13 protocols) at the 350 base pair size immediately after extraction, 56 times (17 protocols) at the 350 base pair size two months after extraction, once at the 800 base pair size two months after extraction, and never at the 550 and 900 base pair sizes (Table 3.2). As the primer pairs involved work strongly with fresh tissue, it is unlikely that these results are influenced by the compatibility of primer pairs, but rather the condition of the DNA involved. A sample image of successful PCR banding is presented in Figure 3.6.


106

Table 3.6. Comparison of three final (Appendix VI: protocols 40, 41, and 42) and two reference (Appendix VI: protocols 3a and 18) DNA extraction protocols as determined by UV spectrometry (DNA yield and purity immediately after extraction).

Protocol 3a 18 40 41 42

DNA Yield (g/mL) AM ANWC MV 1109.6 1037.7 842.4 494.5 889.8 413.2 11.4 92.4 41.6 0 0 0 17.1 16.5 12.7

AM 1.26 0.86 1.15 N/A 2.55

DNA Purity ANWC 1.34 1.11 1.45 N/A 2.39

MV 1.57 0.97 1.22 N/A 2.95

Figure 3.5. Images of ethidium bromide stains of DNA extracts (taken immediately after extraction) run electrophoretically through a one percent agarose gel. Extracts consist of two reference (3a and 18) and three final (40, 41, and 42) protocols. Alphanumerical codes are as follows: L = one kilobyte DNA ladder (GeneRuler®, Fermentas); E = empty well; a = Australian Museum; w = Australian National Wildlife Collection; v = Museum Victoria; and numbers = DNA extraction methods (as described in Appendix VI). Each lane per protocol represents one extraction from approximately 3 mm3 of tissue. Each lane contains 5 L of extract.

LE

29

30

31

32

33

34

E

1000 bp 750 bp 500 bp 250 bp primer dimer

Figure 3.6. Sample image of successful PCR products after an electrophoresis run through an ethidium bromide stained, one percent agarose gel. Alphanumerical codes are as follows: L = one kilobyte DNA ladder (GeneRuler®, Fermentas); 0 = empty well; and 29–34 = DNA extraction methods.

Figure 3.7. Sample comparison of selected PCR additives. Image is of PCR products photographed after an electrophoresis run through an ethidium bromide stained, one percent agarose gel. Alphabetical codes are as follows: L = one kilobyte DNA ladder (GeneRuler®, Fermentas); None = no additives; BSA = bovine serum albumin; DTT = dithiothreitol; B+D = BSA and DTT both present; and DMSO = dimethyl sulfoxide.

PCR banding was sometimes helped with the presence of certain additives to the PCR mix (Figure 3.7). Smearing was typically reduced and bands appeared sharper with the addition of 1% BSA, 1% DTT, or a combination of the two additives. Smearing usually increased or PCRs were inhibited with the addition of higher concentrations of BSA or DTT, or any concentration of DMSO or glycerol. Additional tests of DNA extracts from


108

museum Pseudonaja tissues also showed that the addition of 1% BSA or 1% DTT would sometimes allow the amplification of sequences within PCRs (and formation of bands in subsequent agarose gels) which had previously proven unsuccessful during previous PCRs (and fluorescent checks under UV lighting).

Results were equivocal for PCRs which were conducted using specialty products, such as Restorase® (Sigma-Aldrich), PCR Optimizer® kit (Invitrogen), and PreCR® repair mix (New England BioLabs), that have been shown to be able to help repair damage to DNA and increase the success rate of PCRs (Moore 2005, Rohland and Hofreiter 2007, Schill 2007, Skage and Schander 2007). In all tests of these materials, the success of the PCR was not dependent on the ingredients of the PCR mix. If a PCR had worked under normal conditions, further PCRs worked using the specialty ingredients. Unsuccessful PCRs were not improved using specialty products.

Upon sequencing of successful PCRs, all methods returned similar sequences except for those originating from protocol 36. Corresponding sequences matched most closely with Boiga dendrophila (GenBank: U49303.1); there were no Boiga irregularis ND4 sequences lodged with GenBank to match. Sequences from protocol 36, the Extract-nAmp® kit (Sigma-Aldrich), returned several matches for Bos taurus (European cow), the source of material used to make BSA. After contacting Sigma-Aldrich, technical support disclosed that BSA is one of the Extract-n-Amp® kit ingredients and asserted that Bos taurus contamination was introduced during testing or arose from the lab facilities, not the kit itself. This claim is doubtful for several reasons: 1) no BSA had been added to the PCR (such as with the tests of PCR additives); 2) no work on Bos taurus was undertaken in the lab and building used for these tests; 3) subsequent tests of the Extract-n-Amp® kit returned the same results (banding patterns, BLAST species designation) even after extractions were conducted in separate laboratory rooms not known to have ever housed BSA or had BSA present for laboratory work; and 4) after tests of other extraction protocols with the PCR additive BSA, no sequenced PCR products resulted in BLAST matches of Bos taurus. Thus, the source of the BSA contamination was most likely the particular kit used. Final, confirmatory testing of some of the more promising and successful protocols was undertaken using archival Pseudonaja specimens. Fresh tissue from these snakes either had been previously sequenced as part of this thesis or by Skinner et al. (2003) and lodged with GenBank.


109

Fragments successfully derived from FFT and sequenced returned matching, correct species identifications from GenBank (see Chapter 4 for full results from Pseudonaja specimens).

Discussion

When evaluating the efficacy of published protocols and modifications, success can be measured in a variety of ways. At the most basic level, any method that produces bands on an agarose gel after a PCR would be considered successful (as with the protocols trialled in this study, according to their published results), leaving it to subsequent researchers to determine how consistently successful a protocol actually is. However, most researchers determine success by first evaluating their extractions on an agarose gel prior to any PCR. If the extraction does not produce any visible fluorescence or does not fluoresce in the size range necessary for amplification, many researchers do not proceed with a subsequent PCR. Although it has been shown that a lack of extraction fluorescence does not necessarily mean a lack of extract, re-extracting is usually more cost-effective than re-running a number of potentially negative PCRs (DumolinLapègue et al. 1999, van Beers et al. 2006, personal observation). In the end, the final choice(s) between equivalently-successful protocols may come from the evaluation of time and monetary costs of each technique, where quick and inexpensive protocols are considered most advantageous.

Each of the 47 methods (41 techniques and 6 modifications) chosen for analysis can be broadly categorised by one or more procedural steps deemed necessary to successfully extract DNA from FFT (i.e., application of heat to unbind DNA, DNA separation through magnetic attraction, or direct degradation of tissue to release DNA). Most of these broad categories showed at least some success in releasing DNA from the original cellular matrix, but as can be seen in Figures 3.2–3.5, not every method was successful and the length of extracted DNA varied. In tests of extraction success, seven methods produced a modal fluorescence > 650 base pairs in every extract test of tissue size and time since extraction (protocols 3a, 3b, 9, 18, 25, 36, and 42), and another five methods did so in most tests (protocols 20, 26, 27, 30, and 38a). With the exception of protocol 42 (magnetic attraction of DNA molecules), each of these protocols contained an extraction step whereby the tissue was heated in solution at temperatures equal or


110

greater to 90° C. Heating to high temperatures is assumed to allow the breakage of incompatible DNA cross-links (such as between DNA and proteins) formed during the fixation process and may facilitate the reformation of properly-placed DNA-DNA bonds as the extraction solution cools (Shi et al. 1997, Boenisch 2005). But even after breaking DNA cross-links through the addition of a high heat step, five of these twelve methods did not result in successful PCRs (protocols 3b, 9, 26, 27, and 30).

Trends were evident when comparing differential PCR success (Tables 3.2 and 3.5). Nineteen techniques which heated tissues, subjected tissues to long wash or digestion steps, or which relied upon magnetic attraction of DNA particles tended to produce successful PCRs (indicated by the presence of distinct bands of targeted sequence length when viewed in agarose gels; Figure 3.6). The advantages of high temperature heat extractions were listed above, while long washes (often with a change of buffer solution) allow the thorough dilution of deleterious chemicals from the mix as well as longer times for cellular matrix and protein dissolution (Díaz-Cano and Brady 1997). Protocols without those characteristics, such as most pre-packaged kits, produced less successful results (empty wells, sole production of primer dimer, or DNA smears). Of the nineteen methods mentioned above, ten produced PCR bands despite showing no extract fluorescence and three showed PCR success two months after initial PCR failures, indicating the need for replication and that extract gels should not be the sole judge of protocol success. The PCR successes of protocols involving high temperatures and long washes or digestions may indicate that the two biggest problems facing FFT are DNA (cross-)linkages and the presence of PCR-disrupting chemicals.

For achieving successful PCRs, polymerases and other specialty products specifically described as being appropriate for use with FFT performed no better than normal polymerases and PCR protocols. Either specialty ingredients are unnecessary for normal use with FFT or the extractions tested here were not affected by or treatable for conditions fixable by specialty ingredients. Specialty polymerases may be appropriate as a last result or when there has been demonstrated depurination or depyrimidation, due to their proofreading ability (Moore 2005, Gilbert and Willerslev 2007). Their functionality, however, does not extend to the repair of double strand breaks, DNA cross-linkage, or PCR-disrupting chemicals (Moore 2005, Gilbert and Willerslev 2007). But this study has shown problematic chemicals carried over into PCRs and sequencing


111

reactions may be neutralised in the presence of BSA, DTT, or a combination of both. Additives may bind to substances which may inhibit PCRs, reduce secondary structure formation, or improve the specificity of PCR reactions (Pääbo et al. 1988, Varadaraj and Skinner 1994, Nagai et al. 1998, Ralser et al. 2006, Rohland and Hofreiter 2007). Initial PCR failure of extracts from important specimens should not preclude a second attempt which includes BSA or DTT.

Success or failure may also depend on the size of sampled tissue. The results presented here clearly show that larger amounts of FFT tissue greatly increases the chances of successful extraction and amplification of DNA. More tissue equates to more DNA, which equates to a greater likelihood of recovering an undamaged piece of DNA of the appropriate length. Success can also be optimised with careful selection of primer pairs. When dealing with DNA extracted from FFT, PCR success is inversely proportional to the size of the fragment to be amplified or the age of the tissue since fixation (Table 3.5, Chapter 4: Figures 4.14 and 4.15; Pavelić et al. 1996, Coombs et al. 1999, Zimmermann et al. 2008, Lin et al. 2009).

As can be determined by the above paragraphs, there is no single solution—no one-sizefits-all method—that will work on all archival material. The sheer numbers of protocols (or modifications thereof) which document how to successfully recover DNA from FFT may not always be a testament to the bona fides of each particular method, but rather to the power of exponential growth (and luck). Successful amplification of a single, appropriate DNA fragment through a PCR of 40 cycles can yield nearly 1.1 trillion copies of the original sequence (Hunt 2008). Given the millions of copies of mitochondria present in an organism, statistically there may be at least a few copies of long-length, high-quality DNA available, even after fixation and long-term storage (this is the principle behind protocol 6). Targeting mitochondrial-rich tissue for extractions could also further improve the chances of a successful PCR (Robin and Wong 1988, Friedman and DeSalle 2008). Discussing this issue with other researchers has led to a generalised (but untested) observation: for every 25 PCRs of DNA extractions from FFT of the same individual (extracted organically as from fresh tissue—similar to protocol 37), a researcher may obtain one successful, often weak PCR amplification (sometimes up to four) of medium- to long-length sequences (~600+ base pairs). The


112

time and money involved to pursue this strategy, however, would be unacceptable to most researchers.

Given the potential rarity of obtaining high quality DNA from FFT, geneticists must be vigilant to avoid mistakenly amplifying contaminants (Pompanon et al. 2005, Siddall et al. 2009). In this study, the only identified contaminant came from a highly unrelated taxon (European cow), making the contamination easy to detect. However, contamination by conspecific study material would have been harder to identify. This study minimised the possibility of contamination at each step of the laboratory process. This was accomplished through the use of separate, dedicated areas for extraction and amplification, thorough cleaning (including bleach and alcohol scrubs) or autoclaving of work areas and equipment between analyses, varying the workspace areas and start times for each method, the inclusion of positive and negative controls in all PCR reactions, and the replication of results. Chapter 4—a phylogenetic analysis of Oxyuranus and Pseudonaja—also documents a geographic control to minimise the chances of contamination and the problems of base substitutions due to formalin fixation. Perhaps the quality of DNA normally obtained from FFT—low—is itself one assurance that other DNA sources do not normally contaminate amplifications.

One potential way in which to maximise the chances of selecting long-length, highquality FFT-DNA is neither an extraction method nor an enhancement method (Appendix VI: protocol 23). In short, extracts (from whichever method one chooses) are passed through an ionic high performance liquid chromatography (HLPC) column, similar in principle to the usage of agarose gels (Inadome and Noguchi 2003). DNA passes through the HLPC column at different speeds; these speeds are dependent on the length or charge of a fragment. Sequence lengths and column flow times are first calibrated by analysing a known substance (such as a DNA ladder) and determined by examination of the graphical output (two-dimensional charts showing the time of column flow [x-axis] and sequence lengths [peaks on the y-axis]). A micro-array of sterile tubes are set up to collect the extract outputs and are rotated at regular time intervals. As these outputs are collated for sequence length, a researcher can simply choose the appropriate (or largest) sequence length by comparing the time of output with reference sample lengths and output times. Coupled with an extraction protocol which includes a high heat step, HPLC sorting may enable a researcher the greatest


113

chance of success from a single PCR from archival material. The costs for columns are expensive (typically over $1,000US), especially if one only has a few extractions to filter and sort. However, the cost of the column equates to only an additional ~1–2$AU per extract if the column is used to its full capacity. Relative costs may actually be lowered if HPLC use reduces the total number of PCRs which are performed. It is hoped that this method can be trialled before a final manuscript of this chapter is submitted for publication and subsequently used with type material extracts.

As with the HPLC technique and the antigen retrieval method (inclusion of a high heat step), many of the discussions, testing of ideas, and leading research on FFT originated from within the medical community (Inadome and Noguchi 2003, Shi et al. 2004). Micro-slices of tissue (such as tumours) are routinely kept for later analyses or diagnoses. These tissues are often fixed in formalin (as with museum specimens) and are then not placed in ethyl alcohol, but embedded in paraffin for further storage (unlike with museum specimens). Although archival tissues (whether held by museums or medical facilities) may be stored for decades, published medical literature on DNA extraction from FFT shows that many of the experiments come from tests which involve unrealistic time scales and sets of circumstances, at least when compared to material donated to and collected by museums. In these methodological reports, fresh material is often fixed for less than 48 hours, stored for only a couple of days or months, and PCRs are conducted using small-length amplicons, typically 200–400 base pairs (or less). These conditions may be realistic for the way in which the medical research community uses genetic and biological material. However, as has been shown, archival problems accumulate through time and may be difficult to reverse, especially for fixation times greater than 48 hours. If the quality of DNA extracted soon after fixation is nearly as useful as DNA extracted from fresh tissue, meaningful interpretation of some previously published research could only come after replicating experiments on tissue stored for much longer period of time (such as with this study). Similarly, nearly all relevant research cited in this chapter shows that there are more copies of short DNA fragments in archival specimens and that subsequent PCRs are more likely to work if they target short sequences which could then be joined together after sequencing. Future research should perhaps test and seek to optimise methods which could enable the extraction and amplification of longer DNA strands. Unless proponents of DNA barcoding (the identification of taxa via analysis of short fragments on the COI gene)


114

are able to gain widespread support for their cause, phylogenetic research will continue to require long sequences for meaningful interpretation of results (Hebert et al. 2003a, Hebert et al. 2003b, Smith et al. 2008, Waugh et al. 2008).

Until a universal solution is discovered, researchers should try several techniques before giving up on a particular specimen as a source of DNA. This study (and additional results from Chapter 4) has shown that several techniques are promising for use in taxonomic research, either to salvage DNA that previously could not be extracted or to recover longer-length DNA sequences. In-house further testing of successful methods which were quick and easy to carry out (Appendix VI: protocols 3a, 18, 42) showed these methods were able to work with a variety of archival material (fish, snakes, avian and reptile eggs, adult and larval crustaceans), tissues (throat, fin, integument, locomotive muscle, outer scales, whole organisms, etc.), tissue ages (trialled up to 90 years past fixation, though most successes came from tissues stored 15–50 years; see Chapter 4: Figure 4.15), and genes (mitochondrial, nuclear, ribosomal; 16S, CMOS, CO1, ND4;  1000 base pairs, though most successes came from sequence lengths of 350–550 base pairs; see Chapter 4: Figure 4.14). Yet even the most successful techniques are not perfect. Due to the numerous problems associated with FFT and the specific benefits associated with different FFT-DNA extraction methods, one protocol (or additive) may work on a particular tissue while another does not. Additionally, some successful extraction methods may leave behind undigested tissue, chemicals, and cross-linked DNA, all of which can lead to unreliable spectrometer readings (as some of the DNA yield and purity scores show in Table 3.5). If DNA yields have been overestimated and are used to optimise PCR mixtures, the PCR may fail as too much DNA template (> 1 g/100 L reaction volume) may inhibit PCRs (Savioz et al. 1997). Too much DNA is typically not a problem with archival material, but inaccurate estimates of DNA concentration may cause a researcher to mistakenly dilute or concentrate their PCR mixtures. Scientists working with FFT must be more vigilant and careful in their research as compared to those working solely with fresh tissue.

Pragmatically, the need for increased vigilance or the possibility of a higher workload does not mean a project should be avoided, nor should it mean that the research design be configured only to collect and publish partial results (such as those obtained from analyses only of fresh tissue). Museums and natural history collections contain a


115

substantial amount of genetic material that should be utilised whenever possible. Scientists can streamline their research and minimise many of the difficulties associated with working with FFT by pre-emptively exploring museum databases in order to choose specimens lodged most recently. Issues arising from older or more problematic tissue may be mitigated by designing internal primers for the gene(s) of interest (thereby reducing amplicon lengths), employing an extraction method which includes a high heat or long wash and digestion step, and including PCR additives as necessary. These practices were successfully used for a large-scale, phylogenetic analysis of Oxyuranus and Pseudonaja (Chapter 4). Despite difficulties associated with FFT, archival material available in museums and natural history collections should not be overlooked for use in genetic studies of evolutionary patterns and processes.

CHAPTER 4 – ARE BROWN SNAKES MONOPHYLETIC? A NEW EXAMINATION OF THE EVOLUTIONARY RELATIONSHIPS OF BROWN SNAKES (PSEUDONAJA) AND TAIPANS (OXYURANUS) USING MAXIMUM PARSIMONY, MAXIMUM LIKELIHOOD, AND BAYESIAN ANALYSES OF MITOCHONDRIAL DATA

Abstract

It has been suggested that the systematics of Australian Elapidae (Reptilia: Serpentes) have advanced primarily due to the phylogenetic analyses of molecular data since the late 1990s. Since that time, there have been six molecular investigations of the phylogenies of Pseudonaja and Oxyuranus snakes, and many of the results taken from these studies confirm or resolve earlier taxonomies presented elsewhere in morphological studies and field guides. However, some species- and generic-level relationships still show conflict in published results, perhaps due to research designs which relied on low numbers of snakes opportunistically selected from limited geographic areas. The systematic sampling regime documented in Chapter 2 as having worked successfully with morphological analyses was modified for use with molecular analyses. Presented here are the results of phylogenetic analyses of mitochondrial DNA sequences extracted from tissue of formalin-fixed museum samples, extracted from tissue of live or recently deceased snakes, and available on the internet as part of past molecular studies, the sum of which are taken from throughout the full distribution of each taxon. In contrast with most of the six previous molecular investigations, Pseudonaja was found to be paraphyletic for all analyses of full-length sequences. Pseudonaja modesta was congeneric with Oxyuranus using Maximum Parsimony analyses, or the sister group to all other ingroup taxa using Maximum Likelihood and Bayesian analyses. Although high levels of support for splitting Pseudonaja were recovered in these new analyses, the systematics of Oxyuranus and Pseudonaja are not likely to be completely resolved without additional supporting data, such as nuclear sequences or morphological measures.

Keywords: Bayesian, Maximum Likelihood and Parsimony, Oxyuranus, Pseudonaja.

Chapter 4: Genetic Analyses

117

Introduction

It has been suggested that the systematics of Australian Elapidae (Reptilia: Serpentes) have advanced primarily due to the phylogenetic analyses of molecular data since 1998 (Doughty et al. 2007). Though this idea may be acceptable in its broadest sense, it does not apply equally to all elapid genera within Australia. There have been six molecular investigations of the phylogenies of Pseudonaja and Oxyuranus snakes, most of which were undertaken prior to 1998 or which did not focus solely on the species-level relationships within these genera. This past body of research includes the accumulated works of Greg Mengden (including [Covacevich et al.] 1980, 1982, 1985a, 1985b) on Australian elapid karyomorphs, a phylogenetic investigation of Australian-Papuan snakes by Scott Keogh et al. (1998), a more specific phylogenetic analysis of Australasian snakes by Wolfgang Wüster et al. (2005), Adam Skinner‘s work on Pseudonaja (2003, [Skinner et al.] 2005), the description of a new species of taipan by Paul Doughty et al. (2007), and a report on the origin of Pseudonaja textilis by David Williams et al. (2008). Many of the results taken from Oxyuranus and Pseudonaja molecular research confirm or resolve earlier taxonomies presented elsewhere in morphological studies and field guides. However, there also has been conflict in the species- and generic-level relationships presented in these molecular studies. This could be due to the low number of specimens chosen for inclusion within each of these studies, often due to research designs which relied on the opportunistic selection of snakes for study (see below). As Doughty et al. (2007) did not document how or if the understanding of Australian elapid taxonomic relationships had advanced due to the use of molecular analyses, it is beneficial to explicitly review past phylogenetic work on Pseudonaja and Oxyuranus to assess published systematic results and to determine where future research is needed. Mengden – In the first molecular studies of taipans, Covacevich et al. (1980) and Mengden (1982) looked at the karyomorphs of Oxyuranus microlepidotus and O. scutellatus, finding that both had the same diploid number and general chromosomal morphology, and that small differences in at least one centromere position were sufficient to differentiate the two species. Although different banding techniques were used in the two studies and returned the same general results, each study lacked sufficient numbers of samples overall and within each gender, a general problem first


118

mentioned by Covacevich et al. (1980). Mengden (1982) additionally confirmed that taipan and brown snake karyomorphs could be separated into two natural groups, providing further evidence for their generic separation.

Of the brown snakes, Mengden (1982) noted that Pseudonaja displayed the most variable chromosome number and species-specific chromosomal variation of any Australian elapid genus, that the three potential P. textilis species proposed by Gillam in 1979 possessed a single, typical karyomorph, and that a more thorough (genetic) survey of multiple colour morphs from multiple locations was needed for P. affinis and P. nuchalis. Indeed, for the latter species, Mengden (1982) stated that further ―cytological data may well be of considerable importance in detecting distinct forms within species that appear, on overview, to be too variable and complex to delimit by conventional taxonomic procedures.‖ In the same volume, however, he also noted that the ―lability of sex chromosome morphology and composition implies that they are not likely to be of much value as markers of phylogenetic differentiation.‖ Nevertheless, Mengden summarised that the multiple karyomorphs attributable to P. nuchalis would ultimately prove to be derived from distinct species, distinguishable by external morphology. Mengden (1982) did not have banding data for P. modesta, but noted that four of their sixteen macrochromosomes differed from other Pseudonaja with the same diploid number (P. guttata, P. inframacula, and P. ingrami). This diploid number and arrangement (36: 16 macro and 20 microchromosomes) is also shared by Oxyuranus, and though Mengden (1982) did not draw parallels between the two groups, several of the first eight macrochromosomes were identically described.

In an update and expansion upon his earlier work, Mengden (1985a) rejected (on the basis of karyomorphic data) the suggestion by Wallach (1985) that P. modesta may be a member of Hemiaspis. In the same paper, Mengden (1985a) also presented electrophoretic analyses of multiple loci which, unfortunately, did not include P. inframacula, P. ingrami, or P. modesta. The results from these analyses showed that P. guttata possessed the greatest genetic distance from all other Pseudonaja (regardless of the method used to analyse the data), and was potentially ancestral to Oxyuranus (depending on analysis method). Finally, Mengden (1985a) stated that P. textilis was chromosomally consistent throughout its range, P. inframacula was genetically distinct from P. textilis and should be recognised as a distinct species, and that P. nuchalis was


119

composite. Within P. nuchalis, Mengden (1985a) defined seven karyomorphs which correlated to adult morphological patterns and stated that there were at least four taxa (three distinct species and one composite species) within P. nuchalis. Mengden also discussed results from hybridisation experiments. Mengden‘s accumulated works, containing observations on and interpretations of Pseudonaja, continue to be some of the best references on Pseudonaja taxonomy. His 1985(a) manuscript called for the morphological and genetic examination of Pseudonaja from all museum collections, further hybridisation experiments, and the raising (and analysis) of young from females of each colour morph. Mengden (1985a) finished with, ―Until such [a multidisciplinary] approach is realised, the current practice of erecting or resurrecting names can only be judged premature.‖ Keogh – In 1998, Keogh et al. observed that the phylogenetic relationships between Australian-Papuan snakes were poorly resolved, despite several diverse data sets (internal and external morphology, karyotypes and allozymes, immunological distances, and ecology) investigating these relationships. Keogh et al. (1998) sampled sequences of 290 base pairs from the cytochrome b gene and sequences of 490 base pairs of the 16S rRNA gene from no more than two specimens of the same species from each of the then-recognised 27 genera of Australian-Papuan elapid snakes. Only eight of the 27 genera had samples from all species associated with a particular genus (seven of these eight genera contained a single species, the eighth contained two species). Paired samples were originally tested for intraspecific variation and, if found to be negligible, only one sample was included per species in the final phylogenetic analysis. Most pairs of snakes from each species came from the same (or nearby) localities and samples taken from 25 of the 27 genera showed little or no intraspecific variation. One taipan (O. microlepidotus) and two brown snake (P. modesta and P. textilis) specimens were included in the final analyses. Results differed depending on weightings applied to the variability assigned to the third position base pair of codons. If transversions (substitutions of a purine base [A or G] for a pyrimidine base [C or T] or vice versa) were assumed to be equal to transitions (substitutions of one purine base for the other or substitutions of one pyrimidine base for the other), P. modesta shared a common ancestor with O. microlepidotus, and that clade with P. textilis. If the third base pair of a codon was excluded from analysis or was weighted as undergoing transversion only, then the two brown snakes were most closely related to each other, and that clade to O.


120

microlepidotus. Keogh et al. (1998) conservatively summarised that O. microlepidotus, P. modesta, and P. textilis all shared a single, common ancestor (and that interspecific and intraspecific relationships could not be completely resolved). Skinner – In terms of number of samples, the largest molecular investigations of Pseudonaja have been those of Skinner (2003) and Skinner et al. (2005). Skinner‘s Master of Science thesis (2003) compared mitochondrial DNA sequences (~647 base pairs of the ND4 gene and ~123 base pairs of the adjacent His and Ser tRNA genes), and external morphology in an attempt to confirm the taxonomic status of Pseudonaja affinis, P. guttata, P. inframacula, P. modesta, P. nuchalis (including many of the variants described in Gillam [1979]), and P. textilis. These analyses were supplemented by an examination of allozyme and karyomorph data from a small subsample of specimens. Skinner et al. (2005) is an expanded presentation of the molecular analyses and results contained in Skinner (2003), adding P. ingrami and several more individuals to the overall sample size. Skinner et al. (2005) presented parsimony and Bayesian analyses, and the resulting consensus trees from both analyses show equivalent phylogenetic relationships of all species. However, the strength of clade support differed greatly between analysis methods (parsimony: 4 nodes < 50%, 1 node < 60%, and 3 nodes > 90%; Bayesian: 2 nodes < 70%, 2 nodes < 90%, and 4 nodes > 90%). Though using newer techniques and a larger sample size (in some species) than Mengden (1982, 1985a), the results from both manuscripts (Skinner 2003, Skinner et al. 2005) are similar to those of Mengden (1982, 1985a), thereby providing increased stability for the most widely recognised species of Pseudonaja. For example, all four works discuss the chromosomal uniformity of P. textilis, the existence of at least three species within the P. nuchalis complex, the need for better diagnoses of species, and the need for further research to provide a definitive Pseudonaja taxonomy. Wüster – Wüster et al. (2005) investigated the phylogenetic relationships of three elapid genera (Acanthophis, Oxyuranus, and Pseudechis) with distributions in Australia and Papua New Guinea. Three specimens of Oxyuranus scutellatus were chosen for analysis based on their availability in captive Australian or European collections. Though one specimen was originally captured in Australia and the other two in Papua New Guinea, all three snakes possessed identical sequences (671 base pairs from the cytochrome b gene and 648 base pairs of the ND4 gene). Wüster et al. (2005) suggested these


121

similarities were due to a recent genetic exchange between Australian and Papuan populations of Oxyuranus, with Australia being the most likely origin of Oxyuranus. Doughty – Doughty et al. (2007) described a third species of taipan, Oxyuranus temporalis, based on morphological and mitochondrial characters (sequences of 772 base pairs of the ND4 gene and adjacent His and Ser tRNA genes) collected from a single snake found in central-eastern Western Australia. Some of the sequences used by Skinner (2005) were included within the molecular Bayesian analyses of Doughty et al. (2007), along with new, additional specimens of O. microlepidotus and O. scutellatus. Due to the geographic location of its discovery and the converging morphological characters present on the holotype, Doughty et al. (2007) discuss the possibility that O. temporalis may be a hybrid between Pseudonaja and Oxyuranus parents. Due primarily to the strength of their molecular results, the authors reject the hybridisation hypothesis, despite the fact that analysis solely of mitochondrial DNA (which is maternally inherited) cannot provide information which would conclusively reject this hypothesis. Of other import, Pseudonaja modesta grouped within the Oxyuranus clade, not the Pseudonaja clade. Though the authors do not discuss this result, it contradicts the results of Skinner (2003, [et al.] 2005) who successfully used Oxyuranus as an outgroup (along with Pseudechis) to Pseudonaja modesta (and other Pseudonaja). Williams – In an analysis similar to that of Wüster et al. (2005), Williams et al. (2008) investigated the dispersal of Pseudonaja textilis to and from Australia and Papua New Guinea using sequences of 767 base pairs from the ND4 gene and adjacent His and Ser tRNA genes. Some of the sequences used by Skinner et al. (2005) were included within the molecular analyses of Williams et al. (2008), along with six new specimens of P. textilis. Outgroups included for analysis were only other species of Pseudonaja (affinis, inframacula, and ingrami). From their results, Williams et al. (2008) inferred that colonisation events of Papua New Guinea occurred from the Northern Territory and Queensland, that these colonisations took place when sea levels were much lower and allowed over-land movement (that is, not due to human introductions viâ ships or aeroplanes as had been hypothesised in Slater [1968]), and that the taxonomic status of P. textilis from Papua New Guinea is still unresolved. Williams et al. (2008) conclude that final taxonomic resolution for P. textilis would require a comprehensive


122

methodological approach which utilised morphological analyses along with molecular analyses.

There are six general conclusions that can be drawn from the works summarised above, especially amongst those studies with similar taxa analysed: 1) brown snakes and taipans are closely related; 2) the status of generic relationships is unresolved; 3) the number of existing species is unclear; 4) sample sizes may have been too low for meaningful analysis (Table 4.1); 5) geographic selection of specimens included for analysis was incomplete when compared with the full distribution of each species (Figure 4.1); and 6) as no explanations were given for the choice of subsamples, specimens included within past analyses appear to have been chosen due to their availability and convenience, rather than optimised to best answer the questions posed within each manuscript (that is, they have used an unordered subset of the total available fresh genetic material, itself a small subset of all available genetic material). Because of these issues, one may doubt parts or all of the taxonomic relationships previously published, speculate about the full distributions of each phylogenetic clade resolved, and hypothesise if there are other taxa present yet to be sampled. This chapter presents the results of phylogenetic analyses of DNA sequences extracted from tissue of formalin-fixed museum samples, extracted from tissue of live or recently deceased snakes, and available on the internet as part of past molecular studies (see above), the sum of which are taken from throughout the full distribution of each taxon. These techniques, along with a systematic, grid-based approach to sampling, allowed examination to see if ‗consistent‘ phylogenetic signal was present within smaller fragment lengths (‗consistent‘ being defined both as having the same individuals present within each clade and as having the same relationships between clades), to determine the core geographical extent of each clade, and to discover whether additional clades existed from areas not sampled in previous studies.

Materials and Methods Selection of Specimens – The sampling regime for selection of snakes described in Chapter 2 was modified for use in selecting snakes to be used in genetic analyses. Relevant changes are described here. Ten species (Oxyuranus microlepidotus, O.


123

Table 4.1. A summary of phylogenetic studies (with sample sizes) involving Oxyuranus and Pseudonaja. The geographic distributions of ingroup samples from each study are shown in Figure 4.1. The sample sizes listed in this table include all full-length sequences and informative fragments. Values listed in columns summarising several publications by one author (listed as ―Various‖) are the total numbers of sequences used overall; individual studies by these authors utilised reduced sample sizes. Numbers in parentheses in the final column are the numbers of specimens of each taxonomic group new to this study. Samples used for this chapter are detailed in Appendices X and XI.

Study (right) Keogh Wüster Doughty Williams This Mengden Skinner Taxon et al. et al. et al. et al. Thesis (Various) (Various) (lower) (1998) (2005) (2007) (2008) (2010) Oxyuranus 2 2 – 2 5 – 8 (1) microlepidotus Oxyuranus 31 3 – 4 3 16 – scutellatus (14) Oxyuranus – – – – 1 – 1 (0) temporalis Pseudonaja 52 9 – – 30 2 1 affinis (22) Pseudonaja 5 – – 5 2 – 8 (2) guttata Pseudonaja – – – 21 2 1 14 (1) inframacula Pseudonaja 1 – – 2 2 1 5 (3) ingrami Pseudonaja 49 3 2 – 14 6 – modesta (35) Pseudonaja 122 11 – – 101 14 – nuchalis (26) Pseudonaja 77 14 2 – 48 6 27 textilis (29) Ingroup 367 48 6 4 226 56 30 Total (133) NonOxyuranus and non311 58 42 2 4 – 21 (2) Pseudonaja Outgroups 388 Total 359 64 46 228 60 30 (135)


124

a) Total Snakes Available

b) This Study

# * # *

# * # *

# *

# *

# *! # ! *

# * ! # * # * # * ! ! ! ! ! !

* !# ! # * ! ! ! ! !!! ! ! !! !! !

! ! ! !!! ! !!! !

! ! ! ! !!!! !! ! ! ! ! !! ! !! !! ! !!! !! ! ! ! !!!! ! ! !!! !!!!!! ! ! ! !! !! ! ! ! ! ! ! ! ! !! ! ! !! !! ! ! ! ! ! !!! ! !! ! ! ! !! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! !!! ! ! ! !!! ! !! ! ! !!! ! ! !! ! ! !! ! !! ! ! ! ! ! ! ! ! !! ! ! ! !!!! ! ! ! ! !! ! ! !! !! ! ! ! ! ! ! ! ! !! ! !! ! ! ! ! !! !! ! ! ! ! ! ! !! ! ! !! ! !! ! ! !! # *! ! !! ! ! !! !! ! !! ! ! !! !! ! !!! ! ! !! ! ! ! !! !! ! ! ! !! ! !! !! ! ! ! !! ! ! ! ! ! ! ! !! !! !! ! ! ! !! ! ! ! ! ! ! !! ! ! !!! ! ! ! !! ! !! ! !! !! ! !!! ! ! !!! !! !! ! ! ! ! ! ! !!!!! ! ! ! !! ! !!! ! ! ! ! ! ! ! !! !! ! !! !! ! ! !! ! ! ! ! !!!! !! !! ! !! ! ! ! ! ! !! ! !! !! ! !!! ! ! ! !!! ! ! ! !!! ! !!! ! !!!! ! ! ! ! ! ! ! ! !! ! !! !! ! ! ! ! !! ! ! ! !! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! !! !!! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! !! ! ! !!!! !! ! ! !!!!!!! !! !! !! ! ! ! ! ! !! !! ! !!!!! !! ! ! ! ! ! !!!! ! !! !! ! ! ! ! ! !! ! !! ! ! !! ! !! !! !!! !! ! ! ! ! !! !! !! ! ! !!! !! !! !! ! ! !!!!! !!! ! ! !! ! ! !! ! ! !! ! ! ! !! ! ! ! !! !! !! ! ! !! ! ! ! ! !!!! !!! !! !! ! !!! ! !! ! ! ! ! ! !! ! !! ! ! ! ! ! ! ! !!!!!! ! ! !! !! !! !!! ! !!! ! !!!!! ! ! ! ! !! ! ! ! !! ! ! ! ! !! ! !! ! ! ! !! ! ! ! ! ! !!! ! !! ! ! ! ! !! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! !! ! !!! ! ! ! ! ! ! !! ! ! ! ! !!!! !! !!! ! !! !!! ! !! !! !! ! ! ! ! ! ! !!! ! ! !! !! !!! !!! ! !!! !! ! !! !! ! !! !! !! ! !! ! ! !! ! ! ! ! !!! ! ! ! !! ! ! !! ! ! !! ! ! !! ! ! ! ! ! ! !! !!!! !! !! !! ! ! ! ! !!!! ! ! !!! ! ! ! ! !! !!! ! ! !! !! ! !! !! ! ! ! ! !! ! ! ! !!! ! ! ! !! ! ! ! ! ! !! !! ! ! !! !! !! !!!! !! ! ! ! ! ! ! !!!! ! !!!!! ! ! !!! ! ! !!! ! ! !!!!!! !! !!

# *

# * # * # * * ## # * *

# *# * # *

# * # * # *# # # * * * # # * *

# *

# *#

!

# *

!! !

# *

! # * # ! * # * ! # * ! ! ! ! ! # * # ! ! * ! !! ! !!! ! !! ! ! ! ! # ! * !! ! # !! !! ! *!! # * ! # * *! ! *# * !! ! ! !# !# ! ! # * ! * # *! # *# !! # * ! !!! ! !! ! # * ! # * !# * ! ! ! !!!! ! # * ! # # * ! * # # * * # ! * ! ! ! ! ! # ! *# * ! ! # # !! * * !! # ! * # * # *# * # ! * # *# !! ! * # * # # # * * * ! !! # ! ! * # # *# *!! # * # * ! !*# !! ! ! #! !! * ## # ! *! *!! ! ! # !* * # * * # *# * !! ! ! ! ! ! !!!!! !! !! # * ! ! !!# ! !! *# !! ! ! * * # * *# # !# # * ! ! *# ! ! ! !! ! * # * ! # ! ! !! ! ! !! ! !! ! ! *# ! *# !! ! ! !# ! ! ! !*! !! ! # ** ! ! # * ! ! !! ! !! ! !!! !!! ! !! # * !!! ! ! ! ! ! !! ! ! # * !! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! !! ! # !! * *# ! *# !! ! * ! # * ! ! # ! ! ! ! ! !! ! ! ! ! !! # * ! !# ! ! ! * ! !! ! ! ! ! ! !!! ! ! ! ! !!!! ! # * ! !!! !! ! ! ! !! ! ! !# *# ! # ! * * ! ! # !!! ! * ! !! !! ! !! !! ! ! ! ! ! ! ! ! ! ! !! ! !! ! * !! !! # # # * *# * # ! ! ! !! !!! ! ! ! ! !!! ! ! # *! ! !! ! !! ! ! ! ! !* ! !! !! ! ! !!!! ! !!!! ! ! ! ! ! ! ! # * ! *# # ! ! * ! ! ! !! # *# !!! ! !! ! ! !! # ! # * !!! *# !! ! *! !! * ! ! ! !! ! ! ! ! ! ! ! ! ! !! !!! !!! ! ! !* ! !!! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! !! ! !!# ! ! # * !! ! ! !! ! ! ! !!! ! ! !! ! ! ! ! ! ! ! ! !# ! ! !! ! !! ! ! # * !! # ! !! * ! * !! !# * ! ! !! ! # # ! * ! * ! ! !!!! ! !! ! ! # # * # ! * ! ! *! # !! ! * ! !! ! ! # ! # # !! !! * ! * * #! !! ! # # * * *!! ! # *# * # # ! *!!! * !! !# ! !! ! ! !*!! ! !! !! # !! ! !! ! * # ! ! !!!! * ! ! ! # !! * ! ! ! # !!!! * ! !! !!! ! ! ! ! !!! # * ! !! # * !! ! ! !! ! ! ! !!!! # ! ! * ! !# ! ! ! ! ! # ! * # *! # ! * ! ! * ! ! # ! !! ! ! * ! ! !! ! ! ! ! ! ! ! # !! ! ! * # ! *! ! # !! !! *! ! ! # ! !!! ! ! !! # * ! ! ! !! ! !! ! * ! ! # * # ! * ! ! !! ! ! !! ! ! ! # # ! ! !!!! * * ! ! ! ! ! !# ! ! ! # ! ! !!! ! * ! !! ! ! ! ! !! *! ! # ! !!! !!! !! ! * !! ! ! ! ! ! ! !! ! !! # # * * # ! ! ! # * !! ! ! *! *! ! ! ! ! ! ! # ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! !! ! !!!!!!# * ! !! ! ! ! ! !! !# # * ! ! ! ! !! ! ! ! !! ! !! ! ! !! !! ! !! ! !! * ! ! ! ! ! !# *# ! ! !!! !!!! ! * # !! ! ! ! *# *! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! !!! ! ! ! ! !! !! !!! ! ! ! ! !!! ! !! ! ! !!! * !! ! ! !! ! !! ! ! ! ! ! ! #! ! ! !! ! ! ! # *! ! ! !! !! !! ! !!!!! ! ! !!! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! ! ! ! !!! !! ! ! !! !!! ! ! ! !! ! !! ! !! ! ! ! ! !! ! ! !! ! ! !!! ! ! !! !! ! !! !!! !! !!!! ! !! !! ! ! ! ! !! ! !! !! ! !! ! ! !! ! !! ! !! !!! ! ! !! ! ! ! !! !! !!! ! ! !!!! ! !! !! ! ! ! ! !!!!! ! ! ! !! ! !! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! !!! !! !! !!!! !! ! !! ! ! !!! !! ! ! ! !! ! !! !! ! ! !! !! !! !! !!! !!! ! !!!! ! ! !!!! !! !!! !! ! ! ! ! !!! !!!!! ! ! ! ! !!!!!! !! ! !!! ! !! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! ! ! ! !!! ! !! !!! ! !!! ! ! ! !! !! ! !! !! ! ! !! !!! !!! ! ! !! !!!! !!! ! !! !! ! ! !!! ! ! ! ! !! !! ! ! ! ! ! !! ! !! !! ! ! ! ! !! ! !! ! !!! !!! ! ! ! ! ! !!!! !!!!!!!! ! ! ! !! ! ! !!!! !! ! !! ! !! ! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! ! !!! !! ! !! ! ! ! !! !!! ! !!! !!! ! ! !! !!!!! ! ! ! ! ! ! ! ! ! ! !!! ! !! !! ! ! ! ! * !! ! ! !# !! ! !! # ! ! *!! ! ! !!! ! !! !!!!!! ! ! ! ! ! !! ! ! !!! !! ! ! ! !!! !! ! ! !! !! ! ! !! ! !!!! !! ! ! ! !! ! ! ! ! !! ! ! !!!!! !! ! ! ! ! ! ! ! ! !! ! !! ! !!!! !! ! ! ! ! !!!!! !! ! ! ! ! ! ! !! ! !! ! ! ! ! ! ! ! !! ! !! !! ! !! ! ! ! !! ! ! !!!!! !! ! ! !! !! ! ! ! ! ! ! !! ! ! ! ! ! !! !! !!! ! !! ! !! ! ! !! ! ! ! ! ! ! !! ! ! ! ! !!!! ! ! ! !!!! !! ! !!! !! !! ! ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! !! !!!! ! ! ! ! ! !! !! ! ! ! ! ! !! ! ! !! !! ! !! !! ! ! ! ! ! ! !!! !! !! ! !! !! ! ! ! !! ! ! ! ! ! ! ! !! !! !! ! !! ! ! !! ! ! ! !!! !! ! ! ! ! !! !!! ! ! ! !!! !!! !! ! !!!! ! ! ! ! ! ! !! ! !! !!!!!!! ! ! !! ! ! ! !! !! ! !! ! !! ! !! ! !! !!!! ! ! !! !! ! ! ! !! ! ! !! ! !!! ! ! ! ! ! !! !!! !! ! !! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! !!!! !!! ! ! ! !! !

# *

#

# *

# ## # *##

* ##

# *

* # *# #

#

#

#

# # #

# #

#

#

#

#

#

# #

* ##

#

# #

#

# #

#

#

#

#

#

#

# #

##

##

#

#

## #

# #

#

#

#

#

# #

# * # # # #

#

#

# *# *

#

# #

#

# #

# ## ###

#

#

# *# *

# #

#

# *

## #

#

# #

# # #

#

#

# #

* # * # # #

#

#

#

#

# * #

# *

# #

# # * #

# ### #

# # #

# #

# # ## #

# #

#

# # *

#

#

# #

# * # # # # *

# *

#

#

##

##

## # #

#

# #

# * #

# #

#

#

#

#

#

#

#

#

# *

#

# # #

#

# *

#

# #

#

#

* # #

#

# # * # *

# # # # ## # # ## # ## # # # # # ### ## # # # # ## # # ## # # # # # # # *# ## ## # ## # # # # # # # ## #

# * ## ##

#

#

#

#

#

#

##

# ## #

# ##

# # # # # #

#

#

# # #

# #

c) Mengden (Various)

##

#

d) Keogh et al. (1998)

#

# *

#

#

# # # # *

# *

# #

#

#

#

# #

# #

#

# # # # #

##

##

e) Wüster et al. (2005)

f) Skinner (Various)

# *

# # *

# * ### #

#

#

# * # # #

## # # *

# #

#

#

#

#

#

#

#

#

#

# #

#

#

# # ## #

#

# #

## #

# #

# # #

# #

#

#

# #

#

## # #

# * ##

#

### #

## ### #

#

#

# # * # # # # ## # # # # # # ### ## ## # # ## # # # # # # # # # # # ### ## ## # # # ### # #

# ## ## #

# #

# ##

#

# ##

# # #

# ##

#

#

#

#

# #

g) Doughty et al. (2007)

h) Williams et al. (2008)

# *

#

#

# * # # * ##

* # # *

# * # *

# * #

# # *

##

##

# *

# # *

#

#

#

# # # * # #

#

# *# *

#

#

#

# *

# # *

#

#

# # * #

# *# *

#

# ##

#

# #

# #

# ##

#

#

##

#

#

# #

#

#

# #

#

# #

#

#

Figures 4.1a–h. The geographic distributions of non-outgroup samples from phylogenetic studies involving Oxyuranus (triangles) and Pseudonaja (circles). Speciesspecific sample sizes are listed within Table 4.1. Coloured dots represent species as described in Chapter 1: Figures 1.1 and 1.2.


125

scutellatus, O. temporalis, Pseudonaja affinis, P. guttata, P. inframacula, P. ingrami, P. modesta, P. nuchalis, and P. textilis) included in this study were chosen for their taxonomic stability, the quality of their original descriptions, and their acceptance as valid taxa by most herpetologists. Information (e.g., species name, collection date, and collection location) on 9,087 brown snakes and 485 taipans held in museums in Australia, Europe, and North America was obtained and plotted with ArcGIS 9.3 geographical information systems software (Chapter 1: Figures 1.1 and 1.2; ESRI 2005). Museums were then visited and all snakes found were examined. Museum designations were initially used to guide species identifications. Snakes with potential registration errors (e.g., a P. affinis record from north-eastern Queensland, though the distribution of this species is restricted to southern South and Western Australia) were brought to museum staff for consultation and species designations were updated accordingly. Each snake record was subsequently given a unique identifying number in the ArcGIS database. Maps of updated records were overlaid with a 1° x 1° (latitude x longitude) grid and, using a random number generator, one snake from each of the ten nominative species from each grid square was randomly chosen for further examination (Haahr 2007). If a given snake was either missing from a collection or too damaged to take most measurements, it was replaced if possible by another individual of the same species randomly chosen from the same grid cell. Some additional snakes (per species per grid cell) were also included within the total pool of snakes possible for genetic analysis. These snakes were included either due to being used originally in pilot studies, because further fresh DNA was available for analysis, when a particular grid cell was thought not to have been sampled (time lag from snake selection and measurement to update of records), because they were type specimens, or where sequences were available on GenBank (even if no morphological measurements were collected from these snakes; Benson et al. 2008). Sub-setting Specimens for DNA Analysis – Based on museum records, the smallest distribution for any of the ten species (excluding O. temporalis) included in this study is that of P. inframacula, with an area slightly smaller than 6° x 6° (latitude x longitude). Pseudonaja inframacula is also the species best sampled (number of individuals per unit area) by Skinner (2003) and Skinner et al. (2005), and results from those studies show P. inframacula to be monophyletic, with little genetic variation throughout its distribution. Thus, maps of snakes chosen for analysis were overlaid with a 6° x 6° grid


126

and, when possible, at least one snake per species from each 6° x 6° grid cell was chosen for DNA extraction and analysis. Potential specimens from each 6° x 6° grid cell were preferentially chosen for analysis if sequences were available on GenBank or where fresh tissue existed for use in DNA extraction (Benson et al. 2008). Any remaining, formalin-fixed specimens necessary for analysis were chosen randomly from each 6° x 6° grid cell (Haahr 2007). If DNA was not able to be extracted or amplified from any particular formalin-fixed specimen, it was replaced if possible by another formalin-fixed individual of the same species randomly chosen from the same 6° x 6° grid cell. This method ensured sampling of all areas of distribution with a satisfactory sample size and minimised spatial pseudoreplication.

As detailed in Chapter 1, Oxyuranus and Pseudonaja species have been placed in a number of different genera throughout their taxonomic history. Outgroup specimens were chosen from 113 snakes of various genera, most of which were used for morphological comparisons (see Chapter 5). Molecular outgroups were selected for three reasons: to ensure monophyly of the ingroups (Toxicocalamus preussi – an elapid snake with a distribution in Indonesia and Papua New Guinea but not Australia), to examine the relationships between genera previously associated with Pseudonaja and Oxyuranus

species

(Cacophis

squamulosus,

Demansia

papuensis,

Demansia

psammophis, Demansia vestigiata, Furina diadema, Furina ornata, Hemiaspis damelli, Hemiaspis signata, Pseudechis australis, Pseudechis butleri, and Pseudechis colletti), and to utilise specimens which had been used as outgroups previously in Pseudonaja and Oxyuranus molecular studies (Neelaps calonotus, Pseudechis australis, and Vermicella intermedia). Tissue → DNA → Sequences – Most mitochondrial DNA was extracted using the CTAB method detailed in Appendix VI (protocol 37). Formalin-fixed tissues that did not yield acceptable DNA were further subjected to the extraction methods of Shi et al. (2004; autoclave option) and Sato et al. (2001), also detailed in Appendix VI (protocols 3a and 18). In order to directly compare results with past molecular studies on Oxyuranus and Pseudonaja, attempts were made to amplify a fragment of the ND4 gene and the neighbouring Histidine-, Serine-, and Leucine-tRNA genes. This fragment of the mitochondrial genome was amplified using forward and reverse primers originally published by Arévalo et al. (1994) and Forstner et al. (1995). Additional primers were


127

designed for use with formalin-fixed tissues which did not yield full-length sequences. All primers are listed in Table 4.2 and the location of each primer within a typical elapid mitochondrial genome is illustrated in Figure 4.2. DNA extracts and PCR products were viewed after an electrophoresis run through an ethidium bromide-stained one percent agarose gel (Figure 4.3). Polymerase chain reaction and sequencing protocols were as described in Chapter 3.

Original sequences were edited (and joined together, as in the cases of smaller fragments from formalin-fixed tissues) using BioEdit 7.0.9.0 (Hall 1999) and CodonCode Aligner 2.0.6 (CodonCode 2007). Alignments for all sequences were undertaken with ClustalW (Thompson et al. 1994) and Muscle (Edgar 2004) with nearly identical results. Alignments were corrected by eye and saved as NEXUS- or PHYLIPformatted files (Felsenstein 1993, Maddison et al. 1997). Redundant sequences were identified and removed from analyses using the internet-based tool ElimDupes (Los Alamos National Laboratory 2009). There were two types of final, aligned sequence files: 1) outgroups + full-length sequences from all species, and 2) outgroups + lengthand species-specific sequences (see below). Analysis of Sequences – The most likely model of evolution for each data set was determined under the Akaike Information Criteria (Akaike 1974) as part of Modeltest 3.7 (Appendix VII; Posada and Crandall 1998) and MrModeltest 2.3 (Appendix VIII; Nylander 2004) run within PAUP* 4.0b10 (Swofford 2003). Model-testing results were visualised with MrMTgui 1.01 (Nuin 2009) and saved as text files. Evolutionary relationships were estimated using three different analyses of aligned sequences: Maximum Parsimony (MP), Maximum Likelihood (ML), and Bayesian (B). All analyses treated gaps as missing states and were run through the internet-based CIPRES Portal 2.0 beta (CIPRES 2009) or using a personal computer running Microsoft Windows XP. All output phylogenetic trees were visualised using FigTree 1.2.1 (Rambaut 2009).

The three methods chosen for analysis are the most popular types of analyses used to reconstruct phylogenies. None has been shown to work definitively better than the others, and each method has its own set of advantages and disadvantages—some of which are listed here (Holder and Lewis 2003, Hall 2005, Holder et al. 2008).


128

Table 4.2. A list of mitochondrial primers used in this chapter. Left-aligned primer names indicate use with forward direction/light DNA strands while right-aligned primer names indicate use with reverse direction/heavy DNA strands. Primers without superscript annotation were designed for this study. Base positions (at the 5‘ end) correspond to the mitochondrial genome map published by Kumazawa et al. (1998). Nucleotides include: A = adenine, C = cytosine, G = guanine, T = thymine, D = A + G + T, R = A + G, and Y = C + T. The relative location of each primer within the mitochondrial genome is illustrated in Figure 4.2.

Name 1

Sequence

ND4 TGACTACCAAAAGCTCATGTAGAAGC ND4-1aF GGYATTATCCGYCTATCCC ND4-2F GCTGCAATADCYATCCAAACAC ND4-1R CCYCATTGTGTTTGGAT ND4-H1 CGGGTTTGTGTRCGTTCGTAGG ND4-3F TACGAACGYACACAAACCCG ND4-2R GTATAATRCGGGTTTGTGTGC ND4-315F ACCCGAGGRTTYCAYAAC ND4-3R AGTTTATGCTGGGYGGGGTAG ND4-566R TRAGGAGRTGTTCTCGTGAGTG ND4-565F YDCACTCACGAGAACAYCTCC 1 ND4-SnkNrev TATTAGGAGATGTTCTCG 2 M246 TTTTACTTGGATTTGCACCA 1 From Forstner et al. (1995) 2

Melting Temp. (C) 65.3 54.8 60.0 53.6 69.2 63.3 60.6 56.3 63.8 60.9 61.9 49.5 60.5

Base Position (5‘ end) 11677 11758 11929 11941 12032 12034 12041 12067 12137 12315 12317 12325 12569

From Skinner (2003), a modification (by reduction of the initial six bases of the primer

Leu) of Arévalo et al. (1994)


129

Figure 4.2. Relative location and directionality of each primer used to amplify DNA as presented within this chapter. Primer sequences, melting temperatures, and base positions are located in Table 4.2. Full genome map modified and reprinted from Dong and Kumazawa (2005).


130

a) DNA extract test – Numerical codes are as follows: 1 = one kilobyte DNA ladder (GeneRuler®, Fermentas); 2 = empty well; 3 = whole genomic DNA; 4 = high volume, long to short fragment DNA; 5 = DNA unsuccessfully extracted from tissue; 6 = low volume, short fragment DNA; 7 = high volume, medium to short fragment DNA; 8 = high volume, short fragment DNA; and 9 = negative control

b) PCR product test – Alphabetical codes are as follows: A = one kilobyte DNA ladder (GeneRuler®, Fermentas); B = negative control; C = high volume, full-length DNA (sequence from ND4–M246 primers); D = extracted DNA, unsuccessfully amplified; E = low volume, full-length DNA (sequence from ND4–M246 primers); F = positive control from whole genomic DNA

Figures 4.3a–b. Sample images of ethidium bromide stains of (a) DNA extracts and (b) PCR products photographed after an electrophoresis run through a one percent agarose gel. Except where noted, each column represents a different snake.


131

Maximum Parsimony assumes that the best explanation of a data set is the one with the fewest mutations needed to explain the relationships (Hillis et al. 1996, Felsenstein 2004, Holder and Lewis 2003). Maximum Parsimony is simple and fast, but increasing the amount of data increases the likelihood of recovering incorrect relationships due to long branch attraction (Felsenstein 2004, Holder and Lewis 2003). Maximum Likelihood measures how well a data set matches estimates given by model parameters (Hillis et al. 1996, Felsenstein 2004, Holder and Lewis 2003, Ronquist and Deans 2010). Maximum Likelihood is thorough and least likely to be affected by sampling errors, but can be fairly slow, especially for data sets with greater than 100 sequences (Felsenstein 2004, Holder and Lewis 2003). Bayesian measures how well parameters match a given data set (Holder and Lewis 2003, Alfaro and Holder 2006, Ronquist and Deans 2010). Bayesian allows for a quicker (than Maximum Likelihood) analysis of complex models of evolution without much influence from long branch attraction, but the user must make assumptions about hypothesis probabilities without access to data and it can be difficult to know if an analysis has run long enough (Alfaro and Holder 2006, Ronquist and Deans 2010). Rather than use only one of these methods, all three were included for use in this study. The rationale was that consistent results would indicate robustness to different analytical approaches—evidence of strong phylogenetic signal.

To search for the most parsimonious tree(s), the parsimony ratchet method was used (Nixon 1999). Two hundred ratchet iterations (the default—and often optimal—setting) were performed, with twenty percent of characters equally re-weighted at each ratchet. No limits were set for the number of rearrangements to perform, for the time to search for rearrangements, or for reconnection limits. Non-parametric bootstrapping of one thousand replicates was performed using heuristic searches with tree-bisectionreconnection branch-swapping and ten replicates of random stepwise sequence addition (Felsenstein 1985). MP analyses were undertaken within PAUP* 4.0b10 (Swofford 2003). ML analyses involved successive heuristic searches implementing tree-bisectionreconnection branch-swapping. Initial evolutionary model parameters were re-estimated at the conclusion of each heuristic search, updated as necessary, and this process re-run until equal ML values were obtained by successive searches. One thousand pseudoreplicates were used for ML bootstrapping. ML analyses were undertaken within RAxML (Stamatakis et al. 2008). Relevant MrBayes code (Appendix IX) containing the


132

selected model of evolution and partitioned four ways (one partition each for the first, second, and third codon positions of the ND4 sequence and a fourth partition for the entire tRNA sequence) was appended to the end of each original NEXUS file (containing aligned sequences). Five independent analyses were performed using five Markov chains (incrementally heated, beginning with the default temperature value 0.2) randomly-started, run for seven million generations, and sampled every one thousand generations. Likelihood stationarity and Markov chain Monte Carlo convergence of tree topologies was examined using Microsoft Excel and the internet-based program Are We There Yet (AWTY; Wilgenbusch et al. 2004). Specifically, the following plots were examined: generation time vs. log-likelihood values (Excel) for each of the five runs, post-burn-in posterior probabilities of each split compared between all runs (AWTY), and cumulative post-burn-in posterior probabilities of each split vs. generation time (AWTY). Burn-in trees were discarded, with remaining trees used to calculate the consensus tree topology and posterior probabilities. To help ensure results were not a consequence of analyses becoming trapped within local optima, a second, separate analysis was run (both used different starting trees) and stationarity levels from all analyses were examined for convergence (Huelsenbeck and Bollback 2001, Leaché and Reeder 2002). Bayesian analyses were undertaken with MrBayes 3.1.2 (Huelsenbeck and Ronquist 2001, Ronquist and Huelsenbeck 2003). Uncorrected sequence divergences within and between major clades and groups were calculated with Mega 4.1 build 4104 (Tamura et al. 2007).

As full-length sequences contain the most parsimony-informative sites, analyses of fulllength sequences (derived usually from fresh tissue) were originally performed and their results accepted as being the standard by which to judge all other analyses and trees. Further analyses were conducted for shorter lengths of sequences, due to fragmentation of sequences or inability to recover certain fragments (probably caused by the effects of formalin fixation). In these cases, species-specific files (O. temporalis was grouped with O. microlepidotus) were created so as to contain equal sequence lengths. For example, analyses of Pseudonaja ingrami (N = 17) and outgroup specimens were undertaken using five files: 773 bases (sequences derived from full-length fresh and formalin-fixed DNA, n = 13), 727 bases (sequences derived from fragmented fresh and formalin-fixed DNA, n = 14), 621 bases (sequences derived from fragmented fresh and formalin-fixed DNA, n = 15), 409 bases (sequences derived from fragmented fresh and formalin-fixed


133

DNA, n = 16), and 152 bases (sequences derived from fragmented fresh and formalinfixed DNA, N = 17). A visualisation of these lengths is included in Figure 4.4.

A record was kept of the snakes comprising each clade derived from full-length sequences and the corresponding museum database records for these snakes were mapped geographically. This process was iteratively repeated for all fragmented sequence lengths, starting with longer lengths and finishing with the shortest length. An example of Pseudonaja modesta fragment comparisons is illustrated in Figure 4.5. Fragmented sequences were conservatively designated as informative if they were recovered consistently in or near the same clade, along with the entire complement of original specimens for that clade, and considered to be uninformative if they did not group into any clade or grouped within several clades. An additional, geographic limit was imposed to protect against the effects of possible base switches during formalinfixation or storage, or due to incorrect collection information. Specifically, the distance from the geographic location of a fragmented sequence to the nearest location of a fulllength sequence from the same clade could not be greater than the largest distance between the geographic locations of two full-length sequences from the same clade. ‗Informative‘ fragments were then treated as full-length sequences and the process repeated as necessary. Finally, phylogenetic analyses were repeated using all sequences (full-length + informative and uninformative fragments) and with informative sequences (full-length + informative fragments), and then compared with the earlier analyses only of long-length sequences.

The suitability of analysing morphological data in a phylogenetic framework was also investigated, with the hope of combing both types of data into a final, combined analysis. Briefly, raw measurements of continuous characters were standardised, as per Lleonart et al. (2000). All characters (continuous, meristic, categorical, and binomial) were then scaled to a magnitude of ten (the maximum character states allowed in Bayesian analyses; as per Thiele [1993]), before being converted into a series of binomial characters. Thus, the categorical question ―Are the subcaudal scales single, mixed, or paired?‖ (with original values of 1, 2, and 3) became a series of three binomial (0 or 1) questions: ―Are the subcaudal scales single?‖, ―Are the subcaudal scales mixed?‖, and ―Are the subcaudal scales paired?‖. For a full presentation of morphological measurements and standardisation techniques, please see Chapter 5.


134

Figure 4.4. Screen capture of aligned sequences from outgroups and Pseudonaja ingrami. In the top third of the image, blue lines represent sequences running in forward direction, while the orange line represents nucleotides sequenced in the reverse direction, and white space represents missing bases. Snakes (listed by identification number) and bases representing the shaded portion of the lines (to the top right of image) are displayed on the bottom two-thirds of the image. Bold numbers refer to sequence lengths: 1 = 783 bases, 2 = 727 bases, 3 = 621 bases, 4 = 409 bases, and 5 = 152 bases.


135

a) Full-length sequences (773 bases; n = 52)

b) Sequence fragments (673 bases; n = 53)

c) Sequence fragments (541 bases; n = 53)

d) Sequence fragments (441 bases; n = 54)

e) Sequence fragments (304 bases; n = 57)

f) Sequence fragments (192 bases; n = 63)

g) Sequence fragments (76 bases; n = 70)

Figures 4.5a–g. Comparisons of trees created from analyses of variable-length Pseudonaja modesta sequences. Sub-clades are represented by coloured triangles. Outgroups (usually found early in the tree) and P. modesta samples which did not sort within clades (found between clades) are indicated by single lines.


136

Results

One hundred and seventy-one unique haplotypes were identified among the 319 fulllength sequences available for analysis (Appendix X). Unique haplotypes and total specimen composition of full-length sequences were as follows: Oxyuranus microlepidotus (n = 3 and 7), O. scutellatus (n = 9 and 24), O. temporalis (n = 1 and 1), Pseudonaja affinis (n = 9 and 39), P. guttata (n = 5 and 6), P. inframacula (n = 5 and 13), P. ingrami (n = 3 and 3), P. modesta (n = 29 and 34), P. nuchalis (n = 52 and 105), P. textilis (n = 35 and 66), and outgroups (n = 20 and 21). Full-length, aligned sequences consisted of 773 characters (nitrogenous bases): 375 were invariable and 398 were variable (of which 341 were parsimony-informative and 57 were parsimonyuninformative). Although the primers used in this study often yielded longer sequences, these sequences were trimmed to 773 bases so as to directly compare with the maximum lengths of most previously-published sequences. The ND4 gene was represented by bases 1–647 and the tRNAs by bases 648–773. The average nucleotide composition for full-length sequences was: Adenine = 32.2%, Cytosine = 28.9%, Guanine = 12.2%, and Thymine = 26.7%. The reading frame for codons began from the third position of aligned sequences. Amplification of nuclear paralogues was considered unlikely for two reasons. First, no stop codons were found within the protein-coding ND4 sequence (with the exception of the end-of-gene stop codon). Second, DNA sequences which were identical to DNA sequences available on GenBank were successfully amplified (Benson et al. 2008). These published sequences also contained no stop codons and some had been additionally subjected to nuclear paralogue testing as per Donnellan et al. (1999). All model tests of genetic data indicated the likelihood of evolution under a general time-reversible model with some sites invariant and other sites following a gamma distribution. Morphological data necessitated the use of the general time-reversible, CAT model.

The parsimony analysis of full-length sequences yielded 130 optimal trees (length = 1718). Examining all characters, the consistency index for these trees was 0.3409, the retention index was 0.8834, and the rescaled consistency index was 0.3012. Excluding uninformative characters, the consistency index for these trees was 0.3179, the retention index was 0.8834, and the rescaled consistency index was 0.2808. A 50% majority-rule consensus tree of all most parsimonious trees is presented in Figure 4.6. The maximum


137

Figure 4.6. The 50% majority-rule consensus tree of all most parsimonious trees found from a Maximum Parsimony analysis of 773 bases from the mitochondrial ND4 and neighbouring tRNA genes. Outgroups are demarcated with a gray line, while Oxyuranus and Pseudonaja sub-clade lines are coloured as with Chapter 1: Figures 1.1 and 1.2. Bootstrap support values for most nodes are illustrated on the tree: black circles = 100%, red circles = 90–99%, blue circles = 70–89%, and green circles = 50–69%. Node demarcation is omitted where bootstrap support values are less than 50%.


138

likelihood analysis of full-length sequences resulted in a topology with final maximum likelihood optimization likelihood of -9391.1996. Model parameter estimates produced were: alpha = 1.065, Pinvar = 0.4138, rate A  C = 1.6184, rate A  G = 14.7740, rate A  T = 1.3637, rate C  G = 0.5752, rate C  T = 13.5219, and rate G  T = 1.0000. The best-scoring maximum-likelihood tree is presented in Figure 4.7. Both independent Bayesian analyses produced highly similar results, indicating that neither analysis had become trapped on local optima, and the results from the first analysis are specified here (Huelsenbeck and Bollback 2001). Bayesian analyses were stopped when the average standard deviation of split frequencies reached < 0.01 (seven million generations, 0.009660). High correlations found through examination of generation time vs. log-likelihood values (Figure 4.8)—as well as posterior probabilities of tree topologies compared between all runs (Figure 4.9)—indicated that convergence of chains within the Bayesian analyses had occurred within 100,000 generations. However, plots of cumulative posterior probabilities of each split vs. generation time and posterior probabilities of tree topologies compared between all runs using both absolute and symmetrical differences showed that stationarity did not appear to be fully stable until between 1.5 and 3 million generations (Figure 4.10). Although subsequent review of phylograms generated from different burn-in times (0.5, 2.0, 3.0, 3.5, 4.0, and 5.0 million generations) showed identical clade structure and nearly identical node support, a conservative estimate was utilised: three million generations were discarded, leaving four million generations for analysis. Estimated marginal likelihoods and model parameter summaries are presented in Tables 4.3 and 4.4. A 50% majority-rule consensus tree from the Bayesian analyses is presented in Figure 4.11.

Pseudonaja was found to be paraphyletic for all analyses of full-length sequences, with Pseudonaja recovered as the sister group of Oxyuranus (Maximum Parsimony analysis) or with Pseudonaja modesta recovered as the sister group of all other ingroup taxa (Maximum Likelihood and Bayesian analyses). Although not directly comparable, node support values tended to be lower for the Maximum Parsimony analysis and highest for Bayesian analyses (Douady et al. 2003). The results from the Maximum Likelihood analysis were most similar to those of the Bayesian analysis. In all cases, the lowest node support values were typically found at nodes between Oxyuranus and remaining species of Pseudonaja or between P. guttata and remaining species of Pseudonaja. For


139

Figure 4.7. The best tree found from a Maximum Likelihood analysis of 773 bases from the mitochondrial ND4 and neighbouring tRNA genes. Outgroups are demarcated with a gray line, while Oxyuranus and Pseudonaja sub-clade lines are coloured as with Chapter 1: Figures 1.1 and 1.2. Bootstrap support values for most nodes are illustrated on the tree: black circles = 100%, red circles = 90–99%, blue circles = 70–89%, and green circles = 50–69%. Node demarcation is omitted where bootstrap support values are less than 50%.


140

a) All five Markov chain Monte Carlo runs superimposed on each other Generation 0

1000000

2000000

3000000

4000000

5000000

6000000

7000000

-9300

ln L

-9350

-9400

-9450

-9500

b) Average of all five Markov chain Monte Carlo runs Generation 0

1000000

2000000

3000000

4000000

5000000

6000000

7000000

-9300

ln L

-9350

-9400

-9450

-9500

Figure 4.8. Plots of generation time vs. log-likelihood values from Bayesian analyses, showing convergence of log-likelihood scores towards similar values. All runs were stopped after seven million generations.


Figures 4.9a–j. Plots of posterior probabilities of clades compared between all runs.

141


142

a) Splits 1–20

b) Splits 21–40

c) Splits 41–60

d) Splits 61–80

e) Splits 81–100

f) Absolute differences

g) Symmetrical differences

Figures 4.10a–g. Plots of cumulative posterior probabilities of each split vs. generation time (a–e) and posterior probabilities of clades compared between all runs using both absolute and symmetrical differences (f–g).


143

Table 4.3. Estimated marginal likelihoods for five Markov Chain Monte Carlo Bayesian analyses.

Run 1 2 3 4 5 Total

Arithmetic Mean -9342.12 -9347.81 -9332.32 -9336.78 -9328.43 -9330.01

Harmonic Mean -9435.32 -9440.74 -9446.01 -9430.85 -9431.84 -9444.41

Table 4.4. Model parameter summaries over all five Markov Chain Monte Carlo Bayesian analyses.

Parameter Mean TL{all} 32.525308 r(AC){1} 0.180400 r(AG){1} 0.250179 r(AT){1} 0.017487 r(CG){1} 0.087291 r(CT){1} 0.442495 r(GT){1} 0.022147 r(AC){2} 0.026034 r(AG){2} 0.496290 r(AT){2} 0.034692 r(CG){2} 0.031356 r(CT){2} 0.377851 r(GT){2} 0.033778 r(AC){3} 0.056634 r(AG){3} 0.320595 r(AT){3} 0.065897 r(CG){3} 0.009506 r(CT){3} 0.479815 r(GT){3} 0.067553 r(AC){4} 0.056652 r(AG){4} 0.268013

Variance 3.256908 0.002305 0.005662 0.000231 0.001274 0.004274 0.000288 0.000014 0.001333 0.000029 0.000108 0.001229 0.000196 0.000142 0.002497 0.000224 0.000056 0.002730 0.000515 0.000313 0.003625

95% Credibility Interval Lower Upper Median 29.105000 36.235000 32.507000 0.097716 0.283346 0.176760 0.117418 0.409035 0.245580 0.000548 0.056770 0.013518 0.030534 0.168972 0.082599 0.319237 0.573597 0.441109 0.001716 0.065185 0.018220 0.019263 0.033760 0.025871 0.425506 0.568912 0.496296 0.024969 0.045903 0.034442 0.013508 0.054067 0.030444 0.310082 0.447147 0.377752 0.010579 0.064728 0.032248 0.035979 0.082639 0.055607 0.227005 0.422464 0.318995 0.039808 0.098210 0.064780 0.000392 0.028405 0.007829 0.377398 0.581535 0.480197 0.030480 0.118243 0.065010 0.027472 0.096021 0.054804 0.162755 0.396801 0.263774

PSRF1 1.027 1.001 1.001 1.000 1.000 1.000 1.000 1.000 1.001 1.000 1.000 1.001 1.001 1.000 1.001 1.001 1.000 1.000 1.000 1.000 1.000


144


95% Credibility Interval Parameter Mean Variance Lower Upper Median PSRF1 0.000507 0.038982 0.126934 0.075045 1.000 r(AT){4} 0.077049 0.035543 0.000457 0.005284 0.087561 0.031785 1.000 r(CG){4} 0.004401 0.381673 0.642555 0.515661 1.000 r(CT){4} 0.515382 0.000736 0.007016 0.111109 0.042991 1.001 r(GT){4} 0.047360 pi(A){1} 0.160927 0.000547 0.117466 0.209451 0.160172 1.000 pi(C){1} 0.301095 0.000661 0.252059 0.352590 0.300605 1.000 pi(G){1} 0.130037 0.000450 0.090869 0.174410 0.129194 1.000 pi(T){1} 0.407940 0.000807 0.352703 0.463205 0.407796 1.000 pi(A){2} 0.414830 0.000507 0.370545 0.458908 0.414853 1.000 pi(C){2} 0.323458 0.000349 0.287780 0.360534 0.323165 1.000 pi(G){2} 0.065205 0.000055 0.052084 0.080850 0.064835 1.001 pi(T){2} 0.196507 0.000186 0.170930 0.224331 0.196041 1.001 pi(A){3} 0.349034 0.000810 0.293535 0.405459 0.348553 1.000 pi(C){3} 0.282339 0.000660 0.232779 0.333793 0.281781 1.000 pi(G){3} 0.154605 0.000545 0.112187 0.203356 0.153346 1.001 pi(T){3} 0.214022 0.000490 0.172808 0.259438 0.213159 1.000 pi(A){4} 0.350458 0.001282 0.281476 0.421781 0.349984 1.001 pi(C){4} 0.236632 0.000956 0.179147 0.300128 0.235455 1.000 pi(G){4} 0.178260 0.000867 0.124798 0.240292 0.176486 1.000 pi(T){4} 0.234650 0.000908 0.178831 0.297522 0.233555 1.000 alpha{1} 0.057186 0.000004 0.053694 0.060916 0.057154 1.004 alpha{2} 5.279067 1.919568 3.319277 8.647968 5.033010 1.000 alpha{3} 0.665317 0.136328 0.246216 1.598833 0.564328 1.001 alpha{4} 1.506118 9.515353 0.386026 3.696829 1.235191 1.000 pinvar{1} 0.489866 0.003831 0.364695 0.606817 0.491569 1.000 pinvar{2} 0.012276 0.000110 0.000382 0.038764 0.009578 1.000 pinvar{3} 0.312412 0.019814 0.030955 0.532225 0.332238 1.000 pinvar{4} 0.467083 0.010304 0.196925 0.612670 0.485664 1.000 m{1} 3.244174 0.000558 3.194909 3.287674 3.245269 1.019 m{2} 0.245201 0.000325 0.212089 0.283090 0.244519 1.017 m{3} 0.057007 0.000049 0.044306 0.071912 0.056625 1.005 m{4} 0.055861 0.000094 0.039375 0.077016 0.054958 1.006 1 From the MrBayes output: ―Convergence diagnostic (PSRF = Potential scale reduction factor [Gelman and Rubin 1992], uncorrected) should approach 1.0 as runs converge. The values may be unreliable if you have a small number of samples. PSRF should only be used as a rough guide to convergence since all the assumptions that allow one to interpret it as a scale reduction factor are not met in the phylogenetic context.‖


145

Figure 4.11. The 50% majority-rule consensus tree from Bayesian analyses of 773 bases from the mitochondrial ND4 and neighbouring tRNA genes. Outgroups are demarcated with a gray line, while Oxyuranus and Pseudonaja sub-clade lines are coloured as with Chapter 1: Figures 1.1 and 1.2. Bootstrap support values for most nodes are illustrated on the tree: black circles = 100%, red circles = 90–99%, blue circles = 70–89%, and green circles = 50–69%. Node demarcation is omitted where bootstrap support values are less than 50%.


146

Maximum Parsimony and Bayesian analyses, the relationships between major Pseudonaja clades (excluding P. guttata and P. modesta) and their support values were often congruent with those published by Skinner et al. (2005) and Doughty et al. (2007). For any differences in arrangements between studies, results presented in this thesis typically showed higher node support values.

The main difference amongst these studies is the placement of Pseudonaja modesta in relation to Oxyuranus and other Pseudonaja: Pseudonaja was found to be monophyletic by Skinner et al. (2005), P. modesta was congeneric with Oxyuranus according to Doughty et al. (2007), and Pseudonaja was found to be paraphyletic in this study (with P. modesta appearing as a separate clade to Oxyuranus and other Pseudonaja in two of three phylogenetic analyses). To attempt to understand these potential influences, the data of Skinner et al. (2005) were reanalysed, varying the ingroups and outgroup(s) in four ways: 1) ingroup + outgroup sequences (two Pseudechis australis specimens) from Skinner et al. (2005), 2) ingroup + outgroup sequences from Skinner et al. (2005) + main outgroup sequence used in this study (Toxicocalamus preussi), 3) all ingroup sequences used this study (which include those from Skinner et al. [2005] and Doughty et al. [2007]) + outgroup sequences from Skinner et al. (2005), and 4) all ingroup sequences used in this study + main outgroup sequence used in this study. The first two processes were also run with data from Doughty et al. (2007), including their outgroups (Neelaps calonotus, two Pseudechis australis specimens, and Vermicella intermedia). These comparisons were undertaken by means of two independent Bayesian analyses using four Markov chains to mimic conditions specified by Skinner et al. (2005) and Doughty et al. (2007). Bayesian analyses were selected as they were performed by Skinner et al. (2005) and Doughty et al. (2007), allowing direct comparison of results. Maximum Likelihood analyses were included because Maximum Likelihood results appear to correspond well with results from Bayesian analyses (at least with the data presented above), making any complementary results obtained more convincing while reducing the plausibility that analysis types would influence any differences uncovered. As mentioned earlier, robustness to different analytical approaches (i.e., complementary results) would be seen as evidence of strong phylogenetic signal.

Comparative results are given in Figures 4.12 and 4.13. Topologies of Doughty et al. (2007) were recovered with new Bayesian analyses (Figure 4.12c). However, in three


147

a) MB results, this study

b) ML results, this study

c) MB rerun of Doughty et al. (2007)

d) ML rerun of Doughty et al. (2007)

e) MB rerun of Doughty et al. (2007) + Toxicocalamus preussi

f) ML rerun of Doughty et al. (2007) + Toxicocalamus preussi

Figures 4.12a–f. Comparative results of Doughty et al. (2007) and this study, specifically looking at differences between analysis types, ingroups, and outgroups. Bayesian (MB) results illustrated in c) are equivalent to Bayesian results published by Doughty et al. (2007). Legend: light blue = Oxyuranus, red = Pseudonaja affinis, pink = P. guttata, green = P. inframacula, yellow = P. ingrami, dark blue = P. modesta, brown = P. ‗nuchalis‘, black = P. textilis, letters + numbers = outgroup specimens, and ML = Maximum Likelihood analysis.


148

a) MB results, this study

b) ML results, this study

c) MB rerun of Skinner et al. (2005) and d) MB rerun of Skinner et al. (2005) + additional specimens from this study

e) ML rerun of Skinner et al. (2005) and f) ML rerun of Skinner et al. (2005) + additional specimens from this study

g) MB rerun of Skinner et al. (2005) + Toxicocalamus preussi

h) ML rerun of Skinner et al. (2005) + Toxicocalamus preussi

i) MB rerun of Skinner et al. (2005) + Toxicocalamus preussi + additional specimens from this study

j) ML rerun of Skinner et al. (2005) + Toxicocalamus preussi + additional specimens from this study

Figures 4.13a–j. Comparative results of Skinner et al. (2005) and this study, specifically looking at differences between analysis types, ingroups, and outgroups. Bayesian (MB) results illustrated in c) and d) are equivalent to Maximum Parsimony results published by Skinner et al. (2005). Maximum Likelihood (ML) results illustrated in e) and f) are equivalent to Bayesian results published by Skinner et al. (2005). Legend: light blue = Oxyuranus, red = Pseudonaja affinis, pink = P. guttata, green = P. inframacula, yellow = P. ingrami, dark blue = P. modesta, brown = P. ‗nuchalis‘, black = P. textilis, and letters + numbers = outgroup specimens.


149

other analyses of their data (Figures 4.12d–f), P. guttata was recovered as the sister group to all other ingroup taxa. With the exception of the placement of P. guttata, Oxyuranus was recovered as the sister group to all other ingroup taxa in seven of eight new Bayesian and Maximum Likelihood analyses comparing ingroup and outgroup specimens used by Skinner et al. (2005) and in this thesis (Figures 4.13c–j). Interestingly, when using the outgroups of Skinner et al. (2005) and regardless of the number of ingroup specimens included, the Maximum Parsimony results of Skinner et al. (2005) were recovered from new Bayesian analyses (Figures 4.13c and 4.13d) and the Bayesian results of Skinner et al. (2005) were recovered from new Maximum Likelihood analyses (Figures 4.13e and 4.13f). Pseudonaja guttata was recovered as the sister group to Oxyuranus and all other Pseudonaja in new analyses using Toxicocalamus preussi as the outgroup (Figures 4.13g–j). No result matched any of those from the original, full analyses (for this thesis), which included additional species from closely-related genera (Cacophis, Demansia, Furina, and Pseudechis).

Bootstrap support values of relationships between Oxyuranus, P. guttata, and P. modesta were highly variable depending on the number of ingroup specimens examined during reanalyses. For example, there was high support (99–100%) for P. guttata as the sister group to all other ingroup taxa using the data of Doughty et al. (2007), while there was low support (19–52%) in the same analyses using the data of Skinner et al. (2005). In addition to the influence of ingroup membership, there was a similar pattern of variable support depending on the choice of outgroup. For example, when re-examining the data of Skinner et al. (2005), support for the placement of Oxyuranus varied between 19–52% using T. preussi as the outgroup but did not vary (100%) when using Pseudechis australis as the outgroup. In general, there was higher or more consistent support for the separation of a group consisting of Oxyuranus, P. guttata, and P. modesta from the rest of Pseudonaja than there was for the relationships between Oxyuranus, P. guttata, and P. modesta.

To help assess the influence of outgroup selection on ingroup relationships, an additional set of Maximum Likelihood analyses was performed on the original, fulllength sequence dataset. As stated above, Maximum Likelihood analyses were chosen because results appear to correspond well with results from Bayesian analyses, because Maximum Likelihood node support values are less susceptible to overestimation


150

compared to those of Bayesian analyses, and because their ratio of informative power to computing time is higher than most other equivalent analyses (Simmons et al. 2004, Stamatakis et al. 2005, Morrison 2007). Initial Maximum Likelihood results using Toxicocalamus preussi as the main outgroup were examined and the position of the most closely-related taxon (Cacophis squamulosus) was noted. The data were reanalysed after deleting Toxicocalamus preussi and designating Cacophis squamulosus as the new outgroup. This process was repeated for all outgroup sequences until there was only one outgroup sequence left (Vermicella intermedia). All results showed Pseudonaja to be paraphyletic due to the placement of P. modesta: P. modesta > Oxyuranus (node support values between 98–100%) > P. guttata (node support values between 45–72%) > remaining species of Pseudonaja (node support values between 38–60%). To see if selecting a highly divergent outgroup would affect results (such as due to long-branch attraction), the analysis was re-run three times, using even more distantly-related taxa (Micrurus surinamensis – South American elapid, Naja naja – Asian elapid, and Python regius – African pythonid) as outgroups (Page and Holmes 1998). Relationships inferred from these analyses were as with those presented immediately above (P. modesta > Oxyuranus > P. guttata > other Pseudonaja). Thus, outgroup selection does not appear to be the cause of the differences in systematic relationships between each study.

New results of net (full-length) sequence divergences within and between genera and commonly-defined species of Oxyuranus and Pseudonaja are shown in Tables 4.5a, 4.5b, 4.6a, and 4.6b, respectively. Pseudonaja differed by 11.0% from Oxyuranus, and both Oxyuranus and Pseudonaja differed at least 15.6% from all other genera included within the analysis. Net (full-length) sequence divergences between species ranged between 5.5% and 22.5%. Re-analysis to incorporate a split Pseudonaja still showed similar levels of divergence (Tables 4.7a–b and 4.8a–b), with P. modesta differing both from Oxyuranus and the remaining Pseudonaja by 12.8% and 10.5%, respectively. Overall, the levels presented in this thesis are much lower than those reported by Skinner et al. (2005), who recorded sequence divergences between Pseudonaja species (separating P. nuchalis into three major groups) up to 66.3%, even though the authors also reported that 59.7% (n = 460 out of 770) of all bases analysed were invariable (see pages 562 and 566 [Table 4.3] of Skinner et al. [2005] for confirmation). Despite the differences in magnitude between reported sequence divergences of Skinner et al.


151

Tables 4.5a–b. Net (full-length) sequence divergences (listed as percentages) within and between genera used in this study.

Genus Cacophis Demansia Furina Neelaps Oxyuranus Pseudechis Pseudonaja Toxicocalamus Vermicella

Genus Cacophis Demansia Furina Neelaps Oxyuranus Pseudechis Pseudonaja Toxicocalamus Vermicella

Cacophis

Demansia

0.205 0.233 0.217 0.199 0.210 0.156 0.246 0.266

0.200 0.216 0.189 0.177 0.176 0.267 0.240

a) Within-Genus Divergence – 0.076 0.037 – 0.078 0.092 0.122 – –

Notes Only one sample – – Only one sample – – – Only one sample Only one sample

b) Between-Genera Divergence Furina Neelaps Oxyuranus Pseudechis Pseudonaja

0.230 0.214 0.218 0.175 0.298 0.216

0.210 0.221 0.163 0.274 0.196

0.190 0.110 0.295 0.213

0.170 0.299 0.227

0.220 0.181

Toxicocalamus

0.323

Vermicella


152

Tables 4.6a–b. Net (full-length) sequence divergences (listed as percentages) within and between commonly-defined species of Oxyuranus and Pseudonaja.

Genus O. microlepidotus O. scutellatus O. temporalis P. affinis P. guttata P. inframacula P. ingrami P. modesta P. nuchalis P. textilis

Species O. microlepidotus O. scutellatus O. temporalis P. affinis P. guttata P. inframacula P. ingrami P. modesta P. nuchalis P. textilis

O. microlepidotus

O. scutellatus

0.135 0.131 0.197 0.184 0.217 0.212 0.160 0.172 0.204

0.143 0.189 0.156 0.198 0.225 0.163 0.185 0.204

a) Within-Species Divergence 0.020 0.008 – 0.002 0.022 0.005 0.002 0.074 0.058 0.018

Notes – – Only one sample – – – – – – –

b) Between-Species Divergence O. P. P. P. temporalis affinis guttata inframacula

0.195 0.163 0.182 0.190 0.156 0.173 0.196

0.144 0.078 0.150 0.143 0.063 0.093

0.155 0.188 0.123 0.139 0.142

0.125 0.137 0.055 0.082

P. ingrami

P. modesta

P. nuchalis

0.167 0.102 0.134

0.127 0.139

0.071

P. textilis


153

Tables 4.7a–b. Net (full-length) sequence divergences (listed as percentages) within and between genera used in this study (modified to reflect phylogram results of Maximum Likelihood and Bayesian analyses). Genus Cacophis Demansia Furina Neelaps Oxyuranus Pseudechis Pseudonaja (- P. modesta) P. modesta Toxicocalamus Vermicella

a) Within-Genus Divergence – 0.076 0.037 – 0.078 0.092 0.091 0.074 – –

Notes Only one sample – – Only one sample – – – – Only one sample Only one sample

b) Between-Genera Divergence Genus Cacophis Demansia Furina Neelaps Oxyuranus Pseudechis Pseudonaja (- P. modesta) ‗P. modesta‘ Toxicocalamus Vermicella

Cacophis

Demansia

Furina

Neelaps

Oxyuranus

Pseudechis

0.205 0.233 0.217 0.199 0.210

0.200 0.216 0.189 0.177

0.230 0.214 0.218

0.210 0.221

0.190

0.172

0.196

0.195

0.174

0.128

0.186

0.180 0.246 0.266

0.184 0.267 0.240

0.184 0.298 0.216

0.207 0.274 0.196

0.128 0.295 0.213

0.193 0.299 0.227

Pseudonaja (- P. modesta)

0.105 0.234 0.204

‘P. modesta’

Toxicocalamus

0.251 0.173

0.323

Vermicella


154

Table 4.8. Net (full-length) sequence divergences (listed as percentages) within and between operational taxonomic units of Oxyuranus and Pseudonaja (modified to reflect phylogram results of Maximum Likelihood and Bayesian analyses, as well as to examine the possibility of a composite P. textilis). Genus

a) Within-‗Species‘ Divergence

Notes

0.020 0.008 – 0.002 0.008 0.001 0.005 0.002 0.004 0.018 0.020 0.014 0.005 0.011 0.014 0.007 0.003 0.007

– – Only one sample – – – – – – – – – – – – – – –

O. micro. O. scut. O. temp. P. aff. P. gut.1 P. gut.2 P. inf. P. ing. P. mod.1 P. mod.2 P. mod.3 P. mod.4 P. nuch.1 P. nuch.2 P. nuch.3 P. tex.1 P. tex.2 P. tex.3

b) Between-‗Species‘ Divergence Species O. micro. O. scut. O. temp. P. aff. P. gut.1 P. gut.2 P. inf. P. ing. P. mod.1 P. mod.2 P. mod.3 P. mod.4 P. nuch.1 P. nuch.2 P. nuch.3 P. tex.1 P. tex.2 P. tex.3

O. micro

O. scut.

O. temp.

P. aff.

P. gut.1

P. gut.2

P. inf.

P. ing.

P. mod.1

P. mod.2

P. mod.3

P. mod.4

P. nuch.1

P. nuch.2

P. nuch.3

P. tex.1

P. tex.2

0.100 0.100 0.197 0.188 0.198 0.217 0.212 0.200 0.182 0.197 0.181 0.222 0.185 0.186 0.215 0.207 0.205

0.100 0.189 0.164 0.166 0.198 0.225 0.223 0.179 0.184 0.196 0.210 0.209 0.207 0.222 0.203 0.202

0.195 0.171 0.172 0.182 0.190 0.183 0.183 0.187 0.187 0.193 0.203 0.184 0.208 0.201 0.194

0.146 0.161 0.078 0.150 0.198 0.176 0.168 0.161 0.079 0.087 0.108 0.101 0.101 0.098

0.028 0.157 0.193 0.178 0.158 0.146 0.148 0.158 0.169 0.170 0.154 0.147 0.146

0.172 0.200 0.178 0.177 0.160 0.168 0.173 0.183 0.181 0.171 0.164 0.164

0.125 0.195 0.157 0.167 0.160 0.019 0.105 0.102 0.087 0.089 0.091

0.188 0.183 0.203 0.203 0.128 0.125 0.124 0.140 0.142 0.139

0.119 0.111 0.124 0.189 0.191 0.167 0.212 0.203 0.195

0.057 0.062 0.176 0.186 0.177 0.167 0.179 0.168

0.050 0.165 0.190 0.178 0.183 0.174 0.170

0.160 0.183 0.170 0.166 0.161 0.164

0.097 0.101 0.091 0.089 0.088

0.045 0.106 0.106 0.096

0.121 0.122 0.111

0.018 0.021

0.012

P. tex.3


155

(2005) and this study, both show relatively high inter-specific divergences (helping to confirm species boundaries) and some high intra-specific divergences (providing a line of evidence for potential cryptic taxa as yet undefined).

Fragmented DNA sequences (107–751 bases) were extracted from 133 non-type specimens and another 11 fragmented sequences (530–752 bases) were obtained from GenBank (Appendix XI; Benson et al. 2008). Classification of sequences as informative or uninformative was influenced by their lengths, which were generally affected by fixation type (Figure 4.14). Uninformative sequences were typically shorter and more likely to have been subjected to formalin fixation, while longer sequences provided higher quality information and were recovered more often from fresh DNA (Figure 4.14). Informative sequences (69 of 144 total) consisted of fresh and formalin-fixed tissue, but in much different ratios. Eighty-one percent of fragmented sequences (30 out of 37) from fresh tissue were informative during analyses, as compared to only thirtysix percent of sequences (39 out of 107) from formalin-fixed tissue (Appendix XI). Non-formalin-fixed tissues were usually collected at the time of death and then frozen or stored directly in ethanol, minimising the significance of any comparisons of tissue fixation and storage time. For snakes with known collection dates, formalin-fixed DNA was successfully recovered from specimens stored between eight and eighty-two years (the oldest assumed storage date was 105 years), with only slight differences in the age of storage between sequences classified as informative vs. non-informative (Figure 4.15). The locations of snakes yielding full-length and informative, fragmented sequences

indicated

that

sub-clade

distributions

were

strongly

delineated

geographically. Distributions of major sub-clades of Pseudonaja guttata, P. modesta, P. nuchalis, and P. textilis are presented in Figure 4.16. In total, 388 full-length sequences and informative fragments were used in analyses presented in this chapter. Of these sequences, 135 (35%) were newly derived for this thesis.

Although there was some taxonomic separation throughout the trees produced through analyses of morphological data, most clades contained a number of taxa (Figure 4.17). Even with this general separation, the morphological results did not follow many of the same genetic patterns of divergence. It was immediately evident that, despite the fact


156

800

700

Sequence Length (bases)

600

500

400

300

200

100

0 Fresh

Formalin-fixed Fixation

No

Yes Informative

Fresh - No

Fresh - Yes

FF - No

FF - Yes

Total

Fixation x Informative

Figure 4.14. Recovered fragmented sequence lengths of known ages separated by: fixation type, the level of usable phylogenetic signal they provided, and the product of fixation type and phylogenetic signal. Legend: white vertical bar = length of sequence, white horizontal bar = mean sequence length, and black rectangle = one standard deviation.


157

a) Storage ages of DNA from sequences classified as informative 90

80

70

Age (years)

60

50

40

30

20

10

0 O. microlepidotus

O. scutellatus

P. affinis

P. guttata

P. ingrami

P. modesta

P. nuchalis

P. textilis

Total

Species

b) Storage ages of DNA from sequences classified as uninformative 90

80

70

Age (years)

60

50

40

30

20

10

0 O. microlepidotus

O. scutellatus

P. affinis

P. guttata

P. ingrami

P. modesta

P. nuchalis

P. textilis

Total

Species

Figures 4.15a–b. Storage ages of formalin-fixed specimens from which fragmented DNA was successfully extracted. Legend: white vertical bar = range of storage time, white horizontal bar = mean storage time, and black box = one standard deviation. Oxyuranus temporalis and Pseudonaja inframacula are omitted from both graphs as all sequences from these species derived from fresh tissue.


158

a) Locations of all informative sequences %# U U %

U %

U % ### U# % # U %

U %% U U %

#

# # #

#

#

# % U #

# #

## #

#

#

# #

#

#

#

##

# #

#

#

# #

#

#

#

#

U% % U #

#

# # #

%% U U

#

# # U #%

#

#

#

U % # #

#

# #

# ## # # ##

#

U# % # #

#

#

#

#

#

#

#

# ## ## ##

#

#

#

#

#

#

U %

#

#

# ## #

U % #

#

# #

# #

#

# #

# ## # #

U % U %

#

#

#

# #

U %

#

# #

#

# ##

#

# # # #

U % % U U % # # #

#

#

#

#

# #

# #

# #

U % U %

#

# U %

# # # # # # #

# ### #

## ### #

#

#

#

# #

##

# #

# ##

# # ### ## ## # # # # # ## # # ## # # # # ### ## # ## # # # # # # ##

% U ## # #

#

#

#

# # ##

## #

## #

## # #

# #

#

#

#

# # #

# #

b) Pseudonaja guttata sub-clades

c) Pseudonaja modesta sub-clades

# # #

# #

#

#

# #

# #

# #

# #

# #

# #

#

#

# #

#

#

#

#

# #

# ##

#

#

#

#

#

#

# #

#

#

# #

#

# #

# #

#

# # #

d) Pseudonaja nuchalis sub-clades

e) Pseudonaja textilis sub-clades #

### # #

#

# # #

#

# # #

#

#

#

# # #

#

#

#

#

#

#

#

#

#

#

#

# ## #

##

# # ##

#

#

#

# #

## #

#

# # # #

#

#

#

# #

# #

# ## ##

#

# #

# #

## ## # # ## # #

# #

# #

#

#

## ## #

## #

#

#

# #

# #

# #

## # #

#

#

# #

# # #

#

#

# # #

#

#

#

#

# ## #

#

# #

#

#

##

#

#

#

#

#

# #

# # # #

Figures 4.16a–e. Distributions of all informative DNA sequences, as well as of major sub-clades for Pseudonaja guttata, P. modesta, P. nuchalis, and P. textilis. Coloured dots in Figure 4.16a represent all ten species of Oxyuranus and Pseudonaja as with Chapter 1: Figures 1.1 and 1.2. Coloured dots (red, yellow, green, and blue) in Figures 4.16b–e are used to differentiate major sub-clades found in Figures 4.7 and 4.11.


159

Figure 4.17. Illustration of typical results from analyses of morphological data. Most clades contained a mixture of taxa—branch colours are only to help differentiate numbered sections of the tree. Outgroups are demarcated with a gray line, while Oxyuranus and Pseudonaja sub-clade lines are coloured as with Chapter 1: Figures 1.1 and 1.2. Taxa recovered most often in the following sections were: 1) outgroups, 2) P. nuchalis, 3) P. modesta + P. affinis, 4) P. inframacula + P. guttata, 5) P. nuchalis, 6) P. affinis + P. nuchalis, and 7) Oxyuranus + P. textilis + P. ingrami.


160

that raw measurements were standardised for size and shape, the resulting clades were organised by size. This was confirmed after comparing raw snout-vent lengths of snakes between morphological clades (Figure 4.18). Due to the apparent non-genetic congruence for morphological results, combined analyses were suspended.

Discussion

Based on the work presented here, the genus Pseudonaja is almost certainly paraphyletic in relation to the placement of P. modesta with Oxyuranus, and at least four of the species currently within Pseudonaja (P. guttata, P. modesta, P. nuchalis, and P. textilis) contain sub-clades with phylogenetic and geographic support for separation or sub-specific taxonomic recognition. Some of the results presented here are consistent with those of Skinner et al. (2005) and Doughty et al. (2007), especially with regard to evolutionary younger lineages, but they also demonstrate a pattern of differences between a few of the deeper clade arrangements. Two analyses recovered P. modesta as the sister taxon to all other ingroup taxa (Figures 4.7 and 4.11), and a third analysis recovered P. modesta as the sister taxon to Oxyuranus (Figure 4.6). This latter relationship was not as strongly supported as the idea of an early origin of the P. modesta clade. Reanalyses of published mitochondrial studies incorporating these two genera also showed surprising topological placements of the P. guttata clade, which was most often recovered earlier to all other ingroup taxa (Figures 4.12 and 4.13). Genes and sequence lengths reanalysed were identical to the original studies, indicating that possible differences in results should be addressed. These potential causes may include differences between the outgroup(s) chosen for analysis, differences due to the presence of additional specimens in this study, differences between analysis methods, differences in how each method was utilised, differences in the strength of signal of measured characters, or a combination of any of these possibilities.

There is a chance that outgroup choice may have affected the placement of P. guttata in reanalyses of previously published data (see Figures 4.12 and 4.13). There are at least two reasons why it is unlikely that alternate outgroups were the cause of most differences between studies. First, reanalyses of Skinner et al. (2005) and Doughty et al. (2007), each of which incorporates different (numbers of) taxa as outgroups, produced several similar Maximum Likelihood topologies. Second, iterative testing with various


161 a) Raw size

1600 1400

SVL (mm)

1200 1000 800 600 400 200 0 0

1

2

3

4

5

6

7

8

5

6

7

8

Clade

b) Standardised size 1800 1600 1400

SVL (mm)

1200 1000 800 600 400 200 0 0

1

2

3

4 Clade

Figures 4.18a–b. Summary graphs of snake size (raw and standardised Snout-Vent Lengths) organised by clade position (as delineated in Figure 4.17). The two groups separated in Clade 3 of the standardised graph are P. modesta and P. affinis.


162

outgroups produced near-identical results. More important than the small differences in the choice of outgroups, may be that each author included different numbers of haplotypes (109 [Skinner et al. 2005] vs. 60 [Doughty et al. 2007] vs. 171 [this thesis]) in their analyses.

Phylogenetic analyses are sensitive to taxon sampling—analyses of only a few taxa which contain many characters can lead to systematic biases, incorrect model parameters, and high levels of support for incorrect results (Sullivan et al. 1999, Heath et al. 2008). Although longer sequences may provide additional characters beneficial for analysis, several authors have shown that phylogenetic accuracy is more quickly improved with the addition of extra taxa rather than extra characters (Graybeal 1998, Poe 1998, Heath et al. 2008). In terms of Oxyuranus and Pseudonaja, mitochondrial results between studies are most similar for taxa which have been sampled in higher numbers and more thoroughly from throughout their geographic range, indicating most haplotypes of all possible are presumed to have been recovered. Correspondingly, most disagreement between past studies (regardless of the data type) involve taxa which have traditionally been sampled in the fewest numbers (Oxyuranus, P. guttata, and P. modesta). However, a case can also be made against ingroup composition as the primary cause of observed differences. In three of four reanalyses of Skinner et al. (2005), the addition of further ingroup specimens did not (greatly) change the overall relationships recovered (Figure 4.13).

Additional taxa can also benefit analyses by breaking up long branches, especially when outgroups have been poorly chosen (Stefanović et al. 2004, Bergsten 2005). Longbranch attraction is a mathematical by-product of phylogenetic analyses, whereby rapidly evolving taxa are interpreted to be closely-related, regardless of their true relationships (Page and Holmes 1998, Andersson and Swofford 2004, Felsenstein 2004). A choice of taxonomic outgroup too dissimilar to the ingroup may lead to longbranch attraction and incorrect interpretation of phylogenetic relationships. This study included additional ingroup haplotypes, included a number of different, closely-related outgroups, and followed suggestions presented by Bergsten (2005) to test for the influence of long-branch attraction. Long-branch attraction is not a likely explanation for the new phylogenetic results presented here.


163

A greater factor in the differences between studies may be the choice of analytical methods and how they were implemented. Of the three main studies of Oxyuranus and Pseudonaja which used mitochondrial data (Keogh et al. [1998] and Williams et al. [2008] are not considered due to smaller sample sizes and differences in the focus of their research), all included Bayesian analyses, two included Parsimony analyses, and one included Likelihood analyses (Table 4.9). Each of these methods may produce different results due to variations in their mathematical approach to solving phylogenetic problems (Felsenstein 1978, Hillis et al. 1996, Kolaczkowski and Thornton 2004). These variations in methodology allow for a greater belief in similar results between all studies. Among the directly comparable, Bayesian analyses, each showed alternate ancestral relationships and support, which suggests that differences may have been a function of how each analysis was run.

Although published information on the exact conditions of each Bayesian analysis is incomplete, it was noticed that all three analyses were set up differently. Skinner et al. (2005) utilised a HKY+G model of nucleotide substitution of unpartitioned data. Despite sharing more than half of the same sequences as those of Skinner et al. (2005), Doughty et al. (2007) and this study determined that using a GTR+I+G model of nucleotide substitution for all partitions was more appropriate. Keogh et al. (1998) demonstrated that altering the conditions of an analysis could greatly change subsequent results (in their case, the relationship of Oxyuranus with P. modesta, as determined by Parsimony analyses), an idea contradicted by Skinner et al. (2005) who mention that their own unpublished results of analyses of partitioned data were similar to those presented of their unpartitioned data. However, in early analyses (not presented here), results similar to Skinner et al. (2005) were obtained only after all partitions and model assumptions had been removed. All studies also used different numbers of generations, runs, and chains. Rather than letting the new analysis run for an arbitrary length of time, the new analysis was stopped after the average standard deviation of split frequencies reached < 0.01, resulting in a lower number of generations in a single run. However, due to the historical complexity within the taxa involved, a higher number of heated chains and an increased number of independent runs (which gave a higher number of overall generations) were utilised to enable greater credibility of any results obtained. Again, results presented in this chapter were consistently reproduced after reanalyses of data under similar and previously published conditions.


164

Table 4.9. Comparison of published bootstrap support for the relationships between Oxyuranus and Pseudonaja. Note that although bootstrap values give an overall indication of general support from each analysis, they are only directly comparable within each analysis type. All values taken from 50% majority-rule consensus trees except for the Parsimony analysis of Skinner et al. (2005), which was taken from a strict consensus tree.

Bayesian Relationship Oxyuranus > Pseudonaja Oxyuranus > P. guttata > All others Oxyuranus > P. guttata > P. modesta Oxyuranus + P. modesta Oxyuranus + P. modesta > All others Oxyuranus + P. modesta > P. guttata > All others P. modesta > All others P. modesta > Oxyuranus > All others P. modesta > Oxyuranus > P. guttata > All others

Parsimony

Likelihood

Skinner et al. (2005)

Doughty et al. (2007)

This Study

Skinner et al. (2005)

This Study

This Study

100

–

–

100

–

–

66

–

–

59

–

–

84

–

–

Not specified (< 50)

–

–

–

Not specified (< 95)

–

–

25

–

–

≥ 95

–

–

68

–

–

≥ 95

–

–

32

–

–

–

100

–

–

99

–

–

77

–

–

49

–

–

67

–

–

56


However, during numerous reanalyses of the data, a subset of results were similar to those of Skinner et al. (2005) or Doughty et al. (2007), especially in relation to the placement of Oxyuranus, P. guttata, and P. modesta. A final and more serious problem in the interpretation past results is that there may not have been enough signal present in the characters analysed (773 mitochondrial bases) to provide consistently high or stable results between all taxa. Thus, the ancestral arrangements observed during the various Bayesian analyses may be a result of nearly equal posterior probabilities of highly likely trees. Incorporating additional, informative characters to the analysis may be a solution to this problem, but if the additional data were genetic, there may be relatively little merit in surpassing 1,000 bases, at least in terms of phylogenetic error (Rannala et al. 1998, Pollock et al. 2002, Rosenberg and Kumar 2003, Hillis et al. 2003, Heath et al. 2008). The lack of (and potential for increased) signal is not solely the domain of molecular data.

Many of the ancestral arrangements presented here have been observed or hypothesised in previously published analyses of ecological, morphological, karyomorphic, mitochondrial, and electrophoretic data (Mengden 1985a, Wallach 1985, Shine 1989, Keogh et al. 1998, Doughty et al. 2007). They, too, often produced lower levels of support for some of their results. As discussed above, low support may have two potential causes: inappropriate samples or too few (informative) characters. The former can be easily increased to help improve support, but choosing suitable characters can be difficult, especially if the lineages being examined have undergone rapid or recent evolutionary events. In an examination of morphology, Skinner (2009) was able to correlate several previously-published morphological traits with his mitochondrial clades using multivariate statistical analyses, but the majority of the morphological characters subsequently used to describe recognised species were not subjected to the same analyses. Although all characters (regardless of type) would not be expected to be informative, an attempt to analyse all morphological characters in a phylogenetic framework was not successful (Figure 4.17). In an effort to uncover ‗true‘ evolutionary relationships, laboratory analyses were extended to include formalin-fixed or historically-old tissue. Informative DNA was obtained from less than forty percent of formalin-fixed tissues analysed. The additional


166

use of DNA extracted from old or formalin-fixed tissue was helpful to extend the ranges of known clades (see Chapter 5 for final maps), but was not as effective as hoped in identifying specimens in remote areas or previously-unexamined (genetically) subspecies. This may be due to the accumulated negative effects of formalin fixation and long-term storage, or possibly because the genetic composition in these areas and taxa is significantly different from the genetic composition of the snakes which were used when designing primers for this study. Further analyses are needed of Oxyuranus scutellatus from the Kimberley region of Western Australia and of Pseudonaja nuchalis from the Cape York Peninsula of Queensland. Fresh tissue from these species in these areas is non-existent within natural history and molecular collections, human population density is low in these areas (meaning fresh tissue is not likely to be easily found), and formalin-fixed specimens of these species from these areas are few in number, old, and analysis of their sequences have been uninformative. Given the negative effect on species diversity by the distributional progression of the cane toad (Bufo marinus; historically through Cape York and currently into Western Australia), it may be unlikely that fresh tissue will ever be found (Burnett 1997, Phillips et al. 2007, Urban et al. 2008). Without any further progress in research on recovery and repair of chemicallytreated DNA, there may always be unresolved issues in terms of Oxyuranus and Pseudonaja phylogenies. In terms of ‗advancement‘, past and current presentations of brown snake and taipan molecular data have strengthened many of the taxonomic hypotheses originally proposed based on morphological insights or data. But these presentations have typically also included results which do not concur with previous research or which contain middling levels of support. Based on its past use with Oxyuranus and Pseudonaja, molecular analyses have been a confirmatory tool, no more or less effective than analyses of morphological data. In fact, ignoring the writings of Hoser (such as his self-published output in 2009), which are used to apply taxonomic names to published clades produced by other authors, the description of Oxyuranus temporalis as a new species of taipan is the only case in which molecular data was the primary reason behind a new hypothesis and understanding of the systematic relationships of Oxyuranus or Pseudonaja (Doughty et al. 2007). Should it ultimately be validated, the placement of Pseudonaja modesta as the sister group to Oxyuranus and all other Pseudonaja may be the second.

CHAPTER 5 – A REVIEW OF EVIDENCE—INCLUDING NEWLY COLLECTED MORPHOLOGICAL DATA FROM THROUGHOUT AUSTRALIA, RELATING

INDONESIA, TO

AND

SYSTEMATIC

PAPUA-NEW

HYPOTHESES

GUINEA— INVOLVING

OXYURANUS AND PSEUDONAJA

Abstract

European records of Oxyuranus and Pseudonaja cover a time period of over 140 years and have led to dozens of hypotheses regarding the systematic relationships within and between these two snake genera. The large amount of past evolutionary supposition has not been matched by similar amounts of scientific investigation. The few previous systematic and nomenclatural analyses of brown snakes and taipans have tested differing hypotheses while utilising a range of sample sizes and methods. Not surprisingly, previous genetic and morphological research on the snakes of Oxyuranus and Pseudonaja have led to results which show some inconsistent systematic relationships and which have as yet failed to help produce a useful identification guide. This chapter presents a full synthesis of available genetic and morphologic evidence for all previous (and some new) taxonomic hypotheses of the genus- and species-level evolutionary relationships of Oxyuranus and Pseudonaja. This evidence is bolstered with new morphological data measured from 1,416 Oxyuranus and Pseudonaja specimens, which were selected from throughout their known distributions as part of a systematic, grid-based sampling strategy. Most recent taxonomic claims published without benefit of any formal evidence were shown to be invalid. The evidence herein justifies recognition of several previously (and newly) hypothesised taxa, and new morphological analyses have led to the creation of an updated, highly accurate (94.5%) identification guide for use with recognised taxa.

Keywords: Distribution Map, Identification Guide, Morphology, Pseudonaja, Research Design, Systematics, Taxonomy.

Oxyuranus,

Chapter 5: Morphological Redescription

168

Introduction

Though the systematic resolution of the genera Oxyuranus and Pseudonaja (Serpentes: Elapidae) may still be unfinished (see Chapter 4), these genera are currently thought to represent at least 10 species. The exact number of species recognised by the taxonomic community has varied through time, with a renewed interest in the subject matter evident through the past thirty years (e.g., see Mengden 1982, Wells and Wellington 1983, Cogger 2000, Skinner 2009, Appendices I and II). Many of these species have become well-known, even outside of the wider herpetological community (hobbyists, breeders, naturalists, etc.), due to their distributional proximity and potential danger to humans. Historically, high interest in these snakes shown from the general public has rarely been matched with correspondingly large amounts of academic-based research (with the exception of venom-related, medical studies). The scarcity of ecological and systematic research on species of this genera can perhaps be attributed to three main reasons. First, only a few of the ten most-commonly recognised species of Oxyuranus and Pseudonaja could be considered common (or as having a wide distribution), making it difficult to conduct research using meaningful amounts of samples. Second, a brown snake or taipan bite has potentially lethal consequences, making it easier for scientists to choose more benign research subjects. Finally, some published results have been contradictory (potentially due to the composite nature of these taxa), which may have affected perceptions of Oxyuranus and Pseudonaja, and thereby hindered the onset of new investigations.

The dearth of elapid work (especially systematics-based) has led to some sceptical views on Australian herpetological systematists and taxonomists. The arguments for and against are familiar and perhaps not fair to nor completely accurate about either side of the discussion. These views can be summarised as such: those who are the keenest and may know the most about distributional variation (the hobbyists) often lack the resources necessary to conduct research, and those with opportunities and resources (the academics) are often not interested in conducting research, or doing so in a timely manner (Wells and Wellington 1983, Wüster et al. 2001, Williams et al. 2006, Hoser 2009). These feelings, in conjunction with the principle of priority of authorship and the minimal standards necessary for taxonomic publication (as detailed in Chapter 2), have led to a number of hurried publications from both scientists and non-scientists. Partially


169

as a result of this, Oxyuranus and (especially) Pseudonaja still lack conclusive systematic resolution and a definitive way to identify these taxa easily from throughout their distribution.

Discounting original descriptions, taxonomic work involving these snakes has been infrequent and often controversial. In 1983, Wells and Wellington proposed a radical new taxonomy of Australian Reptilia, a taxonomy which was based on the resurrection of most species and generic names from synonymy. Despite the claim that they had examined nearly 40,000 specimens for their work, no supporting data or analyses were presented (Wells and Wellington 1983). At least two subsequent publications were similar in their content: opinion masked as taxonomy, little to no synthesis of past taxonomic hypotheses (including their own), and no presentation of data or analyses (Wells and Wellington 1985, Wells 2002). Although they provided an alternate rationale (―...to stir others into action.‖), Wells and Wellington (1983) understood and wrote that most people would consider them to be taxonomic vandals.

Wüster et al. 2001 and Williams et al. 2006 have attributed similar and additional duplicity to the published output of Raymond Hoser, the quality of which has ranged from bad (taxonomic ‗prospecting‘, usually based on previously-published works or ideas, many of which were continuing to be worked on by the original authors; see Hoser 2003a, 2003b, 2009) to worse (taxonomic ‗theft‘, usually taken directly from or in anticipation of an imminent publication by additional authors; see Hoser 1998, 2009). Hoser‘s publications are similar to those of Wells in that no analyses were presented, it is unlikely that most type specimens had been examined, and that references to his own, previous output showed inconsistency as to what he considered to be valid taxa. Professional taxonomists typically disapprove the approaches taken by Hoser and Wells, in which the letter of taxonomic regulations has (usually) been satisfied, but basic or prescribed ethical and scientific principles have not been followed (IZCN 2000, Wüster et al. 2001, Williams et al. 2006, Borrell 2007). Many of the practices illustrated above have been criticised previously (see Wüster et al. 2001 or Williams et al. 2006).

Published scientific work can also be scrutinised (partially detailed in Chapter 2), especially if professional scientists have engaged in behaviour which they had previously criticised. For instance, Williams et al. (2008) investigated and speculated


170

about the taxonomic status and presumed dispersal patterns of P. textilis in Australia and Papua New Guinea, despite possessing a small amount of samples for analysis, as well as knowing of and being in contact with at least two (and perhaps three) other groups working on the same topic in pre-existing studies. These are behaviours which some of the authors of Williams et al. (2008) had previously disavowed (Wüster et al. 2001, Wüster et al. 2005, Williams et al. 2006). Additional criticisms of academicbased work have been made about the length of time taken to present one‘s research (see Chapter 2 for more discussion) and the completeness of one‘s research. The former argument was made to justify the publication of Wells and Wellington‘s original revision of Australian herpetology (Wells and Wellington 1983, Williams et al. 2006, Wells personal communication). Lengthy delays were not a problem for the formal description of a third species of taipan (O. temporalis), which was based primarily on the results of phylogenetic analyses of mitochondrial DNA (which is inherited maternally). Though O. temporalis is known only from one specimen taken from a location predicted to be within the range of O. microlepidotus, and though the authors discuss the fact that O. temporalis may be a hybrid, tests of nuclear DNA (which is inherited from both parents) were not conducted (Longmore 1986, Doughty et al. 2007). This may have been due to the fact that the description was accelerated through the publication process in order to minimise the chances that amateur taxonomists (especially Hoser) could publish first (P. Doughty and B. Maryan personal communication). Although a comprehensive and definitive write-up may not be possible with every systematic investigation, modern scientific equipment and communication systems make it far easier for systematists and taxonomists to produce informative research. There seems to be no valid reason to produce taxonomic dispatches (whether by amateurs or professionals) based on observations or hypotheses without support of sufficient evidence, as was often done by early taxonomists who were working with less material and with fewer analytical resources.

In short, the ideas published by each of the authors cited above (amateur or professional) may, empirically, be valid. But in their presentations of data and results (or lack thereof), these authors have provided ammunition to their detractors and provided glimpses of how taxonomy could be improved. The cumulative effects of each of these ‗errors‘ may be one of the reasons, as discussed in Chapter 4, there are still unanswered questions relating to the relationships within and between Oxyuranus and


171

Pseudonaja. Other than major species-level groups, almost no previous taxonomic hypothesis has been explicitly examined or tested for morphologic support, and few authors have attempted to synthesise known information into a workable key. Such an undertaking would be useful for the multitude of professional and amateur biologists interested in these snakes or who are responsible for their management, would provide a further line of support for any recognised taxa, and should be minimally included within any revisionist research project. Accordingly, this chapter presents the results of morphological analyses of Oxyuranus and Pseudonaja from throughout their distribution, examines previous hypotheses about their evolutionary relationships, summarises the evidence for or against all previously- and newly-described taxa, and presents a working identification guide valid throughout their distributional range. (Note that the identification key presented in Chapter 2 was a product of a test of the methods used in this thesis and of larger species ideas. It was not meant to be a final identification guide, as it did not include an examination of the subgroups presented here.)

Materials and Methods

Ten species (Oxyuranus microlepidotus, O. scutellatus, O. temporalis, Pseudonaja affinis, P. guttata, P. inframacula, P. ingrami, P. modesta, P. ‘nuchalis’, and P. textilis) were selected for analysis as detailed in Chapter 2. In brief, information (e.g., species name, collection date, and collection location) was obtained on 9,087 brown snakes and 485 taipans held in museums or natural history collections in Australia, Europe, and North America (Chapter 1: Figures 1.1 and 1.2). As there have been a variety of conflicting arrangements presented about most of these taxa (Appendices I and II), each species was not assumed to be composite for the purposes of specimen selection, (e.g., Wells and Wellington 1983, Cogger 2000, Skinner 2009, Hoser 2009). For each species, one snake was randomly chosen from each grid cell in a 1° x 1° grid covering individual species distributions (Haahr 2007). Snakes selected for detailed measurement were not preferentially chosen according to their size, age, or gender as has been reported in other studies (such as Werner et al. 1999 or Skinner 2009). Hence, the snakes utilised in this study can be assumed to be a random assortment of sizes, ages, and genders taken from available museum specimens.


172

All external morphological characters from Oxyuranus and Pseudonaja literature were recorded for measurement (Appendices IV and XII). During preliminary examinations of snakes held in private collections, the Queensland Museum, and the Northern Territory Museum and Art Gallery, 75 additional patterns of morphological variation were noted and added to the analysis (Appendix IV). Measurements consisted of several different character types, including continuous (e.g., tail length), ratio (e.g., tail length divided by total length), meristic (e.g., number of subcaudal scales), angle (e.g., interior angle of rostral scale), categorical (e.g., are subcaudal scales single, paired, or a combination of both?), and binomial (e.g., does the preocular scale touch the nasal scale?). A final total of up to 313 morphological characters were recorded or calculated from measurements of all snakes (Appendices IV and V). In the event of damaged or missing body parts, individual measurements may not have been possible to collect. For example, either due to storage issues associated with their relatively larger size or due to capture methods utilised to overcompensate for potentially life-threatening bites, many Oxyuranus specimens in museums consist only of a head and neck (and sometimes a tail). Snakes missing significant portions of their bodies were excluded from the main analyses described below. Most specimens had at least some missing measurements (see Results), presumably due to natural morphological variation or damage during capture. As some statistical analyses and software do not permit missing values in a data matrix, characters which could not be recorded from snakes which were otherwise intact were extrapolated from existing data. Continuous, ratio, and angular characters were regressed with species-specific snout-vent lengths and missing values replaced accordingly. Angle measures were then converted to linear equivalents with the following equation: Cosine of ([Anglemeasured * π] / 180). Missing meristic, categorical, and binomial characters were replaced with their modal values within each species. All characters which showed little to no variation (affecting the ability to utilise multivariate analyses) were removed prior to analyses.

To remove the effects of size from analyses, most continuous-type measures are scaled by some value; with snakes, this is typically either the snout-vent length or the total body length. Although preliminary analyses showed this technique to be relatively effective to consistently separate known taxonomic groups, to be as comparable as possible with the previous morphometric examinations of Pseudonaja (Skinner 2003, 2009), the shape standardisation technique of Lleonart et al. (2000) was utilised with


173

continuous data. This method involves scaling all continuous measures to an averaged value of a pre-selected variable (gender-specific snout-vent length in Skinner 2003, gender-specific head length in Skinner et al. 2005 and this study). One of the main problems associated with this technique is the assumption of equal growth patterns among all taxa analysed, an idea easily dismissed when comparing total lengths of Oxyuranus scutellatus and Pseudonaja modesta (the differences in adult body lengths can be over two metres). To minimise this problem, and given that no previous molecular or morphological analyses had synonymised any of the ten taxa chosen for analysis, each snake was scaled to a gender- and species-specific average head length (rather than a grouped-species average head length). Measurements scaled in this way may reduce covariation associated with size and shape, but without significantly reducing the overall (scale of) variation in size (Figures 5.1a–d). Similar results were obtained whether or not a gender-specific standardisation was used and the results listed here reflect the use of a gender-specific standardisation in order to compare results directly with results from previous studies. Unlike previous studies, all graphs include both genders (and juveniles) in order to comprehend the full range of morphological variation present within each taxon. Further standardisation of data proved to be unnecessary, yielding the same results as non-standardised data, and was not employed in final data analyses.

The results from Chapter 4 influenced the progression of the iterative analyses presented here. Morphologic data collected from snakes considered to be genetically ‗informative‘ in Chapter 3 were tested using principal components analyses (PCAs), with results labelled by genetic (sub-)clade assignment. The numbering scheme used for labels was employed for classification purposes and to help visualise the results geographically. The locations of successfully partitioned, genetically informative snakes were plotted to create minimum convex polygons in ArcGIS 9.3 geographical information systems software (ESRI 2005). Snakes contained within the non-overlapping geographic extent of all sub-clades were selected, subjected to a new round of PCAs, and again labelled by their respective sub-clades. A third round of this process was undertaken to include nearby snakes not found within the geographic distribution of any clade, as well as snakes found within areas of overlap between two or more (sub-)clades. Final group assignments were used in multivariate and univariate examinations of past taxonomic hypotheses and questions (see Results), as well as to examine the strength of

174

a) Raw

b) Raw

Snout-Vent Length as a Function of Head Length

Tail Length as a Function of Head Length

80

80

70

70

60

60

50

50 HL

HL


40

40

30

30

20

20

10

10

0

0 0

500

1000

1500

2000

2500

3000

0

50

100

150

200

250

300

350

400

TVL

c) Standardised as per Lleonart et al. (2000)

d) Standardised as per Lleonart et al. (2000)

Snout-Vent Length as a Function of Head Length

Tail Length as a Function of Head Length

60

60

50

50

40

40

HL

HL

SVL

30

30

20

20

10

10 0

0 0

500

1000

1500 SVL

2000

2500

0

50

100

150

200

250

300

350

400

SVL

Figures 5.1a–d. Two examples of removing the effects of size and shape from all snakes. The scale of measurements are similar between data sets.


175

morphological relationships within and between taxa as originally described. At each stage of analysis, discriminate function analyses (DFAs) were run to see how well multivariate, morphological data could be used to predict group membership, as well as to compare with previously published PCA and DFA results (see Results for more discussion about this latter point). After acceptance of taxonomic limits (geographic and morphologic, each influenced by genetic limits) of non-damaged individuals, additional analyses were performed to predict the group status of type specimens and of snakes with increased amounts of damage (both groups had previously been withheld from initial analyses). These results were used to generate final distribution maps and an identification guide for use with all taxa recognised here.

Results and Taxonomic Summaries

Past researchers have used widely varying numbers of characters and specimens in their analyses of Oxyuranus and Pseudonaja (Figures 5.2–5.3, Tables 5.1–5.2, and Appendix XII). Two hundred and thirty-eight out of two hundred and forty-six external characters identified in taxonomic literature associated with Oxyuranus and Pseudonaja were measured (Tables 5.1–5.2, Appendix IV, and Appendix XII). Eight characters were not measured due to faded or absent colours of preserved specimens (Eye Colour, Iris Colour, Pupil Colour, and Tongue Colour), due to a lack of published definition on how to measure the character (Lingua Fossa and Tail Shape), or if the character could not be consistently measured (Umbilicus Scar and Body in Cross-Section). Seventy-five new characters were identified in pilot studies, giving a possible 313 characters for analysis. Nine characters were invariant for all taxa and removed from analyses (Number of Supralabial scales touching the eye? [2], Number of Supralabials in contact with the Nasal scale? [2], Number of Parietal scales? [2], Number of Postgenial scales? [2], Number of Pregenial scales? [2], Presence of a Loreal scale? [not present], Do Internasal scales touch the Preocular scale? [no], Presence of Subocular scales? [not present], and Do Preocular scales touch the Frontal scale? [no]). Examinations of specific taxonomic hypotheses which analysed a reduced data set (such as an assessment of P. affinis subspecies) revealed further invariant characters. These characters were removed from hypothesis-specific analyses and are presented in the appropriate sections below.


176

Figure 5.2. Data summarising the total characters measured by the authors listed in Table 5.1, new characters (not mentioned in previous publications) measured by the authors listed in Table 5.1, cumulative new characters (equivalent to all unique characters) measured by the authors listed in Table 5.1, and specimens examined for each new taxonomic description and major review of Pseudonaja by the authors listed in Table 5.1. Where reviews did not provide the numbers of snakes examined, one snake was allocated for every (sub-) species listed within the review. In these cases, the total amount of snakes actually examined may be overestimated or (presumably) underestimated. Totals from 2010 which are out of range of graph include All Characters Described (313) and Specimens Examined (1299).


Figure 5.3. Figure summarising the total characters measured by the authors listed in Table 5.2, new characters (not mentioned in previous publications) measured by the authors listed in Table 5.2, cumulative new characters (equivalent to all unique characters) measured by the authors listed in Table 5.2, and specimens examined for each new taxonomic description and major review of Oxyuranus by the authors listed in Table 5.2. Where reviews did not provide the numbers of snakes examined, one snake was allocated for every (sub)species listed within the review. In these cases, the total amount of snakes actually examined may be overestimated or (presumably) underestimated. Total from 2010 which is out of range of graph is All Characters Described (313).

177


178

Table 5.1. Data summarising the total characters measured by the listed authors, new characters (not mentioned in previous publications) measured by the listed authors, cumulative new characters (equivalent to all unique characters) measured by the listed authors, specimens examined for each new taxonomic description and notable review (bolded year) of Pseudonaja by the listed authors, and an estimate of the specimens available for analysis during the decade the analysis was undertaken (calculated from museum records). Where reviews did not provide the numbers of snakes examined, one snake was allocated for every (sub)species listed within the review. In these cases, the total amount of snakes actually examined may be overestimated or (presumably) underestimated.

Author Duméril et al. Fischer Günther Jan Fitzinger Jan Steindachner Günther McCoy McCoy De Vis Macleay Boulenger Boulenger De Vis Longman Waite Parker Hunt Mitchell Worrell Gillam Mengden Wells and Wellington Mengden Wells and Wellington Storr Cogger

Year

Total New Characters Characters

Cumulative Snakes Snakes New Examined Available Characters

1854

46

46

46

1

10

1856 1858 1859 1861 1863 1867 1872 1879a 1879b 1884 1885 1896 1908 1911 1915 1925 1926 1947 1951 1961 1979 1982

113 70 33 0 1 43 41 35 50 28 18 63 51 45 60 60 55 27 45 41 46 1

90 14 6 0 0 3 6 8 6 2 1 5 0 3 9 4 3 0 2 1 9 1

136 150 156 156 156 159 165 173 179 181 182 187 187 190 199 203 206 206 208 209 218 219

1 4 3 1 1 1 4 8 6 1 3 28 1 1 1 2 2 8 110 2 271 41

10 10 10 58 58 58 77 77 77 95 95 244 390 699 699 1020 1020 2677 3273 4446 6036 7579

1983

0

0

219

12

7579

1985

8

1

220

160

7579

1985

29

3

223

21

7579

1989 2000

20 37

1 1

224 225

16 7

7579 9087


179


Total New Characters Characters

Cumulative Snakes Snakes New Examined Available Characters

Author

Year

Wells

2002 2003a, 2003b 2003, 2009 2009

58

0

225

18

9087

29

1

226

4

9087

73

7

233

291

9087

29

0

233

12

9087

2010

313

75

308

1416

9087

Hoser Skinner Hoser Gregory (this thesis)

A total of 1,416 snakes were measured: 409 females, 692 males, and 315 of unknown gender (typically hatchling snakes, young snakes less than 400 millimetres in total length, or snakes stored with only a head and/or tail). All but P. guttata and P. modesta showed divergence between genders in multivariate analyses of morphological data (gender results are graphed within each species account presented below). Two hundred and five snakes were considered damaged (average of 22.32 missing or unmeasurable characters) and removed from the main analyses (gender ratios remained almost identical after this data reduction). Two hundred and sixty-one snakes were completely intact (all characters measurable) and included with all analyses. The remaining 950 snakes were considered minimally damaged (average of 4.77 missing or unmeasurable characters) and included with all analyses. Overall, approximately 2.05% of 443,208 external morphological measures were estimated before use in multivariate analyses.

Assessments of commonly-recognised species names and genetic (sub-)clades (presented in Chapter 4) using discriminant function analyses were largely congruent with expected groups and had high support (Table 5.3). Minimum convex polygons constructed from P. modesta, P. ‘nuchalis’, and P. textilis informative specimens and sub-clades contained 65.6% of non-damaged, non-type specimens of these species (589 out of 898). These 589 specimens also showed high congruence with expected groups and large support within discriminant function analyses (Table 5.3). In general, mean


180

Table 5.2. Data summarising the total characters measured by the listed authors, new characters (not mentioned in previous publications) measured by the listed authors, cumulative new characters (equivalent to all unique characters) measured by the listed authors, specimens examined for each new taxonomic description and notable review (bolded year) of Oxyuranus by the listed authors, and an estimate of the specimens available for analysis during the decade the analysis was undertaken (calculated from museum records). Where reviews did not provide the numbers of snakes examined, one snake was allocated for every (sub)species listed within the review. In these cases, the total amount of snakes actually examined may be overestimated or (presumably) underestimated.

Author

Year

Total Characters

New Characters

Cumulative New Characters

Snakes Examined

Snakes Available

Peters McCoy Macleay Boulenger De Vis Kinghorn Thomson Kinghorn Slater Covacevich and Wombey Covacevich et al. Cogger Hoser Doughty et al. Hoser Gregory (this thesis)

1867 1879 1881 1896 1911 1923 1933 1955 1956

33 24 35 48 44 49 58 37 70

33 7 14 20 3 7 7 1 14

33 40 54 74 77 84 91 92 106

1 2 1 3 1 2 4 2 1

1 3 4 4 8 10 27 58 58

1976

8

2

108

16

209

1980

41

6

114

17

320

2000 2002

16 38

1 7

115 122

2 1

418 418

2007

70

14

136

46

418

2009

31

0

136

2

418

2010

313

75

211

117

418


181

Table 5.3. Support for predicted species and clade classification based on initial DFAs. The terms ‗Correct‘ and ‗Incorrect‘ refer to the assignment of specimens to expected groups and to unexpected groups, respectively.

Species Check Mean Mean ‗Correct‘ Support: Support: / Possible ‗Correct ‗Incorrect ‘ ‘

Clade Check Mean Mean ‗Correct Support: Support: ‘/ ‗Correct ‗Incorrect Possible ‘ ‘

Genetically 190/190 100% N/A 173/184a 97.8% 76.2% Informativ e Minimum 587/588 99.9% 100% 551/588 99.0% 84.6 Convex Polygon Nondamaged, 1179/1193 99.7% 88.4% N/A N/A N/A b Non-type Specimens a Snakes from O. microlepidotus, P. guttata, and one sub-clade of P. nuchalis could not be included in analysis due to low sample sizes. b

Eighteen snakes were listed as ―species unknown‖ by museum staff. These snakes

were removed from this first analysis.

support values for snakes assigned to unexpected groups were lower than mean support values for snakes presumed to have been assigned correctly (Table 5.3). Results showing the natural grouping of commonly-recognised taxa combining all genders and size classes can be found in Figures 5.4a–h. However, commonly-recognised taxa may not reflect total taxa present in nature. Thus, further and more specific systematic and taxonomic hypotheses must be addressed. Past and new hypotheses are reviewed below, including summaries of previously-published evidence, Chapter 4 molecular results, and results of new morphological analyses. For the latter, PCA results are presented as the determinant of group structure and, for comparison, DFA results are also included. Where appropriate, new results are compared with DFA results of Skinner (2009), which were assumed to be a proxy for his unpublished PCA analyses (see Discussion).


182

a) Initial Informative specimens from molecular analyses: PCA

b) Same as previous: DFA 15

10 P. affinis P. guttata P. inframacula P. ingrami P. modesta P. 'nuchalis' P. textilis O. microlepidotus O. scutellatus

5

10

5

Factor 2

Root 2

0


-5

-5

-10

-10 -20

-10

0

10

20

-15 -40

-30

-20

-10

0

10

30

40

50

60

Root 1

20

Factor 1

c) Specimens contained within minimum convex polygons of above: PCA

d) Same as previous: DFA 15


5

10

5

Factor 2

Root 2

0

0

-5

P. affinis P. guttata P. inframacula P. ingrami P. modesta P. 'nuchalis' P. textilis O. microlepidotus O. scutellatus

-5

-10

-10

-15 -50

-40

-30

-20

-15 -40

-30

-20

-10

0

10

-10

0

10

20

Root 1

20

Factor 1

e) Non-damaged specimens: PCA

f) Same as previous: DFA 18


5

15

12

9

Factor 2

0 6

3

-5

P. affinis P. guttata P. inframacula P. ingrami P. modesta P. 'nuchalis' P. textilis O. microlepidotus O. scutellatus

0

-10

-3

-6 -15 -35

-30

-25

-20

-15

-10

-5

0

5

10

15

20

-9

Factor 1

-45

g) Close-up (new analysis) of overlapping (from above) Pseudonaja species: PCA

-35

-30

-25

-20

-15

-10

-5

0

5

10

15

h) Same as previous: DFA 2 P. affinis P. inframacula P. ingrami P. 'nuchalis' P. textilis

15 P. affinis P. guttata P. inframacula P. ingrami P. 'nuchalis' P. textilis

10

-40

0

-2

Factor 2

5

-4 0

-6

-5

-8

-10 -25

-20

-15

-10

-5

0

5

10

15

20

-6

-4

-2

0

2

4

Factor 1

Figures 5.4a–b. Generalised results combining all size classes and genders for commonly recognised Oxyuranus and Pseudonaja species. These classifications were used as the basis for further, more specific systematic and taxonomic investigations.


183

Pseudonaja affinis – Pseudonaja affinis was originally described by Günther in 1872, primarily on the basis of possessing 19 mid-body dorsal scale rows (MDSR). Two subspecies of P. affinis were later described from islands in Western Australia (WA)— each normally possesses 19 MDSR. Wells (2002) elevated P. affinis into its own genus, Dugitophis, without benefit of any data or analysis. A third subspecies was erected by Hoser (2009) based on the presence of 17 MDSR, geography (South Australia [SA] only), and a large and conspicuous rostral scale (as compared to the supposedly smaller rostral scale of WA P. affinis). None of these issues have been addressed (directly) by previous authors.

Is there support for elevation of P. a. exilis or P. a. tanneri from the level of sub-species to species? In his Ph.D. thesis (1982), Greg Mengden only examined the karyotypes of specimens from Western Australia: P. a. affinis from Esperance and P. a. tanneri from Boxer Island. He reported no differences between karyomorphs from the two locations and sub-species. Analyses of fresh and formalin-fixed mitochondrial DNA revealed shared haplotypes and no separate sub-clades between P. a. affinis (SA and WA), P. a. exilis, and P. a. tanneri (Chapter 4 and Appendix X). Although the maximum size of island subspecies of P. affinis tends to be smaller than the maximum size of their mainland counterparts, many of the original sub-specific diagnoses for insular P. affinis are ‗incorrect‘ or only partially ‗correct‘ (Table 5.4). Multivariate analyses (PCA) of morphological data show a fair amount of overlap between all P. affinis subspecies (Figure 5.5a). It is unlikely that either insular subspecies should be recognised as a full species, an idea which could be further resolved with karyotype data from P. a. exilis or any comparative breeding data.

Is there support for a species-level taxonomic split of nominal P. affinis based on the number of mid-body dorsal scale rows (17 vs. 19) or geography (Western Australia vs. South Australia)? As stated above, Mengden (1982) only examined the karyotypes of P. affinis specimens from Western Australia. However, Mengden (1982) also listed that a potential P. affinis x P. nuchalis hybrid from Nullarbor, SA, was examined (listed at the end of the P. affinis section of specimens examined). Results from this animal are not explicitly presented, so it is unknown which species account (P. affinis or P. nuchalis) contains the results obtained from this specimen or if the results were omitted from both species accounts. If Mengden (1982) included the results within P. affinis, it would be


184

Table 5.4. Summary results of previously-published diagnostic characters of insular Pseudonaja affinis, compared across main P. affinis subspecies.

Character Smaller Total Length (mm)1 Shorter Tail Length (mm) More DSR Before Vent (≥ 17) Fewer Subcaudal Scales (mean)

P. a. affinis 788–1387 109–211 36/100 49–67 (59) 2: 71/100 3: 29/100

P. a. exilis P. a. tanneri 753–1065 856–1258 110–156 124–180 20/22 7/10 50–56 54–60 (53) (57) 2: 11/22 2: 9/10 More Postocular Scales 3: 11/22 1: 1/10 Much Darker Adult Colouration Not Assessed2 More Slender Habit Not Assessed3 Hemipene Morphology Not Assessed4 1 Worrell stated that P. a. affinis reach lengths of up to 6 feet (1829 mm). Data collected for this thesis do not support this statement. 2

Relative colouration was not assessed due to the lightening effects of museum storage in ethanol. Although P. a. exilis tend to have a consistent, darker appearance, P. a. affinis may be completely dark and mainland juveniles may appear similar to insular adults, rendering this character of limited use.

3

Habit was not assessed as no explanation about the character or how it was measured was given by Storr (1989).

4

Hemipene morphology was not assessed as it was considered to be an internal character, and thus not appropriate for the external analyses used in this study.

the only South Australian P. affinis he analysed and potentially demonstrate karyomorphic overlap with this region. A map of P. affinis specimens examined by Skinner (2009) showed three morphologically homogenous groups: the broader WA P. affinis distribution, the SA Nullarbor region, and the broader SA P. affinis distribution. Skinner (2009) labelled his multivariate results by clade group from his genetic analyses (2005), masking any evidence of geographic homogeneity in his P. affinis graphs.

Multivariate results (PCA) show that geographic groups are not completely homogenous, though most SA and 17 MDSR snakes are distributed toward one end of the graph (Figures 5.5c and 5.6a). This segregation is less apparent if the character ‗MDSR‘ is removed from the analyses (Figure 5.6c), and no differences are seen if


185

a) Island vs. mainland: PCA


10 Mainland Island 8

20 6 0

2

-20 Root 1

Factor 2

4

0

-40 -2

-4

♂

♀

?

-6

-60

-80 -8 -20

-15

-10

-5

0

5

10

15

Mainland Island

20

Factor 1

-100

c) South Australia vs. West Australia: PCA

d) Same as previous: DFA 30 WA SA

10 WA SA

25

8

20

6

15

2

Root 1

Factor 2

4

10

0 5

-2 0

-4

-5

-6

-8 -20

-15

-10

-5

0

5

10

15

20

-10

Factor 1

Figures 5.5a–d. Multivariate analyses (PCA and DFA) of morphological data comparing island vs. mainland and South Australia vs. Western Australia populations of Pseudonaja affinis. Gender divisions of P. affinis in PCA graphs are nearly identical in all PCAs and are thus only demarcated within the first graph. Gender symbols are consistent for all graphs: ♀ = female, ♂ = male, and ? = unknown.

analysing characters mentioned by Hoser (2009)—less the ‗MDSR‘ character (Figure 5.6e). No data were presented for the establishment of a fourth P. affinis subspecies, giving the appearance that Hoser (2009) has engaged in taxonomic prospecting. Univariate analyses could not separate groups in comparisons of geographic origin or MDSR (with the exception of a single character: MDSR), though a few characters did show differing levels of variability. For example, WA and 19 MDSR snakes possessed eye heights ~8.3–19.9% of their head lengths, while SA and 17 MDSR snakes had a narrower range of variation (~9.4–14.4%). These results are likely an influence of the


186

a) MDSR: PCA


10

17 Rows 19 Rows

17 Rows 19 Rows 8 15 6

4

Root 1

Factor 2

10 2

0

?

-2

5

0

♂

-4

♀

-6

-5

-8 -20

-15

-10

-5

0

5

10

15

20

Factor 1

-10

c) MDSR without MDSR: PCA

d) Same as previous: DFA

10

20 17 Rows 19 Rows

17 Rows 19 Rows

8 15 6

4

Root 1

Factor 2

10 2

0

5

-2 0 -4

-6

-5

-8 -20

-15

-10

-5

0

5

10

15

20

Factor 1

-10

e) Hoser (2009) without MDSR: PCA

f) Same as previous: DFA 3

3 17 Rows 19 Rows 2

2

1 1

0 -1

Root 1

Factor 2

0

-1

-2

-3 -2

-4 -3 -5 -5

-4

-3

-2

-1

0 Factor 1

1

2

3

4

17 Rows 19 Rows

5 -4

Figures 5.6a–f. Multivariate analyses (PCA and DFA) of Pseudonaja affinis morphological data comparing MDSR counts, MDSR counts with the character ‗MDSR‘ removed from the analysis, and characters specified by Hoser (2009), less the character ‗MDSR‘. Gender divisions of P. affinis in PCA graphs are nearly identical in all PCAs and are thus only demarcated within the first graph.

smaller, insular snakes of WA (with 19 MDSR) and differing sample sizes (< 19 MDSR = 31, 19 MDSR = 122), rather than actual differences between the mainland populations. Given the overlapping genetic and morphological results, it is unlikely that


187

SA or 17 MDSR P. affinis should be recognised as a full species, an idea that could be further tested with karyotype data from SA P. affinis or any comparative breeding data.

What is the taxonomic status of P. affinis? Analysis of all previous molecular and morphological data shows no support for a generic split involving most Pseudonaja and P. affinis as had been proposed by Wells (2002). Placidaserpens is a junior synonym of Pseudonaja. Given the overall evidence, the name P. affinis appears stable and the holotype most likely originated from Western Australia (type material results are presented at the end of the Results section). However, P. affinis was erected based on a holotype with 19 MDSR whose collection location is unknown. Snakes from throughout the range of nominal P. affinis can display 17 or 19 MDSR (19 more so to the west, 17 more so to the east; Figure 5.7). If karyomorphs from ‗SA‘ snakes turn out to be different from those from ‗WA‘ snakes, and if other strong differentiating support is provided for a species-level split that could be demarcated geographically, then further in-depth analyses would need to be conducted on the P. affinis holotype. Thus, there is a small chance that the name P. affinis could be shown to originate from and only be applicable to ‗SA‘ snakes. In that highly unlikely case, the name tanneri would be take precedence for ‗WA‘ snakes. Subspecies names are normally applied to geographically delimited, morphological variants (Mayr 1969, Dobzhansky 1970, Zusi 1982, Mallet 1995, Cronin 2006). Using such criteria (as is used throughout this chapter) would validate all four sub-species of P. affinis (affinis, charlespiersoni, exilis, tanneri).

Characters removed for lack of or highly reduced variation in P. affinis morphological analyses (14): Internasal scales present? (yes); Does Nasal scale touch Preocular scale? (yes); Number of Preocular scales? (1); Number of Supralabial scales? (6); Tallest Supralabial scale? (6); Longest Supralabial scale? (6); Largest Supralabial scale? (6); Number of Infralabial scales? (6); Number of Infralabial scales touching the Pre- and Post-genial scales? (4); Number of largest Infralabial scale? (4); Primary Temporal scale count? (1); Secondary Temporal scale count? (2); Does a Temporal scale wedge into the Supralabial scales? (no); and Glossy scales present? (no). Pseudonaja guttata – As with P. affinis, nominal Pseudonaja guttata possess two different MDSR counts (19 and 21), are separated by geopolitical boundaries (Northern Territory and Queensland), and have previously been placed into their own genus


U %

U % U% % U % U %% U % UU % U% U % U U % U U% % U % U %

U %

U %

U % U %

U %

U %

U %

Ñ

U %

U %

U %

U %

U % U %

U %

% U

%% U U

U% % U

U% U U % %

U % U % U % U

%$$$

U %

U %

$ % UÑU %

% U U U % % U U % U% %

188

$

% U U %

U %% U U %% UU %

U %

U %

U$$ $ % $$

$$ $$ U %

$

$ $ % $ $ $ U $ $ $

U % U %

$

Figure 5.7. MDSR counts for P. affinis as distributed throughout Australia. Black triangles = 17 MDSR, plus (+) symbols = 18 MDSR, and grey squares = 19 MDSR. Note that there is overlap of scale counts within each geographic area (SA and WA).

(Placidaserpens) by Wells (2002) and have had a subspecies erected by Hoser (whybrowi; 2009) without the benefit or evidence of any scientific analysis. The relevant systematic and taxonomic questions are addressed here.

Is there support for a taxonomic split of nominal P. guttata based on the number of midbody dorsal scale rows (19 vs. 21) or geography (Northern Territory vs. Queensland)? Gillam demonstrated morphological differences between Northern Territory (NT) and Queensland (QLD) Pseudonaja guttata in 1979. Specifically, NT snakes possessed smaller numbers of MDSR and subcaudal scales than QLD snakes, with the reported range of values of each character showing only slight overlap. Mengden (1982) only examined the karyotypes of P. guttata specimens from Queensland, showing them to be consistent in their morphology. His 1985(a) publication also included an analysis of electrophoretic data from specimens collected from throughout their ranges (which showed P. guttata having the greatest genetic distance from other Pseudonaja in the


189

analysis), potentially indicating that some NT material had been examined. Karyomorph results are similar between the 1982 and 1985(a), but it is unclear if the 1985(a) results represent additional data from the Northern Territory as was probable with the electrophoretic analyses. Skinner (2009) did not examine P. guttata morphologically (external or karyomorphs) but was able to delimit the species using analyses of mitochondrial data (Skinner et al. 2005). These analyses showed strong support for subclades that could be differentiated geographically, and a within-species sequence divergence of less than 4.5%. Presumably using data from Gillam (1979) and results from Skinner et al. (2005), Hoser (2009) erected a new subspecies for the NT population. Despite separate claims by Hoser (2009) that the two populations could be differentiated by ―a suite of‖ and ―several‖ characters, only the MDSR and subcaudal scale data of Gillam (1979) were presented to justify the new subspecies.

Multivariate morphological results are similar to those of P. affinis: whether results are plotted by geographic distribution or by MDSR, P. guttata do not show complete homogeneity, and results from one distribution tend to segregate towards one end of the PCA graph (Figures 5.8a and 5.8c). If the effects of MDSR are removed from the analysis, this pattern is further obscured (Figure 5.8e). Few characters showed less than 50% overlap between groups (Table 5.5), though groups did show differences in variability in some characters. Usually the group with the most individuals—QLD or 21 MDSR—showed more variation in a character, presumably a function of sample size (Table 5.5). Differences in morphology potentially related to longitudinal variation can be contrasted with the high support for separation provided by mitochondrial analyses and the presumed geographic barrier to reproduction (Selwyn and Waggaboonyah Ranges, beginning at the eastern edge of the Barkly Tablelands; Figure 5.9). It is likely that the two populations are—or may be heading towards becoming—separate species. Confirmation of species-level separation could be obtained with karyomorphic tests of NT snakes and breeding trials.

What is the taxonomic status of P. guttata? Partial results from several molecular studies (Mengden 1985a, Chapter 4) have recovered polyphyletic Pseudonaja, especially in regard to the relationships between P. guttata, Oxyuranus, and most other Pseudonaja. Chromosomally, P. guttata shares a similar macro-arrangement as that of P. modesta and Oxyuranus (Mengden 1985a). In comparisons of mitochondrial


190

a) Geography: PCA

b) Geography: DFA

10

14 < 139° Longitude

< 139° Longitude > 139° Longitude 12

6

10

4

8

2

6 Root 1

Factor 2

> 139° Longitude 8

0

4

2

-2

0

-4

-2 -6 -4 -8 -20

-15

-10

-5

0

5

10

15

20 -6

Factor 1

c) MDSR: PCA

d) MDSR: DFA

10

12 19 Rows 21 Rows

8

10

6

8

4

6

2

4 Root 1

Factor 2

19 Rows 21 Rows

0

2

0

-2

-2

-4

-4 -6 -6 -8 -20

-15

-10

-5

0

5

10

15

20 -8

Factor 1

e) MDSR without MDSR: PCA

f) MDSR without MDSR: DFA

8

12 19 Rows 21 Rows 10

4

8

2

6

0

4 Root 1

Factor 2

19 Rows 21 Rows 6

-2

2

0

-4

-2

-6

-4

-8

-6

-10 -20

-15

-10

-5

0 Factor 1

5

10

15

20 -8

Figures 5.8a–f. Results of multivariate examinations (PCA and DFA) of Pseudonaja guttata populations based on geography, MDSR, and MDSR (without the use of the character ‗MDSR‘). There is no pattern of gender assortment in P. guttata results.

sequences (Chapter 4), P. guttata was consistently recovered earlier than non-modesta species of Pseudonaja and sometimes earlier than Oxyuranus. The ability to separate P. guttata from other, closely-related snakes makes it tempting to recognise P. guttata as a monophyletic genus, perhaps containing two species (see above). However, results of


191

Table 5.5. Characters which separate eastern and western populations of Pseudonaja guttata by more than 50% of total variation. The fourth character is an exception to this statement, which is provided to illustrate a more typical spread of variation (when any differences exist), perhaps explained by differences in the amount of materials examined (≤ 19 MDSR = 22, ≥ 20 MDSR = 40).

Character

19 MDSR (West) 19: 100% > 19: 0% Normal to Wide: 92% Narrow: 8% ≥ 50: 8% < 50: 92% 12.7–15.7%

MBDSR Dorsal Scale Overlap (Width) Subcaudal Scale Count Tail Length / Total Length

U %

21 MDSR (East) 21: 83% < 21: 17% Normal to Wide: 30% Narrow: 70% ≥ 50: 97% < 50: 3% 12.8–18.3%

$

U % U % U % U % U U$% % U% U $% U % % $ U $ U U % U% %

$ $ U %

T $ U% % U

$ U $% U U% % U % $ $ % U $ $

T T

U %

T

T

T

T

U %

U T % % U T U % U % T T % U T U % % U T

T T T

$

T T T

T

U %

T

T $

T

T

T

T T T

T

T

T

T T

T $

T

T

T T

T

T

Figure 5.9. Distribution of sampled Pseudonaja guttata (solid black triangles = DFA predicted western population, clear triangles = DFA predicted eastern population) and all known P. ingrami (grey squares). The gap between eastern and western P. guttata populations is the eastern edge of the Barkly Tablelands, constrained by the Selwyn and Waggaboonyah Ranges.


192

DNA analyses are inconsistent, and molecular results (karyotypes, DNA) are hindered by low sample sizes, the restricted geographic distribution of samples analysed, or a combination of both. Two subspecies of Pseudonaja guttata (guttata and whybrowi) are recognised here. Skinner et al. (2005) stated that there was ―substantial‖ molecular support for a single guttata species belonging to Pseudonaja; past and currently presented molecular results do not support this evaluation. Although there currently may be enough morphological data and molecular differences to place P. guttata into a separate, monophyletic genus, such a move should not be supported without additional, definitive molecular work (analysis of nuclear gene sequences) to determine the exact placement of the taxon. If a separate genus is deemed to be warranted, the priority of the generic name would belong to Wells (2002), who erected Placidaserpens without supporting data or analyses. Until then, Placidaserpens should be considered a junior synonym of Pseudonaja. Using previously-described criteria, both sub-species of P. guttata (guttata and whybrowi) are valid. Should two species be justified, Pseudonaja guttata would be restricted to the eastern (primarily QLD) population and P. g. whybrowi would be elevated to specific status for the western (primarily NT) population.

Characters removed for lack of or highly reduced variation in P. guttata morphological analyses (13): Ventral Rostral scale pattern? (wide); Oncoming Rostral scale pattern? (wide); Combined Rostral scale pattern? (wide + wide); Internasal scales present? (yes); Number of largest Infralabial scale? (4); Number of Infralabial scales touching the Preand Post-genial scales? (4); Frontal scale-Interorbital scale colour stripe percentage? (0); Parietal scale colour stripe width? (0); Total percentage width of head stripe? (0); Is there a head band/interorbital colour stripe? (no); Does a Temporal scale wedge into the Supralabial scales? (no); Glossy scales present? (no); and Paired or single Anal scale? (paired). Pseudonaja inframacula – Due only to the presence of melanistic ventral scales, Waite (1925) first established Pseudonaja inframacula as a subspecies of (what is now known as) Pseudonaja textilis. Mengden (1985a) demonstrated P. inframacula to be a full species based on karyomorphic data, an idea later confirmed by the DNA analyses of Skinner et al. (2005). Wells (2002) placed P. inframacula within the genus Euprepiosoma without benefit of any data or analysis. The melanism which


193

distinguishes this species from other Pseudonaja was thought to be a product of ―almost insular conditions‖ by Waite (1925). Though Schwaner (1988) recorded the presence and diet habits of nine P. inframacula on Wardang Island, an explicit morphological examination of insular P. inframacula has previously not been conducted.

Is there support for taxonomic recognition of insular P. inframacula? Based on museum records, nominal Pseudonaja inframacula are known to be present on at least three South Australian islands: Neptune (n = 3), Waldegrave (n = 1) , and Wardang (n = 21). Mengden (1982) did not examine P. inframacula and, due to a lack of a list of examined material by Mengden (1985a), it is unknown if any insular specimens of this species have had karyomorphs examined. Skinner et al. (2005) examined one specimen from Wardang Island for mitochondrial analyses, showing that individual shared a haplotype with mainland P. inframacula from two other SA locations. The specimen from Waldegrave Island and one specimen from Neptune Island were damaged and withheld from initial multivariate analyses of morphological data. Multivariate examinations indicated that the two other Neptune Island snakes were not differentiable morphologically from mainland snakes (Figure 5.10a), perhaps due to the small sample size available for analysis. These results are somewhat surprising as Neptune Island is the most distant from the mainland of the three islands (Neptune = 25 km, Waldegrave = 2.5 km, Wardang = 4 km), as Wardang Island is fairly close, and given that Wardang Island snakes separate out almost completely in multivariate analyses (Figure 5.10a). Of the latter specimens, univariate analyses show that they can be distinguished from their mainland counterparts by the proportional width of the fore end to the aft end of the Frontal scale (mainland ≥ 1.09, 95% of specimens examined; Wardang < 1.09, 87% of specimens examined), lower maximum scale counts (i.e., Ventral scale count: mainland average/max 201/206, Wardang average/max 196/201), and several other lower maximum scale ratios. It is unlikely that these snakes will be proven to be a full species (given mitochondrial results). Karyomorphic analyses and breeding trials would be beneficial to confirm the uniformity of mainland and insular P. inframacula.

What is the taxonomic status of P. inframacula? All recent morphological and molecular evidence provide evidence that P. inframacula is a monophyletic species within the genus Pseudonaja. Euprepiosoma is a junior synonym of Pseudonaja (see also the interpretation of results in the sections on P. ingrami and P. textilis, below).


194


b) Same as previous: DFA

10

10

8 5

♀

6

0

?

4

-5

Root 2

Factor 2

2

0

♂

-2

-10

-15

-4 -20 -6 -25

Mainland Wardang Island Neptune Island

-8

-10 -20

-15

-10

-5

0

5

10

15

20

-30 -2000

Mainland Wardang Island Neptune Island -1500

-1000

-500

Factor 1

0

500

1000

1500

2000

2500

3000

Root 1

Figures 5.10a–b. Results of multivariate examinations (PCA and DFA) of insular vs. mainland Pseudonaja inframacula populations. Gender divisions of P. inframacula are also illustrated within the PCA chart.

Two subspecies of Pseudonaja inframacula (inframacula and a new subspecies) are recognised, based on the geographic location and differential morphology of Wardang Island specimens (similar to insular specimens of P. affinis).

Characters removed for lack of or highly reduced variation in P. inframacula morphological analyses (9): Internasal scales present? (yes); Does Nasal scale touch Preocular scale? (yes); Tallest Supralabial scale? (6); Longest Supralabial scale? (6); Largest Supralabial scale? (6); Number of Infralabial scales? (6); Number of Infralabial scales touching the Pre- and Post-genial scales? (4); Does a Temporal scale wedge into the Supralabial scales? (no); and Glossy scales present? (no). Pseudonaja ingrami – In 1908, Boulenger described Diemenia (later Pseudonaja) ingrami from a single individual from Alexandria, Northern Territory. Although Boulenger (1908) provided over 40 different characters in his description, he listed only ―much larger size‖ as the way to distinguish P. ingrami from other elapid snakes found in the same region. Pseudonaja ingrami is still the least collected brown snake or taipan, with less than 50 individuals in museum collections worldwide. Nearly twenty percent of these had been misclassified as P. ‘nuchalis’ or P. textilis prior to the examination of museum collections undertaken for this thesis. Modern identification


195

guides (such as Cogger [2000]) typically use a combination of MDSR (17), the number of infralabial scales (7), and distribution (similar to that of P. guttata) as a way to distinguish P. ingrami from other Australian elapids, and some guides (such as Wilson and Swan 2003) have recently extended the range of P. ingrami into Western Australia. No author has yet investigated the geographic limits or any geographic variation of P. ingrami.

Is there support for a taxonomic split of P. ingrami based on geography (Northern Territory vs. Queensland)? Gillam (1979) validated P. ingrami as a species, primarily on the basis of the number of infralabial scales (7) and buccal cavity colour (predominantly black), as measured from most available specimens. Mengden (1982) confirmed Boulenger (1908) and Gillam (1979) when he provided karyotype information for one Northern Territory specimen: unique among brown snakes in having 20 macrochromosomes and 16 microchromosomes. His 1985(a) update listed the same information but did not elaborate on sample sizes or results for this species. In 2002, Wells placed P. ingrami within the genus Euprepiosoma without benefit of any data or analysis, a systematic arrangement ignored by all subsequent identification guides. Skinner et al. (2005) and this study (Chapter 4) provided further support for generic placement and specific, systematic differentiation on the basis of mitochondrial characters. P. ingrami was not included in the morphological analyses of Skinner (2009). Results of multivariate analyses of morphological data show overlap among snakes collected in different geographic locations, though not a complete pattern of overlap or separation (Figure 5.11a). Given the mitochondrial uniformity and lack of differentiation in univariate morphological analyses (only a few characters show much differentiation, most likely due to the low sample sizes associated with this genus; Table 5.6), the observed multivariate divergence is suspected to be a function of a geographic cline, rather than an indication of systematic differences.

Does P. ingrami occur in Western Australia? Collection locations of P. ingrami in QLD are restricted to the south-western edges of QLD P. guttata distribution, almost to the point of exclusion (Figures 5.9 and 5.12). The distribution of P. ingrami is similar to the distribution of P. guttata in the NT and both species also share a distributional gap in QLD (eastern edge of the Barkly Tableland). In 2003, Wilson and Swan published a guide to Australian reptiles which included photographs and information listing P.


196

a) Geography: PCA


15

10

5

5

♂

0 Root 1

Factor 2

?

0 -5

♀ -5

-10 NT QLD -10 -12

-10

-8

-6

-4

-2

0

2

4

Factor 1

6

8

NT QLD

10 -15

Figures 5.11a–b. Results of multivariate examinations (PCA and DFA) of Pseudonaja ingrami populations based on geography. Gender divisions of P. ingrami are also illustrated within the PCA chart.

Table 5.6. Characters which separate geographic populations of Pseudonaja ingrami by more than 50% of total variation. Character Lower Postocular Scale Diagonal Height / Upper Postocular Scale Height Largest Infralabial Scale Width / Head Length Ventral Scale Count

NT (west)

QLD (east)

0.92–1.48

1.35–1.80

13.9–15.4% ≥ 205: 83% < 205: 17%

11.2–13.7% (one at 15.1%) ≥ 205: 12% < 205: 88%


197

# U %

#

## # # #####

# #U # # #% # U %

##

# #

# U %

# U % # U %

QLD #

NT

# % U

# U %

# U %

# U %

# #

# U % #

# U %

Figure 5.12. Distribution of sampled Pseudonaja ingrami (open squares). The gap between eastern and western P. ingrami populations is not as noticeable as that of P. guttata populations (Figure 5.9).

ingrami as occurring in WA. At the time of data collection for this thesis, the WA Museum possessed ten snakes listed as P. ingrami, five of which were actually P. inframacula. The other five—collected in Western Australia—outwardly appeared similar to P. ‘nuchalis’ specimens. One of these five snakes was morphologically and genetically (using fresh tissue—Chapter 4) examined: Western Australia Museum (WAM) 102045. Analyses of mitochondrial data confirm either that WAM 102045 is a P. ‘nuchalis’ or that the container storing the tissue purportedly derived from WAM 102045 is labelled incorrectly. The latter is the less-likely scenario as no other museumstored tissue analysed for this thesis appeared to be labelled incorrectly. A predictive DFA listed WAM 102045 as being P. ‘nuchalis’ with 99.96% probability and 99.87% probable as belonging to the genetic sub-clade 640 (referable to P. mengdeni). A minimum convex polygon of the geographic distribution of this genetic sub-clade encompasses all five WAM ingrami–‗nuchalis’ specimens, but it does not extend far


198

enough northward to include the area (Kununurra) identified by Wilson and Swan (2003) as containing P. ingrami. If genetic samples are available for the additional four specimens held by the WAM, they should also be analysed to confirm the presence or absence of this species in West Australia. A successful result—highly doubtful— identifying any of these four specimens as P. ingrami would significantly extend the distribution of this species westward. Pseudonaja ingrami may indeed occur in WA, but this idea has not been supported based on information currently available.

What is the taxonomic status of P. ingrami? All recent morphological and molecular evidence provide evidence that P. ingrami is a monophyletic species within the genus Pseudonaja. Euprepiosoma is a junior synonym of Pseudonaja (see also the interpretation of results in the sections on P. inframacula, above, and P. textilis, below). There is no known justification for multiple subspecies of this taxon.

Characters removed for lack of or highly reduced variation in P. ingrami morphological analyses (20): Internasal scales present? (yes); Number of Supralabial scales? (6); Largest Supralabial scale? (6); Longest Supralabial scale? (6); Postgenial scale suture length? (0); Postgenial scale suture length / Pregenial scale suture length? (0); Are there Gular scales separating Postgenial scales? (yes); Frontal scale-Interorbital scale colour stripe percentage? (0); Parietal scale colour stripe width? (0); Total percentage width of head stripe? (0); Is there a head band/interorbital colour stripe? (no); Primary Temporal scale count? (1); Does a Temporal scale wedge into the Supralabial scales? (no); Glossy scales present? (no); Is there a neck band? (no); Is the body banded? (no); Is the tail banded? (no); MDSR? (17); DSR at vent? (15); Paired or single Anal scale? (paired). Pseudonaja modesta – Pseudonaja modesta has avoided much of the taxonomic chaos associated with P. ‘nuchalis’, even though both species share a similar, continental distribution. Only three species (names) have been proposed for P. modesta, most likely due to their small size and their apparent consistency in morphological features. Gillam (1979) separated P. modesta from other Pseudonaja by low ventral and subcaudal counts, and observed that there was a latitudinal gradient to the number of ‗large‘ bands: 5–8 (mean 7) bands south of -21.00° latitude and 6–12 (mean 9.3) bands north of -17.55° latitude. In his karyomorphic review of Australian elapids, Mengden (1982) did


199

not have banding data for P. modesta, but did note the diploid number and arrangement (36: 16 macro and 20 microchromosomes) possessed by P. modesta was also shared by Oxyuranus. Though Mengden (1982) did not draw parallels between the two groups, several of the first eight macrochromosomes were identically described. Mengden (1985a) added that the karyomorphs of P. modesta bore no resemblance to any Hemiaspis species tested (a genus purported to share close affinities with P. modesta by Wallach [1985]), that there were no grounds (on the basis of chromosome evidence) to reallocate P. modesta from Pseudonaja, and agreed with the observations of Mack and Gunn (1953) that Brachysoma sutherlandi was a synonym of P. modesta, not P. ‘nuchalis’ as some authors had suggested (such as Cogger et al. 1983). After Wells and Wellington (1983) pulled both P. modesta synonyms out from synonymy, Wells (2002) formally placed them into a new genus, Notopseudonaja, without benefit of any data or analyses. In fact, the diagnoses provided by Wells (2002) for all three species are nearly identical, indicating either high morphological convergence or the lack of any analysis of the subject material by the author. Though the results of Skinner et al. (2005) consisted of strongly-supported sub-clades which were geographically separable, Skinner (2009) considered P. modesta to be a ―well-demarcated species‖ and not considered for morphological analysis. Other than Gillam (1979), in-depth analyses have not been conducted on P. modesta, and none have been conducted on specimens taken from their entire distributional range.

Is there support for any taxonomic split of P. modesta based on observed sub-clades presented in Chapter 4? Mengden (1982) lists only two P. modesta specimens as having been examined: one from South Australia (ANWC 3075; determined through a museum database search for this thesis) and one from an unknown location. As there were no specimens listed in his 1985(a) publication and very little written about P. modesta in either publication, it is difficult to interpret whether karyomorphic similarities are confined to the two examined specimens (perhaps both from the same area) or are present throughout the entire range of this species. The predicted classification of specimen ANWC 3075 after DFA was clade 520 (99.98%), a clade whose geographic distribution includes the collection location of this specimen (Malboom outstation, Mulgathing Station, SA). Thus, the collective knowledge of P. modesta karyotype variation may be restricted to individuals from only one clade out of the four possible (or five, see below) based on mitochondrial sequence variation.


200

Skinner et al. (2005) recovered four well-supported (87–100%) clades, each of which could be delimited geographically. With additional samples added to the analyses, results (Chapter 4) showed high support (100%) for three of these clades, but only low support (48–56%) for the fourth clade. A fifth group, found in mostly northern areas from which there was no fresh tissue for molecular analysis, was also included in morphological analyses. This final group spans north-west WA, northern NT, and north-western QLD, and is largely coincident with areas of high band counts (as noted by Gillam [1979]).

Results were mixed when analysing the full morphological data set. Principal components analyses resulted in a highly overlapping graph (when plotted by clade or minimum convex polygon membership), with only the eastern-most clade reasonably well separated, while the output of DFAs showed remarkably well-separated points (Figures 5.13a–b; see discussion about the problems of reliance on DFA vs. PCA output, above). Characters able to differentiate between clades consistently did so only between the furthest eastern and western clades. A distributional map of the number of rings possessed by individual snakes is presented in Figure 5.14, and shows that the geographic pattern of ring counts described by Gillam was confirmed, but can be expanded upon. With few exceptions, P. modesta with nine or more ‗wide‘ bands share a similar distribution to P. ingrami or P. guttata (through the Barkly Tableland), but which also continues north-westerly through the top of WA. East of the Selwyn Range, P. modesta possess four to six wide bands, while areas corresponding to clade 520 (central Australia) are nearly all comprised of snakes with five to seven bands, and P. modesta from central-west and south-west WA normally possess specimens with three to eight wide bands. Note that absolute numbers of rings may be underestimated by chemical storage, but this effect is expected to occur evenly across all individuals and clades.

There were also 28 P. modesta measured without any wide bands. Snakes with no wide bands showed no difference in total length (typically used as a proxy for age in snakes) and the average time in storage solution was less for non-banded individuals (29 years) than banded individuals (36 years). However, non-banded P. modesta were almost always found in locations which correspond to areas of overlapping mitochondrial clades or areas between mitochondrial clades (Figure 5.14). It may be that a lack of


201

a) Genetic and morphometric sub-clades: PCA


8

12 510 520 530 540 550

510 520 530 540 550

9

4

6

2

3

0

0 Root 2

Factor 2

6

-3

-2

-4

-6

♀+♂

-6

?

-9

-12

-8

-15

-10 -20

-15

-10

-5

0

5

10

Factor 1

15

20

-55

-45

-35

-25

-15

-5

5

15

25

35

45

55

65

75

85

Root 1

Figures 5.13a–b. Results of principal components and discriminant function analyses on morphological data collected from P. modesta. The two graphs are presented, in part, to illustrate the difficulties in correlating multivariate results with potential systematic differences. There is no pattern of male and female assortment in P. modesta results, only between adults and juveniles.

wide bands is a product of hybridisation and, as there are no karyomorphic or breeding data to compare, may provide evidence for increased levels of reproductive isolation. At the very least, P. modesta from individual geographic regions are most like other P. modesta from the same geographic region. Similar to P. ‘nuchalis’ (see below), P. modesta may be comprised of at least three different species. This final statement cannot be fully verified without further karyotypic results, the availability of fresh tissue from northern latitudes, breeding trials, or further morphological or molecular characters for assessment.

Is there support for taxonomic recognition of insular P. modesta? One specimen, Museum Victoria 781, has been collected from the Abrolhos Islands in Western Australia (Figure 5.14). Results of a discriminant function analysis predict this specimen to belong to clade 530, with a support value of 100%. The distribution of snakes contained within clade 530 is (along with clade 540) the closest to the Abrolhos Islands of any P. modesta clade (Figure 5.14). It is unknown if this individual was part of a natural population, or was a function of a planned human release, a theory


202

6 9 9

60

8 00

530

3

1 3

5 6 2

4

67 6

07

6

6

9 7

93 0 6 3 0 8 0

5 0

50

0

0

10 11

6

7

6

0

540 4 6

5 2 0 3 5 55 5 0 6 4 2 5 5 5 4 2 5 5 4 6 5 4 0 4 4 46 8 6 6 6 5 5 6 01 6 4 5 5 6

11

0

7 77 4 05 6

5

2 4 6 6 7 0 6 6

10

4 7 4

6 6

6 3

6

6

6 7

6 5 5

5

0 0

5 6

5

4 0

6

5

5

5 6

5

520

5

6

5

5 8

7

0 7 3

6 6 6 6

6 6 6

11 10

7

6 7

5

10

9

0

56

8

9

550

2 6

0

5

4

11

7 4 4

10

9 10 11

10 11

6 67 3 6 6 6 6 8 56 5

5 1011 10

5 6

3

5

5

0 55 5 4 6 5

510 4

5 55 5 6 5 5 6 5 565 7 6 5 6 5 6 5 5 5 6 7 4 3

Figure 5.14. Ordered presentation of the number of wide body bands present in Pseudonaja

modesta.

Minimum

convex

polygons

bound

areas

containing

specimens/sub-clades recovered in genetic analyses (510–540) and the area covering most specimens possessing increased counts of wide bands (‗sub-clade‘ 550). The black star represents the location of the Western Abrolhos Islands, site of the only known insular specimen of P. modesta.

recounted by Bush (2008) in regard to tiger snakes on Carnac Island, WA (Bush 2008). It is highly unlikely that this specimen represents a unique evolutionary lineage of P. modesta.

What is the taxonomic status of P. modesta? Multivariate analyses of morphological data lead to the complete separation of P. modesta from all other taxa, as does a univariate examination of the number of ventral scales possessed by each taxa (< 185 for P. modesta, ≥ 185 for all others). The molecular case for generic reallocation of modesta from Pseudonaja is also evident in molecular results presented in this thesis and by at least one other author. Pseudonaja modesta was recovered as the sister group


203

to Oxyuranus and other Pseudonaja using Maximum Likelihood and Bayesian analyses (Chapter 4), while P. modesta was recovered as the sister group to Oxyuranus using Maximum Parsimony analyses (Chapter 4) and Bayesian analyses (Doughty et al. 2007). Only Skinner et al. (2005) recovered a monophyletic Pseudonaja. Support was high (99–100%) for the placement documented in Chapter 4 and lower (< 50–80%) for placements recovered within the other studies. A generic reallocation, either on its own or as a congener within Oxyuranus, is most likely warranted. In the former case, the name provided by Wells (2002), Notopseudonaja, would be applicable. Regardless of the generic name, recognition of additional (sub-)species may require new names to be erected. The holotype and two syntypes for the species, Cacophis modesta, come from Perth and Western Australia, western areas corresponding to the sub-clades presented in Chapter 4 (e.g., Figure 4.11). Brachysoma sutherlandi would have priority for the far northern (many-banded) Australian individuals of this complex, due to its high band count (eleven) and collection location (Carl Creek, Norman River, Queensland). The collection location for the types of Furina ramsayi are all recorded from the same locality, at the furthest edges of two sub-clades (central and eastern), with results from predictive DFAs indicating that Furina ramsayi is indicative of central Australian stock. Were sub-clades be proposed as valid taxa (grouping the two furthermost western subclades), as is appropriate at least at the sub-specific level, a new taxonomic name would be required to delimit either central or eastern Australian specimens (depending on the final assignment of Furina ramsayi).

Characters removed for lack of or highly reduced variation in P. modesta morphological analyses (2): Tallest Supralabial scale? (6) and Does a Temporal scale wedge into the Supralabial scales? (no). Pseudonaja ‘nuchalis’ – Since 1858 (Günther), eleven different species names have been erected for snakes now generally synonymous with Pseudonaja ‘nuchalis’. The high number of names attributable to this one species is both a product of inherent morphological variability and because P. nuchalis (as used during much of the previous thirty years) is actually a composite taxon. Gillam (1979) wrote that there were at least sixteen different adult colour (and pattern) forms—the twelve most common of which he described—and numerous intermediate variations, based on morphologic measurements taken from 111 NT specimens. Mengden (1982, 1985a) examined the


204

karyomorphs of eleven P. ‘nuchalis’ from selected locations throughout Australia and the adult colours and patterns of P. ‘nuchalis’ held by the Australian and Queensland Museums. Similar to Gillam (1979), Mengden (1985a) found there to be nine major adult colour and pattern forms (which he colloquially named, i.e., ―orange with black head‖), seven of which could be ascribed to unique karyotypes and two of which lacked any karyotype data to examine. Several of the existing karyotypes were similar enough so as not to provide a barrier to reproduction, leading Mengden (1985a) to conservatively estimate that P. ‘nuchalis’ consisted of four separate taxa, two of which he recognised were as likely to eventually be grouped together as they were to be split apart. Skinner‘s early works (2003, et al. 2005) tested these assumptions using mitochondrial (and some karyomorphic) data, resulting in seven to nine (depending on the type of phylogenetic analysis conducted) well-supported clades of P. ‘nuchalis’, which the author(s) considered to be three separate species.

Karyomorphic results between Mengden and Skinner largely matched, with one exception. In opposition to the results presented by Mengden (1985a), Skinner et al. (2005) noted that ―pale head, grey nape‖ karyotypes could not be differentiated from ―orange with black head‖ karyotypes. Skinner et al. (2005) listed several hypotheses for this discrepancy in results, none of which the authors said could be accurately investigated due to the ―absence of any details of the material Mengden examined‖. However, Mengden had published a list of his examined material in 1982, which included P. ‘nuchalis’ from NT, SA, and WA. In contrast, the snakes examined by Skinner et al. (2005) derived from a single location in Alice Springs, NT, providing an another hypothesis for the discrepancy: sampling error. Overall, Skinner et al. (2005) helped to resolve P. ‘nuchalis’ taxonomy, work which was further strengthened by Skinner (2009) on the basis of regional morphological analyses. Linking his mitochondrial and morphological results, Skinner (2009) officially recognised three species of P. ‗nuchalis’: P. aspidorhyncha, P. mengdeni, and P. nuchalis. As the molecular results presented in Chapter 4 concur with this assessment, only a few questions remain to be answered, mostly dealing with issues of incomplete geographic and specimen sampling. Are the patterns of P. ‘nuchalis’ recognition specified by Skinner (2003, 2009) and Skinner et al. (2005) consistent when examining the full range of geographic and


205

morphologic variation? Specifically, is there support for any taxonomic split of P. ‘nuchalis’ based on observed sub-clades (Skinner et al. 2005 and Chapter 4)? Skinner (2009) used thirty morphological characters in his multivariate analyses of P. affinis, P. inframacula, P. ‘nuchalis’, and P. textilis, and discussed over forty more characters in further descriptions of these species. There are subtle differences in the characters examined and the multivariate analyses undertaken between Skinner (2003) and Skinner (2009), but the way in which characters were chosen and why all characters were not included in analyses was not explained. To reiterate, regardless of the amount of morphological data examined, PCA results are not homogenous, especially in regard to the relationship of P. nuchalis to that of P. aspidorhyncha and P. mengdeni (Figures 15.5a, 15.5c, 15.5e, and 15.5g). Pulling back the analyses to examine the original mitochondrial clades showed a continuing pattern of heterogeneity in PCA results (Figure 5.16a). In general, snakes (and clades) now attributable to P. mengdeni are mostly separable from snakes (and clades) now attributable to P. aspidorhyncha using multivariate analyses (PCA) of morphological data. In these same analyses, snakes (and clades) now attributable to P. nuchalis highly overlap both other taxa. In terms of multivariate analyses, the separation of P. nuchalis is not supported unless the PCA results are ignored in favour of DFA results. There is additional support for separation, however, based on karyomorphic data, mitochondrial divergence, and results of morphological analyses (Mengden 1983, 1985a, Skinner et al. 2005, this thesis).

Is there support for taxonomic recognition of insular or Cape York Peninsula Pseudonaja ‘nuchalis’? Several P. ‘nuchalis’ specimens have been collected from various Australian islands, primarily in the NT, including the type specimen for P. imperitor (Angurugu, Groote Eylandt; Wells and Wellington 1985). However, univariate and multivariate analyses (PCA) of morphological data do not support the taxonomic recognition of insular P. ‘nuchalis’ (Figure 5.17a). Mitochondrial sequences of four of the six non-damaged, island P. ‘nuchalis‘ were also examined (Chapter 4). Three of these four haplotypes were shared by a range of mainland specimens, indicating that insularity in and of itself is not a differentiable condition for specieslevel nomenclatural purposes.


206

a) AS snakes, AS characters: PCA


3

8 aspidorhyncha mengdeni nuchalis

2 6 1 4

Root 2

Factor 2

0

-1

2

-2 0 -3 -2 aspidorhyncha mengdeni nuchalis

-4

-5

-4 -8

-6

-4

-2

0

2

4

6

8

-10

-8

-6

-4

-2

Factor 1

0

2

4

6

Root 1

c) CG snakes, AS characters: PCA


4


aspidorhyncha mengdeni nuchalis

3

2 2

0 Root 2

Factor 2

1

0

-1

-2 -2 -3

-4

-4

-5 -12

-10

-8

-6

-4

-2

0

2

4

6

8

10

-5

-4

-3

-2

-1

Factor 1

0

1

2

3

4

Root 1

e) AS snakes, CG characters: PCA

f) Same as previous: DFA

8

10

aspidorhyncha mengdeni nuchalis

6

aspidorhyncha mengdeni nuchalis 5

4

2

Root 2

Factor 2

0

0

-2 -5

-4

-6

-10

-8

-15

-10 -16

-14

-12

-10

-8

-6

-4

-2

0

2

4

6

8

10

12

-30

14

-20

-10

0

10

20

Root 1

Factor 1

g) CG snakes, CG characters: PCA

h) Same as previous: DFA 45


6

40 35 30

4

25 20 15

0 Root 2

Factor 2

2

-2

10 5 0

-4

-5 -6

-10 -15 aspidorhyncha mengdeni nuchalis

-8 -20 -10 -20

-15

-10

-5

0

5

10

15

20

25

Factor 1

-25 -100

-50

0

50

100

150

200

250

300

350

400

450

Root 1

Figures 5.15a–h. A comparison of multivariate results varying the sample sizes, the characters examined, and the types of analysis undertaken. All analyses were conducted on data collected from non-type, non-damaged P. nuchalis material. See Figure 5.16a for patterns of gender divisions in PCA results.


207

a) Genetic sub-clades: PCA


8

5

610 620 630 640 650 660 670 680 690

6

4

2

4

3

2

Root 2

Factor 2

1 0

-2

0

-1 610 620 630 640 650 660 670 680 690

-2 -4 -3

♂

-6

?

♀

-8

-4

-5

-10

-6 -20

-15

-10

-5

0

5

10

15

20

25

-6

Factor 1

-5

-4

-3

-2

-1

0

1

2

3

4

Root 1

Figures 5.16a–b. Results of principal components and discriminant function analyses on morphological data collected from P. ‘nuchalis’. Snakes included in analyses are the original, informative specimens used in mitochondrial analyses + snakes contained within minimum convex polygons created from each sub-clade. Sub-clades 610 and 620 correspond to Pseudonaja aspidorhyncha, sub-clades 630–660 correspond to P. mengdeni, and sub-clades 670 and 680 correspond P. nuchalis. Mitochondrial sequences of snakes from the Cape York peninsula (‗sub-clade‘ 690) were not recovered successfully, but were included to determine group membership. Gender divisions of P. ‘nuchalis’ in PCA graphs are nearly identical in all PCAs and are thus only demarcated here.



10 Mainland Island 8

2

6 0 4 -2

-4

0

Root 1

Factor 2

2

-2

-6

-4

-8

-6 -10 -8 -12 -10 -20

-15

-10

-5

0

5

10

15

20

Mainland Island

25

Factor 1

-14

Figures 5.17a–b. Results of principal components and discriminant function analyses on morphological data collected from insular P. ‘nuchalis’. See Figure 5.16a for patterns of gender divisions in PCA results.


208

The status of P. ‘nuchalis’ in the Cape York Peninsula (CYP) is less clear. Few specimens are known from the region, several of which were collected by Donald Thompson during his explorations in the 1930s. Through the years, the number of specimens collected from the CYP has dwindled. Collection locations and dates roughly match the documented introduction and geographic progression of the introduced cane toad (Bufo marinus; Freeland 1986, Sutherst et al. 1996, Catling et al. 1999). Mengden (1985a) is the only Pseudonaja researcher to have written about this population, who provided a distributional map of Australian P. ‘nuchalis’ in which various major colour and pattern morphs were displayed. In the areas in and directly around the CYP, Mengden (1985a) identified the presence of three of his nine colour morphs, one of which showed a biphasic character state: head colouration changed with increasing latitudes. Of the three major colour and pattern morphs present, one is otherwise restricted to southern QLD (typically associated with aspidorhyncha), one is found in the northern half of Australia (nuchalis), and the third is found throughout Australia (mengdeni). No karyotypic data from the region has ever been examined.

Attempts were made to sequence mitochondrial DNA from five CYP snakes, but none of the resulting sequences were fully informative (informative being defined as sequences which are full-length, clean, without double peaks, realistically placed in phylogenetic analyses, etc.). The most informative of the five sequences was most closely associated with the northern P. nuchalis clade. According to published information, personal field exploration, and communication with a variety of local biologists and residents, cane toads may have led to the extirpation or dramatic reduction of the CYP population of P. ‘nuchalis’, making it unlikely to easily obtain fresh tissue for analysis. Treating the CYP population as a separate clade in multivariate (PCA) and univariate analyses of morphological data revealed a shared overlap with P. aspidorhyncha and some P. nuchalis specimens (Figure 5.16a). A predictive DFA of specimens from the CYP and surrounding area showed mixed results: 9/14 were predicted to be P. nuchalis, 3/14 were P. mengdeni, and 2/14 were P. aspidorhyncha. The southern edges of the CYP may now be the distributional limit of all three species, but the balance of morphological evidence indicates that brown snakes from the CYP are remnants of a once-broader P. nuchalis distribution, which is now restricted to the northern edges of the NT and WA. Should a specimen from the CYP become available,


209

it would be advisable to obtain fresh tissue for molecular analysis before release or disposal of the snake. What is the taxonomic status of P. ‘nuchalis’? As has been hypothesised, discussed, and shown by past researchers, P. ‘nuchalis’ is clearly a composite taxon. Valid, monophyletic taxa include P. aspidorhyncha, P. mengdeni, and P. nuchalis. No subspecies are known or recognised. Characters removed for lack of or highly reduced variation in P. ‘nuchalis’ morphological analyses (7): Tallest Supralabial scale? (6); Number of largest Infralabial scale? (4); Number of Infralabial scales touching the Pre- and Post-genial scales? (4); Where does Rostral scale end in relation to the Nasal scale? (past); Does Nasal scale touch Preocular scale? (yes); Does a Temporal scale wedge into the Supralabial scales? (no); and Paired or single Anal scale? (paired). Pseudonaja textilis – Similar to Pseudonaja ‘nuchalis’, P. textilis has had a relatively high number of taxonomic names (sixteen different species or subspecies) applied to what has commonly been considered to be a single species. Gillam (1979) examined specimens from three geographically isolated locations in the Northern Territory, finding differences in scale counts, colour, and patterns between specimens at each location. Based on these observations, Gillam (1979) expected P. textilis would be found to be a composite species. Mengden (1982, 1985a) contradicted this belief, presenting chromosomally similar results from P. textilis throughout ―...its range.‖ However, of published material documenting sample locations, one can only ascertain that Mengden mainly sampled P. textilis in south-eastern Australia, and included only a few specimens from central Australia, one from Brisbane, Queensland (within the range of north- and south-eastern sub-clades, see below), and none from Indonesia or Papua New Guinea. Wells and Wellington (1985) erected a new species for central Australian P. textilis, and resurrected one species from synonymy for south-eastern populations. This arrangement was abandoned (but not formally synonymised) by Wells (2002), who placed a solitary P. textilis within the genus Euprepiosoma without benefit of any data or analysis. Similarly, Hoser (2003) introduced the name P. t. pughi for PNG specimens based not on his own work, but presumably on observations first presented by McDowell (1967).


210

Skinner et al. (2005) presented three clades which were differentiable geographically and wrote that it would be unsurprising if further analyses showed P. textilis to be composite. However, phylogenetic analyses were conducted using two different methods, one of which did not show high levels of support (< 50%) for a clade containing eastern PNG specimens. Perhaps because of this, due to a lack of corresponding morphological data to differentiate the clades, or because most type material was not examined, Skinner (2009) chose to recognise only a single species of P. textilis without comment, forgoing most discussion of his previous molecular results or other hypotheses of multiple taxa within this species. Williams et al. (2008) investigated the systematic placement of eastern and western Papuan P. textilis, and interpreted their results as a function of multiple Australian colonisation events. Hoser (2009) erected four new subspecies for P. textilis from the NT (two separate subspecies), SA, and Indonesia. No original data or any analyses were presented, the ideas for the subspecies appear to be derived from sub-clades produced by Skinner et al. (2005) and Williams et al. (2008), and based on the names erected, the subspecies appear to be an homage to friends and family rather than exemplars of natural variation. No past study has investigated the plethora of taxonomic hypotheses associated with different populations of P. textilis.

Is there support for a species-level split of P. textilis based on geography or the observed sub-clades presented in Chapter 4? Three well-supported clades (all 100%) were recovered in analyses (Chapter 4), corresponding to previously described geographic regions: Indonesia and central Australia (―western‖), PNG and ‗north‘eastern Australia (―northern‖), and ‗south‘-eastern Australia (―southern‖; Figure 5.18). Karyotypes of P. textilis are supposedly similar, but known samples only include individuals from the western (n = 1) and southern populations (Mengden 1982, Skinner et al. 2005). As explained by Skinner (2009), Mengden (1985a) and Skinner et al. (2005) purportedly described P. textilis chromosomes ―...with autosome pairs 4–18 being separable into two distinct size classes...‖ This statement is interesting in terms of the results of mitochondrial analyses and its contribution to the overall evidence used to delineate potential speciation. However, examination of the cited source material shows that the quoted statement was never written by any of the authors.


211 $

S

ÑS

S

S

S

S $

S

Ñ

$

S

S$

$

Ñ Ñ Ñ Ñ

ÑÑ

$ $

$

ÑÑ Ñ Ñ Ñ ÑÑ Ñ

Ñ

Ñ

S

$

ÑS

ÑÑ

Ñ

ÑÑÑ

Ñ S

$ $S

S $ $ $

$ $ $

ÑS

S

S Ñ

S

S S S S

Ñ Ñ

SS

ÑS

S S

Ñ S Ñ S ÑÑS

SÑS

SS S S

S S

S

S

S S S S

S SS

S

S S

Ñ

S

S S S

S

S S

S S

SS S

Ñ S

S S

Ñ S S S

SS S

Ñ SS $

Ñ

ÑS

S

Ñ

S

S S

S

S

S S

S

S SS

S S S Ñ

Ñ

S

Ñ

S

S

S S

S

S

S

Ñ SS

Ñ

S S S

Ñ Ñ

Ñ

S

S

ÑÑ $

ÑÑ S Ñ S Ñ S Ñ SÑ $ ÑÑ Ñ $ S S S ÑÑS Ñ Ñ SÑ Ñ ÑÑ Ñ Ñ Ñ ÑÑ Ñ Ñ Ñ S Ñ S Ñ $ SÑ S $Ñ ÑS S S S S S ÑÑ SS SS SÑ

Ñ

S $

SS SS S

Ñ

Ñ

S

ÑÑ Ñ

Ñ S

S S S S

Ñ

Ñ

Ñ

$

Ñ

Ñ Ñ ÑÑ Ñ Ñ

Ñ

$

S

Ñ

SÑÑ

$ $ $

Ñ

S $

S

Ñ S S SS SS S S S

S S

S

SSSS S SSÑ SS

S

S

Figure 5.18. Distributional map of Pseudonaja textilis, organised by minimum convex polygons associated with major clades resulting from analyses of mitochondrial sequences. Specimens included in morphological analyses are labelled according to final DFA sub-group prediction (western = black triangles, northern = grey plus symbols [+], and southern = open circles).

Principal component analyses consistently recovered heterogeneous results and were unable to separate snakes between sub-clades nor Australian snakes from those originating in Indonesia or PNG, (see discussion near start of this section; Figures 5.19a and 5.19c). Although DFAs were able to sort individuals when clades or geography were specified, the predictive resolution of DFAs was poor, with analyses consistently predicting snakes from Indonesia and PNG as belonging to the southern population. Univariate analyses were similarly poor in their ability to separate groups, with only two characters even able to separate more than half of each sub-population (Table 5.7). To underscore the preceding statement, no diagnostic character(s) listed within previously-published descriptions of P. textilis sub-taxa can actually differentiate P. textilis sub-taxa. Given karyomorphic and morphological similarities, as well as fairly


212



12

20 Mainland Island

Mainland Island

10

8

15

6

10 Root 2

Factor 2

4

2

0

5

?

-2

♂

-4

♀

-6

0

-8 -20

-15

-10

-5

0

5

10

15

-5

20

Root 1

Factor 1

c) Genetic sub-clades: PCA


10

16 Southern Northern Western

8

Southern Northern Western

14

12 6

♂

10

8

2 Root 2

Factor 2

4

?

0

6

4

2

-2

0

♀

-4

-2

-6

-4

-8

-6 -20

-15

-10

-5

0

5

10

15

20

-8

-6

-4

-2

Factor 1

0

2

4

6

8

10

Root 1

Figures 5.19a–d. Results of multivariate examinations (PCA and DFA) of Australian vs. insular, non-Australian and of genetic sub-clades of Pseudonaja textilis. Gender divisions of P. textilis are also illustrated in both PCA charts.

Table 5.7. Characters which separate geographic populations of Pseudonaja textilis by more than 50% of total variation. Character Eye Width / Eye to End of Snout Relative Size of Postocular Scales Compared to Each Other

Southern

Northern

Western

0.42–0.86

0.32–0.65

0.43–0.63

Bottom Larger or Even: 71% Top Larger: 29%




213

continuous (or overlapping) distributions, it is unlikely that these sub-clades are geographically or reproductively isolated enough (or have been for long enough) to prevent interbreeding. Further resolution may be provided by karyotype analyses of northern populations as well as breeding experiments utilising snakes collected throughout their full range of distribution.

What is the taxonomic status of P. textilis? Recent morphological and molecular evidence provide support that P. textilis is most likely a monophyletic species within the genus Pseudonaja. Euprepiosoma is a junior synonym of Pseudonaja (see also the interpretation of results in the sections on P. inframacula and P. ingrami, above). Several publications on P. textilis systematic taxonomy and nomenclature have arisen in the last two decades, in which previously published systematic hypotheses have not been synthesised or which have presented new taxonomic names without providing accompanying support or justification for these actions. Absent any definitive morphological character(s) which can be correlated with recovered mitochondrial clades, only P. textilis—no sub-species—is recognised. If three subspecies are to be recognised based primarily on distributional and mitochondrial differences, synonyms are provided in Table 5.8.

Characters removed for lack of or highly reduced variation in P. textilis morphological analyses (3): Number of largest Infralabial scale? (4); Number of Preocular scales? (1); and Does a Temporal scale wedge into the Supralabial scales? (no). Oxyuranus microlepidotus – Two snakes which would eventually be known as Oxyuranus microlepidotus were described by McCoy (1879a), who erected the species on the basis of the number and size of DSR (especially MDSR). The type specimens possess a single anal scale (a character diagnostic of the genus), yet the sole junior synonym of this species possessed a paired anal scale (a character diagnostic of Pseudonaja). Kinghorn (1955) synonymised the two species into a new, singular genus, Parademansia, based primarily on skull and teeth characters. The species was redescribed by Covacevich and Wombey in 1976, who noted that colour and eye size were the only reliable external distinguishable features. The authors included a map displaying the location of all Australian Oxyuranus museum specimens known at the time of publication, which showed O. microlepidotus with highly disjunct populations


214

Table 5.8. Nomenclatural priorities for geographic populations of Pseudonaja textilis, should they be accepted as valid subspecies. Geographic Population Southern

Nomenclatural Priority Pseudonaja textilis textilis (from Furina textilis)

Synonyms Pseudoëlaps superciliosus Demansia annulata

Note: may be P. aspidorhyncha Note: may be P. aspidorhyncha

Pseudoelaps Sordellii Pseudoelaps Kubingii Pseudoelaps superciliosus Beckeri Cacophis Güntherii Furina bicucullata Pseudechis cupreus (part.) Pseudonaja elliotti Pseudonaja textilis rollinsoni

Western

Pseudonaja textilis ohnoi (from Pseudonaja ohnoi)

Pseudonaja textilis leswilliamsi Pseudonaja textilis jackyhoserae

Northern

Pseudonaja textilis Pughi

None

Other

Pseudonaja nuchalis

Pseudonaja textilis cliveevattii

in QLD/SA, NSW, and Victoria. Mengden‘s (1982) solitary O. microlepidotus with known coordinates came from southern QLD. A later publication (Longmore 1986) would predict O. microlepidotus to occur further westward, including in eastern WA, where a third species of taipan (O. temporalis) was recently discovered (Doughty et al. 2007). Covacevich et al. (1980) synonymised Parademansia with Oxyuranus, provided further differentiating features between O. microlepidotus and O. scutellatus, including skull characteristics, and noted that counts of MDSR were consistent at 23 (with one exception: 25). Few questions have been asked about this species other than if it belonged in its own genus (Parademansia).


215

Is there support for any taxonomic split of O. microlepidotus based on observed subclades (Chapter 4)? Of informative sequences, only two sub-clades were present in mitochondrial analyses (Chapter 4): two specimens from north-eastern SA through to south-western QLD vs. one specimen from central SA. This split was given a high level of node support (100%). However, the sample sizes for this species were low, making interpretation of such a small molecular analysis difficult and impossible for multivariate analyses of morphological data. More samples are needed for adequate molecular analyses in order to determine if molecular differences are part of a larger, real division in this species.

Is there support for a taxonomic split of nominal O. microlepidotus based on the number of mid-body dorsal scale rows (21 vs. 23) or geography (Queensland vs. South Australia)? Covacevich and Wombey (1976) examined seventeen O. microlepidotus (listing the museum registration numbers), but reported MDSR counts for only seven specimens (which were not identified). Each of the seven specimens examined possessed 23 MDSR. However, of the 17 snakes measured for this character for this thesis, 4 possessed MDSR counts less than 23. Differences in MDSR counts could be differentiated geographically, with lower counts comprising a majority (three out of five) of the northern-most distributed O. microlepidotus specimens examined (all located in Queensland at greater than -25° latitude; Figure 5.20). Interestingly, multivariate analyses of morphology did not yield homogenous results when the graphical output was labelled by MDSR count, even though some univariate characters could differentiate snakes from the two clades (Table 5.9). Conversely, multivariate analyses showed that northern-most snakes were more alike than southern snakes (Figures 5.21a and 5.21c) but no univariate character supported this separation. The two locations most likely represent individuals of the same species and results merely show slight clinal variation—variation which seems more dramatic due to low sample sizes.

Type specimens for this species were originally recorded seemingly far beyond their normal distributional limits, at the convergence of the Murray and Darling rivers. One of the type specimens is not damaged and was recovered in multivariate analyses near to the positions of the northern-most snakes. This may lead to a hypothesis in which the type materials may have been carried along the Murray-Darling catchment during a


216 $ U % Ñ

U %

$

U % U % U % U %

U %

U %

U %

Figure 5.20. Ordered presentation of the number of MDSR present in Oxyuranus microlepidotus. Black triangles = 21 MDSR, plus (+) symbol = 22 MDSR, and open squares = 23 MDSR.

flood event. However, this catchment is still outside the known distribution of most O. microlepidotus specimens, indicating that there simply may be a high level of morphological variation among all populations of this species, some of which have been locally extirpated. Sample sizes for analyses of O. microlepidotus are generally low, making detection or interpretation of any patterns—and resolution of any hypothesis— difficult.

What is the taxonomic status of O. microlepidotus? Most past and recent morphological and molecular evidence provide evidence that O. microlepidotus is a monophyletic species within the genus Oxyuranus. Further research is recommended involving the karyomorphs of the northern-most distribution of this species. However, it is likely that these snakes are part of a morphological cline and not separate taxa. No subspecies are known or recognised.


217

Table 5.9. Morphological characters which separate mitochondrial clades of Oxyuranus microlepidotus by more than 50% of total variation. Note the small sample sizes of undamaged, non-type specimens available for analysis. Character Fore-Supraocular Scale Width / AftSupraocular Scale Width Lower Postocular Diagonal Scale Diagonal Height / Head Length Bottom Rostral Scale Length / Head Length Preocular ScaleSupralabial Scale Suture Length / Head Length Fore-Snout Width / Head Length Eye Height / Head Length Preocular Scale Width / Head Length

21 MDSR (n = 3)

23 MDSR (n = 9)

≥ 0.6: 100%

≤ 0.6: 100%

≤ 0.95: 67%

≥ 0.95: 100%

≤ 0.04: 100%

> 0.04: 100%

< 0.06: 100%

≥ 0.06: 89%

≤ 0.23: 100%

≥ 0.23: 100%

< 0.08: 100%

≥ 0.08: 100%

≤ 0.073: 100%

≥ 0.073: 100%

Characters removed for lack of or highly reduced variation in O. microlepidotus morphological analyses (14): Internasal scales present? (yes); Number of largest Infralabial scale? (4); Number of Infralabial scales touching the Pre- and Post-genial scales? (4); Ventral Rostral scale pattern? (wide); Oncoming Rostral scale pattern? (wide); Combined Rostral scale pattern? (wide + wide); Number of Postocular scales? (2); Relative size of Postocular scales compared to each other? (bottom larger than top); Frontal scale-Interorbital scale colour stripe percentage? (0); Parietal scale colour stripe width? (0); Total percentage width of head stripe? (0); Is there a head band/interorbital colour stripe? (no); Is there a neck band?; and Glossy scales present? (no).


218

a) Geography: PCA


15

6 > -24° Latitude < -24° Latitude

> -24° Latitude < -24° Latitude 5

10 4

3

♀

2 Root 1

Factor 2

5

0

1

?

0

♂

-5

-1

-2 -10 -15

-10

-5

0

5

10

15

20

Factor 1

-3

c) MDSR: PCA


15

10 21 Rows 23 Rows

21 Rows 23 Rows

5

10

0

Root 1

Factor 2

5

-5

0

-10 -5

-15

-10 -15

-10

-5

0

5

10

Factor 1

15

20 -20

Figures 5.21a–d. Results of multivariate examinations (PCA and DFA) of Oxyuranus microlepidotus populations based on geography and MDSR. Gender divisions of O. microlepidotus in PCA graphs are nearly identical in all PCAs and are thus only demarcated within the first graph.

Oxyuranus scutellatus – Oxyuranus scutellatus was first described in 1867 (Peters) and recognised as a new species, primarily on the basis of possessing 23 MDSR and a single anal scale. Two specific and four sub-specific synonyms followed over the next 142 years. One of these accounts (Kinghorn 1923) demonstrated variation in MDSR (21 vs. 23), a character trait confirmed by Covacevich et al. (1980), who also provided further differentiating features—including skull characteristics—between O. microlepidotus and O. scutellatus. Three of the four subspecies were erected by Hoser (2002, 2009), who did so without benefit of any data or analysis. No study has investigated subspecific geographic or morphological variation of O. scutellatus.


219

Is there support for a taxonomic split of nominal O. scutellatus based on Australian geography (Queensland vs. Northern Territory and West Australia)? Hoser (2002) originally proposed a WA sub-species of O. scutellatus based on geography (which the author presumed would eventually be shown to include the NT population), an action not permitted by the International Code of Zoological Nomenclature (―Code‖; International Commission on Zoological Nomenclature 1999). Wüster et al. (2005) subsequently declared the name erected by Hoser (2002) for the WA sub-species to be a nomen nudum (―naked name‖ = name published below the standards set forth in the Code and thus not considered to be valid), based on the fact that no characters were provided to differentiate the taxon. In 2009, Hoser redescribed the WA and NT populations on the basis of the following characters: snout not lighter in colouration than rest of head, shape of head rounded instead of coffin-shaped, and geography. A fourth character, purportedly dealing with neck scale rugosity, was poorly worded and mistakenly described a recurring lack of neck scales in eastern Australia and PNG specimens. Interestingly, although the holotype for this subspecies is the same in both accounts, each account provides a different description of the snout colour character. In 2002, Hoser claimed that the holotype (WAM 60666) had ―...a paler head, particularly near the snout‖, whereas in 2009 Hoser wrote ―...this taxon does not have a distinct lightening of the snout‖ which was one of ―...the most simple means to separate this taxon from all other Oxyuranus scutellatus subspecies.‖ As can be seen in Table 5.10, the character states provided by Hoser (2009) are incorrect and are not indicative of NT and WA taipans. Overall morphological differences are not seen in univariate or multivariate analyses (PCA; Figure 5.22a) when comparing differences in Australian geography, nor are they separable in DNA analyses (Chapter 4; but see the section below, regarding MDSR). There appears to be no valid support for recognition of a ―north-west‖ sub-species of taipan.

Is there support for specific taxonomic recognition of insular O. scutellatus? In 1956, Slater proposed that O. scutellatus from PNG were suitably different enough from Australian O. scutellatus to warrant sub-specific status (O. s. canni), based primarily on the following evidence: the presence of a vertebral stripe, keeling of the dorsal and lateral body scales, skull characters, and chemical composition of the venom (evidence for this latter character was not presented by Slater). Slater (1956) noted that the MDSR


220

Table 5.10. Summary results of three diagnostic characters put forth to describe northwestern Oxyuranus scutellatus by Hoser (2009). A fourth character was poorly explained and could not be assessed nor inferred from the description. Character Snout Colouration Shape of Head Geography

As Described Not lighter than rest of head Not coffin-shaped NT and WA

As Measured Lighter: 9/11 Coffin-shaped: 10/11 NT and WA: 11/11

of all specimens examined (n = 13) each possessed a MDSR of 23. Hoser (2009) proposed that there existed a second sub-species of O. scutellatus in PNG, with very little information (and no data) provided to justify such a distinction. Three characters were used to delineate this new sub-species from the others: geography, the lack of a vertebral stripe (though the author discusses that both PNG sub-species may or may not possess a vertebral stripe), and colouration (grey to black [canni] vs. olive or brown [adelynhoserae]). No mention was made about MDSR, specimens examined, or other basic information helpful to confirm the author‘s hypothesis. The types examined by Hoser are predicted by DFA to be of canni stock (type results listed at end of Results section), do not match his description, and given comments by the curators of the two museums housing the type material (BMNH and CAS), Hoser does not appear to have examined the type material in person, if at all. Australian and PNG taipans are not separable on the basis of morphological multivariate analyses (PCA; Figure 5.22c) and genetic analyses of mitochondrial sequences (Chapter 4; but see section below, regarding MDSR). Although there are occasional morphological differences (such as the presence of a vertebral stripe) in some Pacific Island specimens as compared to Australian individuals, such variation is likely a product of insular conditions, not an indication of separate species. There appears to be no valid rationale for the recognition of a second sub-species from PNG as proposed by Hoser (2009).

Is there support for a taxonomic split of nominal O. scutellatus based on the number of mid-body dorsal scale rows (21 vs. 23)? Undiscussed by most researchers are the dual character states present within O. scutellatus MDSR (~67% of specimens possess 23


221

a) Geography: PCA


20

8

6 15 4 10

♂

5

Root 2

Factor 2

2

? ♀

0

-2

0 -4 -5

NT QLD PNG WA

-6

-8 -100

-10 -20

-15

-10

-5

0

5

10

15

NT QLD PNG WA

20

-80

-60

-40

c) Mainland vs. Island: PCA

0

20

40


20

10

15

5

10

0

Root 2

Factor 2

-20 Root 1

Factor 1

5

0

-5

-10

-5

-15 Mainland AU Island PNG Island

Mainland AU Island PNG Island -10 -20

-15

-10

-5

0

5

10

15

20

-20 -100

25

-50

Factor 1

0

50

100

150

200

Root 1

e) MDSR: PCA

f) Same as previous: DFA

20

6

4 15

2 10

Root 1

Factor 2

0

5

-2

-4

0

-6 -5 -8

21 Rows 23 Rows

21 Rows 23 Rows

-10 -20

-15

-10

-5

0

5

10

15

20

25

-10

Factor 1

Figures 5.22a–f. Results of multivariate examinations (PCA and DFA) of Oxyuranus scutellatus populations based on overall geography, insular vs. mainland populations, and MDSR. Gender divisions of O. scutellatus in PCA graphs are nearly identical in all PCAs and are thus only demarcated within the first graph.


222

MDSR, ~21% possess 21 MDSR, and no data exist for ~12% of specimens—stored only with a head and/or tail). Individuals with 21 MDSR appear to be restricted to PNG and northern QLD (with the exception of one specimen near the NSW border), while specimens possessing 23 MDSR are found throughout the full distribution of this species (Figure 5.23). Similar to the results presented above, morphological differences are not seen in univariate or multivariate analyses (PCA; Figure 5.22e) or in analyses of mitochondrial sequences (Chapter 4). Of the latter analyses, one can describe the O. scutellatus clade as being shallow, as containing many haplotypes, and with only approximately half of those haplotypes showing close relationships with each other. The geographic locations of the members of one sub-clade are dispersed throughout the east coast of QLD, non-affiliated haplotypes are distributed in the same pattern and in the NT, and a second sub-clade contains haplotypes from throughout the full distribution of the species.

As mentioned above, examinations of these specimens and their mitochondrial structure showed that a shared haplotype can be present in all Australian states and territories (in which the species in distributed), can be present throughout both Australia and PNG, can show variation in the presence of a vertebral stripe in PNG specimens, and can show variation in the number of MDSR. However, this latter point is slightly misleading in that only one snake known to possess 21 MDSR has been successfully examined genetically (located in northern QLD, it belongs to the sub-clade which includes animals from the full distribution of this species). Several of the mitochondrial sequences came from other studies, in which museum registration numbers or basic scale counts were not provided. There is a small chance that an examination of additional specimens possessing 21 MDSR will show that this character can sort out into a single sub-clade. This is unlikely, given the shallowness of the overall species clade, the general distribution of snakes with shared haplotypes, and the lack of overall morphological diversity. Without further evidence, O. scutellatus should not be split taxonomically based on MDSR.

What is the taxonomic status of O. scutellatus? Past and recent morphological and molecular evidence provide evidence that O. scutellatus is a monophyletic species within the genus Oxyuranus. Further research is recommended involving the karyomorphs of specimens from Indonesia and Papua-New Guinea, as well as


223 % U $ 3 2

1 2

$ 1 2

$ 1 2

$ 1 2

$

U % $

1 2

2 3 1 2

U % 3 2

U % 3 2

U %

U %

3 2

3 2

U % 3 2

$ 12 2 1

U % 3 2

U % % U

U %

3 2

3 2

3 2

U % U $% 3 2

3 2

1 2

% U U U% % U % U % 3 2

3 2

3 2

3 2

3 2

U % 3 2

U % 3 2

U % 3 2

U U % %% U U % 3 2

3 2 2 3

3 2

%% U U 3 2

3 2

U % 3 2

Figure 5.23. MDSR counts for O. scutellatus throughout its distribution. Black triangles = 21 MDSR and gray squares = 23 MDSR. Note that reduced MDSR counts are confined to PNG and northern QLD. Also note one museum record listing a collection location in Renmark, SA. Although museum records do not list the circumstances of donation, this is not likely part of a natural SA population. Rather, it is most likely a donation from a well-known, local zoo (Bredl‘s Wonderworld of Wildlife, Renmark, SA), the owners of which have a record of natural history investigation and specimen donation (Bredl family personal communication).

individuals with only 21 MDSR. Taxonomic recognition of insular O. scutellatus should be restricted to the original O. s. canni, as originally described by Slater (1956). Two subspecies of Oxyuranus scutellatus (scutellatus and canni) are recognised.

Characters removed for lack of or highly reduced variation in O. scutellatus morphological analyses (6): Internasal scales present? (yes); Ventral rostral pattern? (wide); Relative size of Postocular scales compared to each other? (bottom larger than


224

top); Does a Temporal scale wedge into the Supralabial scales? (yes); Glossy scales present? (no); and Is the tail banded? (no). Oxyuranus temporalis – Oxyuranus temporalis is known from only one specimen collected in south-east WA (Figure 5.20). Its recognition as a taipan was based primarily on the results of mitochondrial analyses (Doughty et al. 2007) and partly on scale counts and patterns (some of which are shared by Pseudonaja). These analyses led to a variety of new hypotheses, including the possibility of the specimen being a hybrid cross between a taipan and a brown snake. Given the existence of a single specimen with questionable ancestry and the availability of fresh genetic material, it is recommended that further genetic analyses be undertaken (nuclear and karyotype) before final acceptance of this species. As there is only one specimen, O. temporalis could not be included in multivariate analyses. It was included, however, in a predictive DFA (see below). Predictive success for damaged and undamaged, non-type specimens – Post-DFA snakes were plotted using a GIS map and compared with previously-created and new (such as P. modesta sub-clade 550) minimum convex polygons (MCPs). Most nondamaged snakes found in MCPs (including molecularly-analysed specimens) were assigned to sub-clade groups as predicted (Table 5.11). Among 158 non-damaged specimens found outside of MCPs, only four were located outside of reasonablyexpected species-level distributions (such as a P. affinis designation being applied to a snake from southeast Queensland; Table 5.11). Similarly, four out of 163 damaged specimens showed incompatible distributions. As can be seen by these morphological results, even specimens with known cladistic placements were assigned to the wrong clade or species. This shows not only that the DFA method is not a perfect analytical tool, but also highlights the phenotypic plasticity of these snakes. Final distribution maps and DFA accuracy summaries are listed in Figures 5.24–5.32 and Table 5.11, respectively. Note that all records of original collection locations may not be accurate and that some specimens are no longer held by their respective institutions. Predictive success for type material – Type material were also subjected to a predicted discriminate function analysis, with taxon-specific results incorporated within each ‗species‘ summary listed above. Overall results are listed in Appendix XIII—not all


225

Table 5.11. Summary of final DFA predictions for all examined material. For specific information about the predictive results of type material, please see Appendix XIII.

Taxon Within MCPs, Non-damaged Outside MCPs, Non-damaged Damaged, All Locations Type Material

Mean SubClade Support for ‗Correct‘ Identifications 0.991 0.934 0.960 0.964

Number and Percentage ‗Correctly‘ Identified 964/996 = 96.8% 154/158 = 97.5% 159/163 = 97.5% 56/74 = 75.7%

Mean SubClade Support for ‗Incorrect‘ Identifications

Number and Percentage ‗Incorrectly‘ Identified

0.797

32/996 = 3.2%

0.994

4/158 = 2.5%

0.875

4/163 = 2.5%

0.946

18/74 = 24.3%

type material was assigned to expected groups (as with the results of the methodological exercise presented in Chapter 2). At the broader, species level, only three of 76 type specimens were predicted ‗incorrectly‘. All three were type material designated by Hoser (2009): P. a. charlespiersoni (predicted to be a P. modesta), P. t. cliveevattii (predicted to be a P. ‘nuchalis’), and P. t. rollinsoni (predicted to be a P. inframacula). At the sub-clade level, an additional fifteen specimens were predicted ‗incorrectly‘, twelve of which were insular in origin and/or damaged, conditions which can affect scale measurements and ratios (as discussed previously in this thesis). Also, three of these ‗incorrect‘ group assignments were a function of the way in which the DFA was calculated. Despite evidence against such a division, two ‗sub-clades‘ of O. scutellatus were included: Australian (O. s. scutellatus) and PNG (O. s. canni). The insular type specimens for this species consistently grouped with mainland Australian specimens, a ‗correct‘ assignment based on molecular results presented in Chapter 4, but recorded as ―incorrect‖ due to way in which the analysis was configured. None of the aforementioned success ratios include Oxyuranus temporalis which, because of only a single known specimen, makes inclusion in multivariate analyses as its own taxa impossible. It was included for prediction from among other included groups and received 88.4% support for membership within WA P. affinis.


226

Western Australia South Australia #

# #% # U # #

#

# #

# # # # # ### # U % # # # # U # % # ## ## # #% # U % U # # # # # # # # # # # # ## # # U % # # # # # # # ## # U % # # # # # # # # # ## ## # # # # ## # # # # # # # # # # # # # # # ## # # # # # U % # # # ## # ## # # # U % # ## # # # # U % # # # # # # # # ## ## ## ## U % #Ñ # ## # # # # # # # ## # # # # # # # ##% U % Ñ Ñ # # # # # ##### ## # U # # # # # # # # # # U % # ## U # # # # # # % # # U % # # # ## # ## U % # # # # # ## # # # ## ## # ## # # #% U # ## # # # # # U % # # # % U U % ## ## #% # ### # # ### # # ### # U % U # ## U % ## ## #### # ## # ## U % ### # # # # # # # ## ### ### # ## # ## % # ## U % # # U % # U ## # ## U % # # #% # # # U # ##### ## # # #### # ## # # # # # ####% # # # ### # # # U ## #% U # #% #### U U U# # # # % ## ## U % # # # # #% # # ## ### # U ## U % ### ## ## # # # % U % # # # U U % U ## # # % U % ## # ## # # U % U ## # # ## # #% # ## % # # ## # U % $ ## # ## # # # ## # # # # # ## # # # # U % # U # # # # # % U % # U % # # # % U ## # # ## # # # ## # # ## ## # #% U U # %

NN

# % U

# # U # U % ## %

# U ### ### # #% # % U U % U % # U # %

# # #% U U # # U #% $ ### ##%

#% $ # U # $ # U %

# $# ## U % # #$ # #% # U #$ ##$ $ # #

# # $ #$ $ ## #$ $

# U %

# $

$ # # $ $ # # $ % # $ # # U $ U % # $ # $ # ## $

# #

N

##

Figure 5.24. Final distribution map of measured, non-damaged Pseudonaja affinis. Open squares = P. a. affinis, black plus (+) symbols = P. a. exilis, black crosses (X) = P. a. tanneri, black triangles = P. a. charlespiersoni, and grey circles indicate the full range of historical museum holdings.


227

# $

# $ # $

#

# $

# U % # $ # $

#

# $

#

# # #

# $

# # ## $

# U % # # $

## # % U #

# U %

# U %

# U %

# #

# U %

# #

# # # U % # # U %

# # U %

# U %

# $

# # # # ## U # ## % U % ## # # # # # #% # # ## # U # # # ### ## U #% # # # # # U # # #% ## ## ## ### # # ##### # U % U % #

NT

## % U % # U U %

# U %

# U %

#

#% # U # U % # % U #

# U %

# # U % #

#

# U % #

#% # U #

# U %

# U % # # # U % # U %

# % U

# U %

#

QLD

# # U %

SA

##

# # U %

#

#

# #

NSW

#

# U %

#

Figure 5.25. Final distribution map of measured, non-damaged Pseudonaja guttata. Open squares = P. g. guttata, black triangles = P. g. whybrowi, and grey circles indicate the full range of historical museum holdings.


#

#

U # U %

U # U %

#

#

## U # ## U U U ### U # # % U %

228

South Australia

# # # # #

# # #

#% U# # # U ## # # #

#

#

# ##

U # U $ %

U ## # # U U %

# U # U %

#

#

#

# U U %

#

# ###

U # U %

# ## # # # # U U # # U# # # % ## # ###% U## # U # # # # # ## U % # U ## # U ## # U% # U % U# # ### U ## U # U %

#

# $ $ # $

# #

# ## # # U## #U# # # ### # ## ## # U # U # # # # ## % U # U % #

Figure 5.26. Final distribution map of measured, non-damaged Pseudonaja inframacula. Open squares = P. i. inframacula, black triangles = P. i. (new subspecies), and grey circles indicate the full range of historical museum holdings.


229

# U %

#

## # # #####

# #U # # #% # U %

##

# #

# U %

# U % # U %

QLD #

NT

# % U

# U %

# U %

# U %

# #

# U % #

# U %

Figure 5.27. Final distribution map of measured, non-damaged Pseudonaja ingrami (open squares). Grey circles indicate the full range of historical museum holdings.


230

N# N# N#

#

# #$ # # $

# # #$ # $ ### #$ # #$ ## ### # # % # U # # # # # $ #

## # $ # $

# $ # $ # $

## #

# $

N#

# # U % # $

N#

#

N#

##

# U %

# # # # ## # # ##$# # # #$ ##

N#

N# N#

N# N N

N#

N#

# Ñ

##

#

# Ñ Ñ #

N#

# Ñ

#

# #

WA ## U % #$ # ## U % # % ## U % U #

# U %

# U %

# U %

## $

# U % #

# $

# % U # U %

#

# U % # U %

#

# $

# Ñ

# #

#

# # # % U #% #% # # U U

# #Ñ

# #% % U ## U

# U %

# U %

# Ñ

#

# Ñ

#

# Ñ # U %

# # ## U % # # $ # % U # #% # U # # $ # U % # U %

# Ñ

# ## #Ñ ## ## ## # # # ## Ñ # # ## Ñ Ñ # # #

#

N#

# Ñ # Ñ

#

# # % U # U %

# U % # U %

#

# Ñ

# $

SA

# U %

# U %

# U %

# Ñ

# # U % # # # # # # #$ # # # # % U U % # # # # U % $ # % U # # % Ñ U % # U # # ## % U U % # U % ## # # # U % # % U # U % # U % #% ## % U U # # # U % # # # U % # U % # U % ##

# U % # # U %

##

N# N#

# U %

# U %

N##

N#

QLD

#

N#

N#

# # % U # U %

NT

# U %

$

# # # # $ # # # #$ # # ## $ #### # ### # # # ## # #### #$ # # # # # #### ## # ###$ $ # ########## #$ # # ### # $ # # # # # ####$ $ # # $ # # #### ##### $ $# ##

N#

# $

# # $ $ # # $ # $ #$ $ # # # # # # # U % # $ $ ### # # $ # $ ## #$ ## $ # # #$ U % # # # # # $ ### ## # # # # # $ $ $ # $ $ #$ # ## # $ # # # #$ # # ## # # $ # $ # # # $ # # ### # # U % # ## # $ #$ # $ # ## $ # # $ # # $ U % # #$ # $ # # $ # ## # $ #$ $ # # # # # $ ## # ## #% # U # # $ ## $ # # $ # # $ # $ # #$ ### # # # ## $ #$ # # # # # $ $ # $ ## # # # # # # # # $ # $ # ## # U % # # ## # $ # #### # ## # # # # # ## $## # #$ $ # # # ## ## ## # # $ # # # # # $ # $ # $ $ # $ # # # # $ # # # #

# $

N# # N# N# #

# Ñ ## Ñ

#Ñ Ñ # # #

# Ñ

# # # Ñ #

# # U % # # U %

# # Ñ # # Ñ Ñ #

NSW

# ## # ### # # ##$ #

# # # U %

# U %

Figure 5.28. Final distribution map of measured, non-damaged Pseudonaja modesta. Open squares = P. m. (ramsayi or new subspecies), black triangles = P. m. modesta, black plus (+) symbols = P. m. (ramsayi or new subspecies), black crosses (X) = P. m. sutherlandi, and grey circles indicate the full range of historical museum holdings.

Chapter 5: Morphological Redescription N# N# # # # N#####N#######N#N##### ### ##N N# N#### # # N## ## N# N### N## N# # N# # U % # N N## # # N N##

N# N# # N

### # ## #

N

# # U % # ## U # % U # N###% #

#

N# N#

NN

N#N#N## N #

# ### ## % # U # ## #% # U % U

U % # U ###% # ### U # #% # # # ## U % # U #% # # # # # # # U % # U % U % # # # # # % U% # U % # # # #% # # U # # U # # # # U % # # ## % U U# # # % # # # ## U % ## U % # # # # U % # # # # # # # U % U % # # ## U % #U # ## U #% # # U % # ## # % # U % U ##% U ##% # # # # # U % # # # # U % ## # U % # # # U % U % ## # ## # # U % # # ## ### U % U % # #% # U % U % # ## # U % # ## U # U % # ## # # ## #% # ## ## # # # # # U U % # ## # # # U % # # ####% U % U % ## # U # # # # # # # # U % # ### # % ## % # U # # # U # # ## # # ##% U % # # # ## # # U % # U # # # ## U % # U % ## # # # U % ## # # # % # ## U % # # # # # U # ## # # U % ## # U % ## # # # U % # # # # # #% # # # # ## # ## # U # U % # # # ## # # # # # ## #### # # # ### # #### # ##% U # ## # # ## # #% U ### # # U % ### ## ## % # # # # # # U % U ## # ### % # U ## ## # # # ## # # #% ## # # # # # U % # ## # # U ##### ### # # # ## # ## # ### ## # ### ##### # # # # # ## # # U % # # # # # # # # # # # # # ###% U ## # # #% U # # # # # # # # # # # # ### # ### ## # # # # # # U % # # ## # # # # # # # # # U % U % # # ### # # ### # ## # # ## ### # % U U #% # ## # U % # # # # # # U % ## # # # # U %

# U #% % U

WA

N N

N

# U %

# U %

#

# U %

#

N#

# U %

N#

# $ #

N# N

# # N #

# U %

# U %

# U %

QLD

## # # ##### # # # # % # U # % U #

#

N#N# #N#N# #

#

# U %

# U % # ## U % # # # # # # ## #### # # ## #% U ### # # # ## # # U % #% # % # # # U U # ## # # U U % #% ## # # # # # # # U % # U % # ## U % # # # #% U # U % # # U % U % # # % U % # # U # # # ## U% % U U % # # $ $

N

# N# #N% # U

N#

## # U #% # ## # U %

# # N# $ N#

#

N#

# U % # % U # U % ## U % # U %

N# #

#

# # N# N#

N#

# ## # # U % # #

SA

#

N

N N

N#

#

N###

#

N# # # U %

# $

# U %

$ ## ## # # $ $ # #

# # $

# U %

# U %

#

N

U % # U # U % % ## U %

# #

# ## # U % # U %

# U %

# # # ## U % # U % # U % # U %

# U %

N

#

##

# # U %

N#

NT U %

#

## # # U # #%

#% ## U % U

231

# $ # % U #

#

# # $ #

#

# $

# #

# $ #

# $ $ # # #$ #$ # # $ U # #% ## # $ # $ # N# ### ## # U % # ## # # # # $ # $ # # # # $ #$ # $ $ # #$ U % # $ # # # #$ # $ # # # $ #$ # # U % # # U % $ # # # # $ U # ## # $ $ ## # % # #$ # $ ## #####$ U % #$ # $ #### # ## % # # U % # # U $ # # $ # ### $ # # # $ $ # # ## # # % U # $ ## # $ # # $ ### # $ # # $ ## ## $ # # U % # # % #$ # $ # # U # #$ # # ## $ # # # ##$ ### # ## $ # # # U % # ## # # # $ # ## # $ # # ##$ # # $ $ # ## # # # U % # U % # # U % ## $ # # #% # # # # $ $ # # ### # # # $U # $ # # $ #$ ## # # # # # U % $ # # $ # # ## # # U # # # # # # # $ U # $ # # $ # ##% # ##% $ # $ # # # # # ### $ ## $ #$ # # # # # # # # $ # # # $ ## ## $ # ## # $ # # ## $ $ ## # # # # # # # # $ $ ## # #$ # # # $ # $ # $ # $

#

# #

NSW

VIC

# #

#

Figure 5.29. Final distribution map of measured, non-damaged Pseudonaja aspidorhyncha, P. mengdeni, and P. nuchalis. Open squares = P. mengdeni, black triangles = P. aspidorhyncha, black crosses (X) = P. nuchalis, and grey circles indicate the full range of historical museum holdings.


232

PNG N

##

IND # $

# $ ## U % $$ #

$

#

##

N

# #

N# # #N

# # # $ # % U ## U % # # # # U % # # # # U % # # ## U % # U % # U #% U % # U % # # % U % # # ## # U # ## # # U % U % ## U % U % # # ## # $ # # % # U # N# # # #% U #% # % U U # # # U % # U % # # # U % U % $ ## # $ ## ## U % # # # # U #% N# # # $ N#$ # # # U % ###% ## # ##% U % U U % ## U # % # # U U % # # U % # # # # # # # ## U U % # # # # U % # # # U % # U % # # #% # # # U ## # N# N# ## #% # # U # ## U % # #% #$ U % U % # # ## U % # ## # # # #$ # # # % # $ U % # N# ##$ ## U % U # ## N# # # # # # ## U % % U U# N % # # $ ### ## $ # ## # ## N # $ # U % # # ## $ U # # ## #$ ## # # #% # # U % U % # # $ ######## # U # ## #% U % ### ## # # # # # U % # # # $ # # #### # # # # # # ## # # $ U % ## # # # ## U % U % # # U % # ## # # ## # # # # # # # N## U % # # ## # # # U % # # # # U % # # # # ## # # # # #### U % # $ # ## ## # # # # # # # U % # U % # # # U % # # # # # # # $ # # U % # # U % N U % # # # # # # # # # # # # # # # # # # # $ # # # # ###### # # # $ U % # # # # # ### # #% ## # $ U % ## ## # # ## # U # U % # # $ # # ### # # # ### ## # U U % #####% #% # # $ U % ## # ## # # # # $ $ # # # U % # U % U % # # #U # # #% # U % U % # # % # U % U % U U % # # ### U ### # # # $ # # # # $ $ # # U % # % ## # # $ # #N U # ## ## # U % # # # # $ # $ # $ N#### # # # # $ # # # ## $ # $ ## # U % ### N#% # ## # U # # # #$ $ $ ##$ # #### # ## # # # # # ### #$ # #% # # # # # # # #$ # #### # #$ # % ## U % U $ U # # ### # #% $ $ U #$ # ## $ #$ # ## # $ U % # # # # ##% # $ ## ## # $ U ### # # $ ## ## ## $ # # # # #% # # $ U #### ## $ $ # ## # $ # # # ## # #$ # ## U % ##$ # #$ # $ ## ##$ ## # ## U % ## #$ # ## $ ## # # ## # ### $ #### # # # U % # # # # # $ # $ # # # # $ $ # ### $ # # #$ $ # # # ## # ## # #$ #### ### # # # $ # # ## # # # #$ ### # $ # # ## # # ##### # ## ## # ## $ # #$ # $ # # $ ##### #$ $ # # ## # # ## # # # # ## # # % # ## # $ # $ # # # # # # # ### $ # # #% ## # ## $ ## # # # # # # ## ## # U ## ####$# # # # # $ U % # #$ #U # # # ## # # $ ## # # # # # # ## $ # ###### ## ### ##$ $ ## # # # $ U % # # # # # # # ## $ ## # # # # ### $ ## #### $ U # # # # # $ ## #####% ## $ # # # # ###$ # # # # # ## ## # # # # ## ## $ ## # ## # $ # # # ## # # # # $ # # # # # ## ## ## ##### # #$ $ # # # ## # ### ##$ #### $ #### # # # # #### $ # # # # # # # # $ # # # # # ## # $ # # # # # # # $ # # # # # # # # # $ # # # # U % # # # # # # #$ # #$ # #### # # ## # # # $ # # $ # # ## $ ## $ ## # ## # # # # ## ## $ ## # # # # $ $ # # #### $ # ## # # # # # # ### # # ## # $ ## ## # ## $ ### # $ # ## ## ### ## $ # # ### ### ## #### # # # #$ # # # ## $# ##### #######$ $ # #$ #$ ## # # $ ## ## ## # ## # ###$ # ## # # #% # ## # # # # ## # # $ U ## # $ # ## ## # $ #### ## # #$ ## # # # $ ## $ # ## # $ # ## # # ## # # ## ## # # $ ## # # # # ## ## # ## # ### $ # # ### # # # # $ # $ # # N#### # ### ## # ## # # # # # # # # ## # $ # $ # ##$ ## ## # $ $ ## #$ # # ## $ ## # $ # $

N##N# #

NT # # # #### # ## # # ## #

NN NN N #

N#

QLD

SA

NSW

VIC

Figure 5.30. Final distribution map of measured, non-damaged Pseudonaja textilis. Open squares = P. t. pughi, black triangles = P. t. textilis, black crosses (X) = P. t. ohnoi, and grey circles indicate the full range of historical museum holdings.

# $


233 # U % #

# #

WA

#

QLD

# U % # $ # U % # # U %

#

# U % #

#

SA

# # U #% ##

# # # #

### # # #% U

#

# U % #

# U %

# # # # # U % ###

#

#

#

# U %

Figure 5.31. Final distribution map of measured, non-damaged Oxyuranus microlepidotus and Oxyuranus temporalis. Open squares = O. microlepidotus, the black triangle = O. temporalis, and grey circles indicate the full range of historical museum holdings of O. microlepidotus.


234 $ # $ #

$ # $ $ # $ 3 2

PNG

1 2

#

#

$ # $

$ # $ 1 2

# # $ # $ # #

#

$ # $ # 1 2

#

1 2

$ # $ 1 2

## # ## ## $ # U # $ $ 2 3 1 2

U # U % 3 2

$ # $

U # U % U # U % 3 2

# U # U % U # U % U # % U

#

3 2

# U # U % ## ##

#

3 2

U # U % 3 2

#

U # U %

$$ # $ $ # U# $ # U % 1 2

1 2

3 2

U # U # U % U # % U

U # U %

3 2

3 2

3 2

U # U % ## # # # # # # # U # U % U# # # % U 3 2

#

3 2

1 2

U # U % #

U # # U % ### # ## ## # # # # U # U % ## # $# # # U % # # # ## ## U# U# # U % U % U # U % # # U # U % U # # # U % $# # $ # ##### # # 3 2

NT

3 2

3 2

3 2

3 2

#

# U # U % 3 2

#

QLD

# # U# # U #% ## # U## # U % # # $# U # $ U # % 3 2

U # U %

U% # U## # U % U # ## 3 2

#

U # U %

U # U % # # U # U # # U% # U U % U #% U ## # U % ## # # # U # # % U ## U # U # #% # ## U# # U % # # U # ## U% # U # U % U U % # 3 2

3 3 2 2

3 2

3 2

3 2

#

Figure 5.32. Final distribution map of measured, non-damaged Oxyuranus scutellatus. Open squares = O. s. scutellatus, black triangles = O. s. canni, and grey circles indicate the full range of historical museum holdings.

Univariate results – Appendices XIV and XV contain morphological summaries of taxa recognised as part of this thesis, based on an interpretation of the results of univariate and PCA analyses of morphological data (this chapter), major mitochondrial differences (Chapter 4), and inference of past karyomorphic work (Mengden 1982, Mengden 1985a). The summaries only include raw data taken from non-damaged specimens. The synthesis of univariate data (based on the PCA + mitochondrial + karyotypic groups) led to an identification key for use with all identified taxa with an overall success rate of 94.5% (Tables 5.12–5.17).

Discussion

As shown in this thesis, Oxyuranus and Pseudonaja systematics are more complex than have been recently suggested (e.g., Doughty et al. 2007, Skinner 2009), but less diverse


235

than others have implied (e.g., Wells and Wellington 1985, Hoser 2003, Hoser 2009). Much of the past confusion in identification can be attributed to two main factors: the morphological diversity possessed by these snakes (especially within Pseudonaja) and the relatively small amounts of data used to assess this variation. In the face of such diversity, the continuous publication of taxonomic ideas without supporting (or in some cases, any) data, makes taxonomic clarity harder to achieve. Additionally, large problems often require a greater effort, and in the case of these genera (with international distributions), previous sample sizes have been insufficient. The inclusion of a large number of samples from throughout the full distributions of these taxa has enabled identification of increased levels of variation, mapping of these limits, and tests of systematic hypotheses at various levels (sub-species to generic). Despite the increased level of taxonomic resolution provided in this thesis, no study can ever prove to be the final systematic survey needed for full resolution.

In the quest for comprehensive resolution, taxonomists can also encounter difficulties when trying to assess and synthesise the conclusions of previous research (such as the problem in this chapter of comparing current multivariate results with those of past surveys). The multivariate analyses presented here involved examining morphological data for any structure corresponding to known, hypothesised, or unknown groups (principal components analyses), followed by tests of that structure with discriminate function analyses. In theory, this is a slightly modified approach to that used by Skinner (2009), who compared snakes from disparate geographic locations using PCAs, grouped homogenous results (no overlap of points), and then repeated this technique until all groups had been delineated. All results shown by Skinner (2009) were graphs of DFAs, in which there was almost always clear separation between the groups presented, which were labelled according to the species recognised as a result of mitochondrial analyses presented in Skinner et al. (2005). However, Skinner (2003, 2009) provided no PCA results to confirm homogeneity or demonstrate group structure. Given that DFAs require the specification of group structure prior to analysis, the sole presentation of DFA results to justify group membership is inappropriate.

The grid-based sampling approach employed in this study allowed an examination of many snakes used in past studies (such as those by Gillam 1979, Mengden 1982, Shine 1989, and Keogh 1999). Thus, measurements were collected from 137 (47%) of the


236

Table 5.12. Final species-level identification key to taxa recognised as a result of analyses included in this thesis. Accuracies are calculated as in Chapter 2 and are assessed against results obtained from predictive DFAs. Sample sizes possible (n) are listed after each species.

Gregory (2010), Distribution-wide Go to // Species (n)


‗P. modesta‘ (241)

241/241 = 100%

Ventral scales ≥ 185

2)

937/938 = 99.9%

2) ≤ 18 mid-body dorsal scale rows (MDSR)

3)

719/723 = 99.4%

19 MDSR ≥ 20 MDSR

10) 11)

121/121 = 100% 93/93 = 100%

P. ingrami (14)

14/14 = 100%

Character

1) Ventral scales < 185

3) ≥ 7, ≥ 7 infralabial scales and ≥ 61 subcaudal scales Infralabial and subcaudal scales not as above

Total Key Accuracy: 5210/5514 = 94.5% Individual Couplet Accuracy

1178/1179 = 99.9%

933/936 = 99.6%

706/716 = 98.6% 4)

692/702 = 98.6%

4) Lowest edge of postocular scales ≤ Lowest edge of eye

P. affinis (part; 134)

25/28 = 89.3%

Lowest edge of postocular scales > Lowest edge of eye

5)

644/657 = 98.0%

5) Frontal-rostral distance (FRD) / Parietal suture length (PSL) ≥ 0.6

6)

274/295 = 92.9%

FRD/PSL < 0.6

7)

326/343 = 95.0%

6) > 25% of ventral scales completely dark

P. inframacula (37)

29/32 = 90.6%

≤ 25% of ventral scales completely dark

P. textilis (276)

240/242 = 99.2%

669/685 = 97.7%

600/638 = 94.0%

269/274 = 98.2%


237

Table 5.12. Continued. Total Key Accuracy: 5210/5514 = 94.5%



7) Tail length / Total length ≥ 15%

8)

145/157 = 92.4%

Tail length / Total length < 15%

9)

152/169 = 89.9%

8) Dorsal scale rows (DSR) one head length behind parietal scales ≥ 19

P. nuchalis (80)

45/59 = 76.3%

DSR one head length behind parietal scales < 19

P. mengdeni (part; 181)

76/84 = 90.5%

P. aspidorhyncha (107)

59/74 = 79.7%

DSR one head length behind parietal scales = 17

P. mengdeni (part; 181)

63/76 = 82.9%

10) Average infralabial scale count = 6

P. affinis (part; 134)

104/105 = 99.0%

Average infralabial scale count ≥ 6.5

P. guttata (part; 54)

14/16 = 87.5%

11) Ventral scales ≤ 208

P. guttata (part; 54)

38/38 = 100%

Ventral scales > 217

12)

55/55 = 100%

12) DSR behind parietal scales ≥ 28

13)

52/52 = 100%

Character

9) DSR one head length behind parietal scales ≥ 18


297/326 = 91.1%

121/143 = 84.6%

122/150 = 81.3%

118/121 = 97.5%

93/93 = 100%

53/53 = 100%

DSR behind parietal scales ≤ 25

O. temporalis (1)

1/1 = 100%

13) Subcaudal scales ≤ 64 (if 61–64, then head and neck noticeably darker than body)

O. microlepidotus (15)

12/15 = 80.0%

Subcaudal scales ≥ 61 (if 61– 64, then head and neck similar in colour to body)

O. scutellatus (39)

37/37 = 100%

49/52 = 94.2%


238

Table 5.13. Final identification key to Pseudonaja affinis subspecies recognised as a result of analyses included in this thesis. Accuracies and sample sizes are as above.

Total Key Accuracy: 165/167 = 98.8%



P. affinis charlespiersoni (27)

27/27 = 100%

P. affinis affinis (74)

74/74 = 100%

2)

33/33 = 100%

2) Lack of suture between parietal and lower postocular scales

P. affinis exilis (22)

22/22 = 100%

Presence of suture between parietal and lower postocular scales

P. affinis tanneri (11)

Character

1) 17 mid-body dorsal scale rows (MDSR) ≥ 18 MDSR, mainland 19 MDSR, island


134/134 = 100%

31/33 = 93.9% 9/11 = 81.8%

Table 5.14. Final identification key to Pseudonaja guttata subspecies recognised as a result of analyses included in this thesis. Accuracies and sample sizes are as above.


1) 19 mid-body dorsal scale rows (MDSR) ≥ 20 MDSR



P. guttata whybrowi (16)

13/16 = 81.3%

P. guttata guttata (38)

38/38 = 100%


51/54 = 94.4%


239

Table 5.15. Final identification key to Pseudonaja inframacula subspecies recognised as a result of analyses included in this thesis. Accuracies and sample sizes are as above.




1) Frontal-prefrontal scale width / frontal-parietal scale width ≥ 1.09

P. inframacula inframacula (22)

18/22 = 81.8%

Frontal-prefrontal scale width / frontal-parietal scale width < 1.09

P. inframacula subspp. nov. (15)

14/15 = 93.3%


32/37 = 86.5%

snakes examined by Skinner (2003, 2009), who stated that there was complete homogeneity within and complete separation between all groups he recognised. Analyses of four P. nuchalis (as traditionally defined) data sets included commonlymeasured snakes analysed with Skinner‘s (2009) characters (replicating a subset [47%] of Skinner‘s analyses), snakes measured as part of this thesis analysed with Skinner‘s (2009) characters, commonly-measured snakes analysed with characters presented in this thesis, and snakes measured as part of this thesis analysed with characters presented in this thesis (Figures 5.15a–h). In every case, sub-taxa recognised by Skinner were not completely homogenous in PCAs, and results appeared much ‗cleaner‘ when viewing DFA output. Differences in results are not likely to be based on methodological modifications or observer error. Nearly identical results were obtained when these analyses were re-run using the exact method of size standardisation originally used by Skinner (2009). Additionally, where raw measures have been published by Skinner (2003), there were only slight differences (if any) between the two studies. At the very least, past presentation of DFA results over-simplified the morphological variability and differences present within these taxa (see P. modesta results for an even more extreme example of this problem).


240

Table 5.16. Final identification key to Pseudonaja modesta subspecies recognised as a result of analyses included in this thesis. Accuracies and sample sizes are as above.




P. modesta sutherlandi (27)

20/26 = 76.9%

2)

204/209 = 97.6%

2) Fore-nasal scale height / head length to end of skull > 0.0875

P. modesta subspp. nov. (32)

22/28 = 78.6%

Fore-nasal scale height / head length to end of skull ≤ 0.0875

3)

154/175 = 88.0%

P. modesta ramsayi (73)

49/61 = 80.3%

P. modesta modesta (109)

84/92 = 91.3%

Character

1) ≥ 9 Wide body bands ≤ 7 Wide body bands

3) Longitude > 125° Longitude ≤ 125°


224/235 = 95.3%

176/203 = 86.7%

133/153 = 86.9%

Table 5.17. Final identification key to Oxyuranus scutellatus subspecies recognised as a result of analyses included in this thesis. Accuracies and sample sizes are as above.



1) 23 mid-body dorsal scale rows (MDSR), without vertebral stripe 21 MDSR, with vertebral stripe



O. scutellatus scutellatus (30)

27/30 = 90.0%

O. scutellatus canni (9)

6/9 = 66.7%


33/39 = 84.6%


241

Much of the (support for) systematic partitioning within the most recent review of Pseudonaja (Skinner 2009) ultimately derived from the evidence supplied by the karyomorphic work of Mengden, and identifiable mitochondrial divergence and several new karyomorphs generated by Skinner et al. (2005). Known sample sizes used in karyomorphic analyses by either author were extremely low (and very few specimens were actually identified), the independence of morphological analyses (based on mitochondrial correlates) was not actually demonstrated, and type material not examined was often listed as ―missing‖ (even though material does exist). A more egregious example is that of Hoser (2009), who specified fourteen type specimens for eight new Oxyuranus and Pseudonaja subspecies. Of these fourteen types, only one could be verified as having been personally examined by the author. Additionally, claims were made about the existence of molecular data to differentiate the groups Hoser (2009) presented, though no data were provided and none known to have been previously collected or analysed. In both cases, recent authors have attempted to convince their readers by over-extending support for their systematic ideas, each in slightly different ways. Though each of their hypotheses may, empirically, be valid, ideas should lead to the collection of data, while gaps in and results from collected data should lead to additional avenues of research. Ideas or speculations should never be substituted for data. Part of the reasons such academic behaviour may have to do with how vertebrate taxonomic nomenclature is (not) regulated, an issue covered in more detail in Chapter 2. The goal of a ‗pure‘ taxonomy is to elucidate and demonstrate observed patterns of variation observed in nature. The interpretation of species-level results presented here has been conservative, preferring to recognise defendable taxonomic units likely to be reproductively isolated in nature, while still accepting any limitations of any available evidence. As mentioned earlier, all surveys have been hampered by small samples in at least one group examined. The numbers of Oxyuranus microlepidotus and Pseudonaja ingrami included for this study are low, coincident with the low numbers of these taxa stored in museum collections worldwide. Pseudonaja nuchalis in the Cape York Peninsula and Pseudonaja (modesta) sutherlandi are also similarly under-represented, which may be a function of their rarity in nature. Although uncertainty is highest where sample sizes are lowest, overall confidence in results is maintained through the use of an easily-implemented, scalable, grid-based survey design. Only now, with the


242

utilisation of this methodology, have all taxonomic hypotheses been examined, many of which had been presented by authors fifty or more years ago. The use of a systematic research design incorporating a high number of samples for molecular and morphological analysis has allowed a presentation of clarified taxonomic relationships between selected elapid taxa from Australia, Indonesia, and Papua-New Guinea, as well as an accurate guide for the identification of these snakes.

CHAPTER 6 – GENERAL DISCUSSION AND CONCLUSIONS

This thesis is a comprehensive taxonomic review of snakes of the genera Oxyuranus and Pseudonaja, that also reflects upon and tests the methods by which taxonomists choose to practice their craft. To avoid confusion, taxonomy is hereby defined as the pursuit of two separate, but similar goals. Systematic taxonomy is the attempt to determine evolutionary relationships between taxa, while nomenclatural taxonomy is the attempt to give formal names to valid taxa (Hennig 1966, Mayr 1969, Hillis et al. 1996, International Commission on Zoological Nomenclature 1999). Modern systematic taxonomy is often based on molecular analyses, with the nomenclature of resultant clades not necessarily of interest to a systemic taxonomist. Conversely, nomenclatural taxonomists need not conduct any analyses at all; but if they do, the analyses are almost always based on morphological data or observations. For both systematic and nomenclatural taxonomists, the final results are similar: the discovery or (re)description of a clade or taxon. How well those results are received by the larger scientific community or general public is dependent on the quality of the research conducted, which is ultimately limited by the efficacy of any research protocols employed. For all scientific sub-disciplines, proper research design is required, especially for difficult or large-scale problems. One example of such a problem is the taxonomic history of Oxyuranus and Pseudonaja, elapid snakes distributed in Australia, Indonesia, and Papua New Guinea.

As documented in Chapter 1, Oxyuranus and Pseudonaja have been historically troublesome in terms of their taxonomic relationships. Pseudonaja especially has been a heavily studied group for which there have been more questions (hypotheses) than answers. For example, species now considered to be part of Oxyuranus and Pseudonaja have been organised into eighteen different genera at some point in their taxonomic history. There are a number of possibilities why past researchers have struggled with resolving Pseudonaja taxonomy. Two probable causes are the likelihood of recent and/or rapid evolutionary events within these taxa leading to high morphological variation, and the use of inadequate study methods by researchers. Although there are a number of methods which can be used to assess evolutionary relationships, systematic

Chapter 6: General Discussion

244

science is designed to identify similarities and dissimilarities which match evolutionary history. Thus, both molecular and morphological analyses are reliant on the number of samples included for analysis, the geographic origin of samples, how the specimens are examined, and what questions are being asked by each researcher. For organisms such as Oxyuranus and Pseudonaja, similarities and dissimilarities are often contradictory. By not optimising study methods, past researchers may have hindered their taxonomic analyses and led to further confusion.

If and how a systematic sampling regime could help with taxonomic research was examined in Chapter 2. Derived from a previously used ecological method of randomised, linear search transects, the present study utilised a (scalable) search grid covering the entire area of distribution, with the random selection of specimens from within each grid cell (Hipes and Jackson 1996, Gregory et al. 2006). When coupled with an appropriate grid cell size (based on the known or presumed scale at which variation exists), this manner of specimen selection was shown to be more accurate than opportunistic sampling when used with taxonomic research. The proximate benefit of such a methodological approach is simple: a large number of specimens originating from throughout the full distribution of the taxon of interest are able to be included for analysis. Ultimately, this method allow researchers access to a fuller range of morphological (or genetic) variation (depending on the scale at which variation exists) and greater confidence in observed results. A modified form of this design has been used successfully both for taxonomic and long-term ecological research, showing that a systematic sampling design allows for a more detailed and proper examination of any research question (Magnusson et al. 2008, Schmelz et al. 2009).

Similarly, there is no need to believe that a research design appropriate for morphological and ecological studies would not be as useful for molecular studies. However, papers published about Australian elapid phylogenetics show that past researchers have been opportunistic in their specimen collection. This is most likely due to a dependence on fresh tissue, which generally yields high quality, long-length DNA strands. However, fresh tissue is not always equally (or easily) available from throughout the distribution of a taxon, causing a molecular biologist to rely upon random sources of and easily-accessed locations for fresh tissue. Again, if the purpose of taxonomy is to delineate variation, then the full range of molecular variation must be


245

addressed. In such cases, formalin-fixed (or other archival) tissue must be sampled for analysis.

Polymerase chain reactions (PCRs) of formalin-fixed DNA do not work as consistently or as well as PCRs of fresh DNA. This is because DNA obtained from formalin-fixed tissue has several inherent problems: depurination and depyrimidation, strand nicks and breaks, and cross-linkage between DNA and proteins or between DNA strands (De Giorgi et al. 1994, Hofreiter et al. 2001, Schander and Halanych 2003, Willerslev and Cooper 2005, Tang 2006). But problems and inconsistencies can be mitigated in several ways: choose specimens stored for shorter periods of time, design primers for smaller fragments which can be subsequently pieced together, and use extraction and PCR techniques which will enhance laboratory processes. Results in Chapter 3 showed that all but one of the most successful extraction and PCR techniques contained a step whereby the tissue was heated in solution at temperatures equal or greater to 90° C (the other successful technique involved the magnetic attraction of DNA molecules). Heating to high temperatures is assumed to allow the breakage of incompatible DNA cross-links (such as between DNA and proteins) formed during the fixation process and may facilitate the reformation of properly-placed DNA-DNA bonds as the extraction solution cools (Shi et al. 1997, Boenisch 2005). In addition, bovine serum albumin, dithiothreitol, or a combination of both, can be added to the PCR mixture to help neutralise problematic chemicals carried over from the archiving process. Additives may bind to substances which may inhibit PCRs, reduce secondary structure formation, or improve the specificity of PCR reactions (Pääbo et al. 1988, Varadaraj and Skinner 1994, Nagai et al. 1998, Ralser et al. 2006, Rohland and Hofreiter 2007). If fresh tissue is not available from throughout the distribution of a studied taxon, then the use of archival tissue must be attempted.

Both techniques (systematic sampling and the use of formalin-fixed tissue) were used in a molecular examination of Oxyuranus and Pseudonaja (Chapter 4). Geographic and cladistic quality controls were also included in order to minimise the inclusion of sequences obtained from formalin-fixed DNA which may have included errors in their genetic code. Results may be conservative (as these controls minimise the acceptance of slight genetic variation at increasing geographic distances), but they are less likely to include false genetic variants (typically caused by base substitution in sequences


246

exposed to fixative chemicals). All molecular examinations of these snakes have both validated previous hypotheses as well as provided a number of conflicting results (Mengden 1982, Wallach 1985, Skinner 2003, the present study). This is especially true of the relationships between Oxyuranus, Pseudonaja modesta, Pseudonaja guttata, and the remaining Pseudonaja. The most consistently recovered clades in the current study showed Pseudonaja to be paraphyletic: Pseudonaja modesta was recovered most often as the sister group to all other ingroup taxa or as the sister group to Oxyuranus. Additional molecular support was also obtained for a composite Pseudonaja modesta. As genetic analyses are but one possible line of evidence when looking for confirmation or repudiation of taxonomic hypotheses, analyses of morphological data were also conducted.

Using the same systematic sampling regime, but at a finer scale (more densely balanced), over 1,400 snakes were examined for detailed analysis of 313 morphological characters (Chapter 5). Given the ongoing, chaotic taxonomic history of these snakes, it was imperative to address each previous taxonomic hypothesis, as well as several new hypotheses uncovered in the analysis of the full morphological data set. Many hypotheses previously put forward, especially those taxonomic ideas suggested by authors who had not conducted any analyses (that is, who only published ‗results‘ without including any supporting data), were not confirmed by analyses of morphological (and genetic) data in the present study. Several possible new taxa emerged due to morphological (but not always molecular) variation. Table 6.1 presents final taxa recognised based on the weight of molecular, morphological, and geographic distribution evidence compiled during the present study. The present study includes a final identification guide, which tested at 94.5% accurate throughout the distributional range of these taxa. The morphological characters found to be most reliable for separating taxa included: ventral scale count, mid-body dorsal scale count, number of infralabial scales, number of subcaudal scales, and the relative position of the lowest edges of the postocular scales and the eyes.

As can be noted by reading this thesis, Oxyuranus and Pseudonaja snakes (especially Pseudonaja) are notorious for their morphological similarities. Although the analysis of large numbers of specimens provided a clearer understanding of these taxa, it is now evident why the morphology can be confusing—the genetics are muddled, too. Thus,


247

Table 6.1. Summary of final taxa recognised as valid at the conclusion of the present study. See Appendix I, Appendix II, and Chapter 5 for a list of synonyms and a nomenclatural timeline. Genus Oxyuranus Oxyuranus Oxyuranus Oxyuranus Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja Pseudonaja

Species microlepidotus scutellatus scutellatus temporalis affinis affinis affinis affinis aspidorhyncha guttata guttata inframacula inframacula ingrami mengdeni modesta nuchalis ramsayi spp. nov. sutherlandi textilis

Subspecies

Notes

canni scutellatus affinis charlespiersoni exilis tanneri Was synonymised with P. nuchalis guttata whybrowi inframacula subspp. nov.

New subspecies Was synonymised with P. nuchalis

Was synonymised with P. modesta New species (from P. modesta) Was synonymised with P. modesta

despite the contribution of this thesis to the taxonomic resolution of Oxyuranus and Pseudonaja, there is still work to be done. I recommend four further approaches (three molecular, one ecological) to help delineate and define these taxa. First, additional genetic markers are needed for analysis. The GenBank web-based genetic database lists 41 projects which have investigated the evolutionary relationships of Australian aquatic and terrestrial elapid snakes (Benson et al. 2008). Relevant statistics regarding the make-up of these studies are listed in Table 6.2. As can be seen, the present study compares favourably with averages of the other studies, with the exception of the number of genes chosen for inclusion. Thus, further markers are needed, especially sequences obtained from nuclear DNA in order to help resolve the deep sister group positioning of Pseudonaja modesta. Second, given the systematic foundation provided


248

Table 6.2. Summary of previous evolutionary studies of Australo-Pacific Elapidae whose molecular data were lodged with GenBank (Benson et al. 2008). Please note the following about the information in this table: 1) Only species whose main distributions were located within the overall distribution of Oxyuranus and Pseudonaja were included for summary (i.e., no African, American, or Asian elapids have been included); 2) The numbers of genes listed here may be slightly underestimated (e.g., only one gene was counted if a study denoted an examination of the ND4 gene, even if the primers listed actually amplified the ND4 gene and parts of the neighbouring Histidine-tRNA gene); 3) Studies not primarily concerned with the evolutionary relationships of Oxyuranus and Pseudonaja were not included (i.e., most venom studies); 4) The numbers of species listed here may be an overestimate of focal species (i.e., outgroup species were included, even though outgroups were not the main subject of interest or contained as many samples as those from ingroup taxa); and 5) Average gene lengths may overestimate typical gene lengths used in studies (i.e., a few studies sequenced major parts of the mitochondrial genome—with these studies removed, average gene lengths drop by at least 70 base pairs). Character Number of studies Average number of species per study Average number of specimens per study Average number of specimens per species per study Average number of genes per study Average number of base pairs per study Average number of base pairs per gene per study

Terrestrial 24

Aquatic 20

Overall 41

Present Study 1

4.6

2.6

3.9

23

41.4

15.8

31.9

318

9.0

6.2

8.1

13.8

2.9

3.1

2.4

1

760.8

845.5

798.2

773

260.9

272.9

327.6

773


249

by the karyomorphic work of Mengden and mitochondrial work of Skinner (Covacevich et al. 1980, Mengden 1982, Mengden 1985a, Skinner et al. 2005), karyomorphs and genetic sequences should be examined from specimens from several geographic areas (e.g., the Cape York Peninsula) not yet (successfully) examined. This most likely would require the procurement and use of fresh tissue (or a marked refinement of formalinfixed techniques) from these areas, the third recommendation. Finally, although less likely to be a causative factor for speciation, ecological data may be helpful—in certain cases—to delineate species with conflicting boundaries (Kohn and Orians 1962, Millar 2007). Progress is being made toward a resolution of each of these four recommendations. Primers for nuclear and other mitochondrial genes have been tested and it is hoped an molecular analysis will be completed shortly after the publication of this thesis. A lab appropriate for the preparation and analysis of karyomorphic material has been sourced and awaits the appropriate samples. Unsuccessful searches for live specimens have taken place in parts of Australia representing geographic areas where only formalinfixed tissue is available and subsequent DNA amplification has failed. However, local contacts have been made and it is hoped fresh tissue can be sourced in the future. Extra ecological data were collected during the course of the present study, including a complete listing and identification of stomach contents, surveys of snake ectoparasites and endoparasites, and data layers (e.g., descriptions of soil contents, climactic information, habitat type, and elevation) for use with GIS analyses of collection locations. Analysis of these data are well underway and show definite trends, some of which are contradictory to previously published observations. (Past ecological work is limited to four main reports: a cursory look at the dietary habits, reproduction, and size of Oxyuranus and Pseudonaja, and at the activity patterns, movements, shelter-site selection, and thermal biology of Pseudonaja textilis [Shine 1989, Shine and Covacevich 1983, Whitaker and Shine 2003].) Once taxonomic boundaries have been further settled, it is expected that the results from these additional ecological data will become even more valuable, if only to provide baseline conservation information for regulatory agencies.

Unfortunately, individual studies cannot solve every problem or pursue every relevant question associated with their research. However, it is inherent upon researchers to


250

attempt to maximise their efforts, to act ethically, and to search for solutions in a responsible manner. The history of these snakes shows periods both of slow development and reckless advancement of taxonomic hypotheses. This is something that should not happen in the future. With relatively little funding, this thesis has summarised the knowledge to-date of a chaotic problem, has shaped the arguments for and against all taxonomic hypotheses, and has defined the necessary steps for final resolution. I wish the best of luck to the next round of researchers and look forward to reading about the inventive ways in which they approach their research questions.

LITERATURE CITED

Akaike, H. 1974. A new look at the statistical model identification. IEEE Transactions on Automatic Control 19(6):716–723.

Alfaro, M.E. and M.T. Holder. 2006. The posterior and the prior in Bayesian phylogenetics. Annual Review of Ecology, Evolution, and Systematics 37(1):19–42.

Altman, D.G. and C. Cates. 2001. Authors should make their data available. British Medical Journal 323(7320):1069–1070.

Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology 215(3):403–410.

Anderson, F.E. and D.L. Swofford. 2004. Should we be worried about long-branch attraction in real data sets? Investigations using metazoan 18S rDNA. Molecular Phylogenetics and Evolution 33(2):440–451.

Arévalo, E., S.K. Davis, and J.W. Sites, Jr. 1994. Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Systematic Biology 43(3):387–418.

Austin, J.J. and J. Melville. 2006. Incorporating historical museum specimens into molecular systematic and conservation genetics research. Molecular Ecology Notes 6(4):1089–1092.

Azuma, H., M. Okamota, Y. Oku, and M. Kamiya. 1995. Intraspecific variation of Taenia taeniaeformis as determined by various criteria. Parasitological Research 81(2):103–108.

Literature Cited

252

Banerjee, S.K., W.F. Makdisi, A.P. Weston, S.M. Mitchell, and D.R. Campbell. 1995. Microwave-based DNA extraction from paraffin-embedded tissue for PCR amplification. BioTechniques 18(5):768–773.

Banks, C. 1981. Notes on a seasonal colour change in a western brown snake. Herpetofauna 13(1):29–30.

Barnes, J. 1984. The complete works of Aristotle: the revised Oxford translation. Princeton University Press, Princeton. 1256 pp. Bartlett, J.M.S. and D. Stirling. 2003. PCR protocols, 2nd edition. Method in Molecular Biology, volume 226. Humana Press, New York. 556 pp.

Baverstock, P.R. and T.D. Schwaner. 1985. Phylogeny of Australian elapid snakes: the genetic approach. Pages 159–164 in: Biology of Australasian frogs and reptiles. G. Grigg, R. Shine, and H. Ehmann, eds. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 527 pp.

Ben-Ezra, J., D.A. Johnson, J. Rossi, N. Cook, and A. Wu. 1991. Effect of fixation on the amplification of nucleic acids from paraffin-embedded material by the polymerase chain reaction. The Journal of Histochemistry and Cytochemistry 39(3):351–354.

Benson D.A., I. Karsch-Mizrachi, D.J. Lipman, J. Ostell, and D.L. Wheeler. 2008. GenBank. Nucleic Acids Research 36:D25–30 (Epub). Berg, J.M., J.L. Tymoczko, and L. Stryer. 2002. Biochemistry (5th edition). W.H. Freeman and Company, New York. 1120 pp.

Bergsten, J. 2005. A review of long-branch attraction. Cladistics 21(2):163–193.

Bhadury, P., M.C. Austen, D.T. Bilton, P.J.D. Lambshead, A.D. Rogers, and G.R. Smerdon. 2005. Combined morphological and molecular analysis of individual nematodes through short-term preservation in formalin. Molecular Ecology Notes 5(4):965–968.

Literature Cited

253

Boenisch, T. 2005. Effect of heat-induced antigen retrieval following inconsistent formalin fixation. Applied Immunohistochemistry and Molecular Morphology 13(3):283–286.

Borrell, B. 2007. Linnaeus at 300: the big name hunters. Nature 446(7133):253–255.

Boulenger, G.A. 1896. Catalogue of snakes in the British Museum (Natural History). Volume III. British Museum, London. 727 pp.

Boulenger, G.A. 1908. Description of a new elapine snake from Australia. The Annals and Magazine of Natural History (8)(1):333–334.

Bramwell, N.H. and B.F. Burns. 1988. The effects of fixative type and fixation time on the quantity and quality of extractable DNA for hybridization studies on lymphoid tissue. Experimental Hematology 16(8):730–732.

Bucklin, A. and L.D. Allen. 2003. MtDNA sequencing from zooplankton after longterm preservation in buffered formalin. Molecular Phylogenetics and Evolution 30(3):879–882.

Burnett, S. 1997. Colonising cane toads cause population declines in native predators: reliable anecdotal information and management implications. Pacific Conservation Biology 3(1):65–72.

Bush, B. 1989. Ontogenetic colour change in the gwardar, Pseudonaja nuchalis. Western Australian Naturalist 18(2):25–29.

Bush, B. 1989. Polymorphism in captive bred siblings of the snake, Pseudonaja nuchalis. Herpetofauna 19(2):28–32.

Bush, B. 2008. Tiger snakes on Carnac island! Where did their ancestors come from? (http://members.iinet.net.au/~bush/CARNAC.html). Last accessed 31/12/2009.

Literature Cited

254

Campbell, N.A. and J.B. Reece. 2002. Biology (6th edition). Benjamin Cummings, San Francisco. 1175 pp.

Caramelli, D., C. Vernesi, S. Sanna, L. Sampietro, M. Lari, L. Castrì, G. Vona, R. Floris, P. Francalacci, R. Tykot, A. Casoli, J. Bertranpetit, C. Lalueza-Fox, G. Bertorelle, and G. Barbujani. 2007. Genetic variation in prehistoric Sardinia. Human Genetics 122(3–4):327–336.

Carraway, L.N. 2006. Improve scientific writing and avoid perishing. American Midland Naturalist 155(2):383–394.

Catling, P.C., A. Hertog, R.J. Burt, R.I. Forrester, and J.C. Wombey. 1999. The shortterm effect of cane toads (Bufo marinus) on native fauna in the Gulf Country of the Northern Territory. Wildlife Research 26(2):161–185.

Cawkwell, L. and P. Quirke. 2000. Direct multiplex amplification of DNA from a formalin fixed, paraffin wax embedded tissue section. Journal of Clinical Pathology: Molecular Pathology 53(1):51–52.

Chase, M.R., R.J. Etter, M.A. Rex, and J.M. Quattro. 1998. Extraction and amplification of mitochondrial DNA from formalin-fixed deep-sea molluscs. BioTechniques 24(2):243–247.

Chatigny, M.E. 2000. The extraction of DNA from formalin-fixed, ethanol-preserved reptile and amphibian tissues. Herpetological Review 31(2):86–87.

CodonCode. 2007. CodonCode Aligner, Version 2.0. CodonCode Corporation, Dedham. Cogger, H.G. 1975. Reptiles and Amphibians of Australia (1st edition). Reed, Sydney. 584 pp. Cogger, H.G. 1979. Reptiles and Amphibians of Australia (2nd edition). Reed, Sydney. 608 pp.

Literature Cited

255

Cogger, H.G. 1985. Australian proteroglyphous snakes - an historical overview. Pages 143–154 in: Biology of Australasian frogs and reptiles. G. Grigg, R. Shine, and H. Ehmann, eds. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 527 pp. Cogger, H.G. 2000. Reptiles and Amphibians of Australia (6th edition). Ralph Curtis Books, Sanibel Island. 808 pp.

Cogger, H.G., E.E. Cameron, and H.M. Cogger. 1983. Zoological Catalogue of Australia. Amphibia and Reptilia. Australian Government Publishing Service, Canberra. 313 pp.

Coombs, N.J., A.C. Gough, and J.N. Primrose. 1999. Optimisation of DNA and RNA extraction from archival formalin-fixed tissue. Nucleic Acids Research 27(16):e12–e12.

Cooper, A. and H.N. Poinar. 2000. Ancient DNA: do it right or not at all. Science 289(5482):1139.

Coura, R., J.C. Prolla, L. Meurer, P. Ashton-Prolla. 2005. An alternative protocol for DNA extraction from formalin fixed and paraffin wax embedded tissue. Journal of Clinical Pathology 58(8):894–895.

Covacevich, J. 1987. Two taipans! Pages 480–485 in: Toxic plants and animals - a guide for Australia. P.D. J. Covacevich, J. Pearn, eds. Queensland Museum, Brisbane. 504 pp.

Covacevich, J. and J. Wombey. 1976. Recognition of Parademansia microlepidotus (McCoy) (Elapidae), a dangerous Australian snake. Proceedings of the Royal Society of Queensland 87(1):29–32.

Covacevich, J., S.B. McDowell, C. Tanner, and G. Mengden. 1980. The relationship of the taipan, Oxyuranus scutellatus, and the small-scaled snake, Oxyuranus microlepidotus (Serpentes: Elapidae). Pages 160–168 in: Proceedings of the Melbourne

Literature Cited

256

Herpetological Symposium, 1980. C.B. Banks and A.A. Martin, eds. Zoological Board of Victoria, Melbourne. 199 pp.

Coventry, A.J. 1970. Reptile and amphibian type specimens housed in the National Museum of Victoria. Memoirs of the National Museum of Victoria, Melbourne 31(1):115–124.

Coventry, A.J. and P. Robertson. 1991. The snakes of Victoria. Department of Conservation and Environment, East Melbourne. 70 pp.

Cracraft, J. 1997. Species concepts in systematics and conservation biology: an ornithological viewpoint. Pages 325–339 in: Species: the units of biodiversity. M.F. Claridge, H.A. Dawah, M.R. Wilson, eds. Chapman and Hall, London. 439 pp.

Cronin, M.A. 2006. A Proposal to Eliminate Redundant Terminology for Intra-Species Groups. Wildlife Society Bulletin 34(1):237–241.

Darwin, C. 1968. On the Origin of Species by Means of Natural Selection, or the Preservation of Favoured Races in the Struggle for Life. Penguin, Harmondsworth. 477 pp.

De Giorgi, C., M.F. Sialer, and F. Lamberti. 1994. Formalin-induced infidelity in PCRamplified DNA fragments. Molecular and Cellular Probes 8(6):459–462.

De Rooij, N. 1917. The reptiles of the Indo-Australian Archipelago, volume 2 (Ophidia). E.J. Brill, Leiden. 334 pp.

De Vis, C. 1884. Description of new snakes with a synopsis of the genus Hoplocephalus. Proceedings of the Royal Society of Queensland 1(1):138–140.

De Vis, C. 1911. Description of snakes apparently new. Annals of the Queensland Museum 10(1):21–25.

Literature Cited

257

Díaz-Cano, S.J. and S.P. Brady. 1997. DNA extraction from formalin-fixed, paraffinembedded tissues: protein digestion as a limiting step for retrieval of high-quality DNA. Diagnostic Molecular Pathology 6(6):342–346.

Díaz-Viloria, N., L. Sánchez-Velasco, and R. Perez-Enriquez. 2005. Inhibition of DNA amplification in marine fish larvae preserved in formalin. Journal of Plankton Research 27(8):787–792. Dieffenbach, C.W. and G.S. Dveksler. 2003. PCR primer: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 520 pp.

Dobzhansky, T. 1970. Genetics of the evolutionary process. Columbia University Press, New York. 505.

Dong, S. and Y. Kumazawa. 2005. Complete mitochondrial DNA sequences of six snakes: phylogenetic relationships and molecular evolution of genomic features. Journal of Molecular Evolution 61(1):12–22.

Douady, C.J., F. Delsuc, Y. Boucher, W.F. Doolittle, and E.J.P. Douzery. 2003. Comparison of Bayesian and Maximum Likelihood Bootstrap Measures of Phylogenetic Reliability. Molecular Biology and Evolution 20(2):248–254.

Doughty, P., B. Maryan, S.C. Donnellan, and M.N. Hutchinson. 2007. A new species of taipan (Elapidae: Oxyuranus) from central Australia. Zootaxa 1422(1):45–58.

Douglas, M.P. and S.O. Rogers. 1998. DNA damage caused by common cytological fixatives. Mutation Research 401(1):77–88.

Dowling, H.G. 1951. A proposed standard system of counting ventrals in snakes. British Journal of Herpetology 1(5):97–99.

Duméril, A.M.C., G. Bibron, and A.H.A. Duméril. 1854. Erpétologie générale ou histoire naturelle complète des reptiles. Tome septième. Deuxième partie, comprenant l‘histoire des serpents venimeux. Librairie Encyclopédique de Roret, Paris. 755 pp.

Literature Cited

258

Dumolin-Lapègue, S., M.-H. Pemonge, L. Gielly, P. Taberlet, and R.J. Petit. 1999. Amplification of oak DNA from ancient and modern wood. Molecular Ecology 8(12):2137–2140.

Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5):1792–1797.

Eernisse, D. J. and A.G. Kluge. 1993. Taxonomic congruence versus total evidence, and the phylogeny of amniotes inferred from fossils, molecules and morphology. Molecular Biology and Evolution 10(6):1170–1195.

ESRI. 2005. ArcGIS 9.3 software package. Environmental Systems Research Institute, Redlands.

Fairweather, P.G. 1991. Statistical power and design requirements for environmental monitoring. Australian Journal of Marine and Freshwater Research 42:555–567.

Fang, S.-G., Q.-H. Wan, and N. Fujihara. 2002. Formalin removal from archival tissue by critical point drying. BioTechniques 33(3):604–611.

Felsenstein, J. 1978. The number of evolutionary trees. Systematic Zoology 27(1):27– 33.

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39(4):783–791.

Felsenstein, J. 1993. PHYLIP (Phylogeny Inference Package) version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle.

Felsenstein, J. 2004. Inferring phylogenies. Sinauer Associates, Inc., Sunderland. 664 pp.

Literature Cited

259

Filichkin, S.A. and S.B. Gelvin. 1992. Effect of dimethyl sulfoxide concentration on specificity of primer matching in PCR. BioTechniques 12(6):828–830.

Fischer, J.G. 1856. Neue Schlangen des Hamburgischen Naturhistorischen Museums. Abhandlungen des Naturwissenschaftlichen Vereins in Hamburg 3(4):79–116.

Fitzinger, L.J. 1860. Die Ausbeute der österreichischen Naturforscher an Säugethieren und Reptilien während der Weltumsegelung Sr. Majestät Fregatte Novara. Sitzungsberichte der Mathematisch-Naturwissenschaftlichen Classe der Kaiserlichen Akademie der Wissenschaften 42(25):383–416.

Florey, C.D. 1988. Sample size for beginners. British Medical Journal 306(6886):1181– 1184.

Floyd, R., E. Abebe, A. Papert, and M.L. Blaxter. 2002. Molecular barcodes for soil nematode identification. Molecular Ecology 11(4):839–850.

Forstner, M.R.J., S.K. Davis, and E. Arévalo. 1995. Support for the hypothesis of anguimorph ancestry for the suborder Serpentes from phylogenetic analysis of mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 4(1):93–102.

Fox, C.H., F.B. Johnson, J. Whiting, and P.P. Roller. 1985. Formaldehyde fixation. The Journal of Histochemistry and Cytochemistry 33(8):845–853.

Fracasso, T., Heinrich, M., Hohoff, C., Brinkmann, B. and Pfeiffer, H. 2009. Ultrasound-accelerated formalin fixation improves the preservation of nucleic acids extraction in histological sections. International Journal of Legal Medicine 123(6):521– 525.

France, S.C. and T.D. Kocher. 1996. DNA sequencing of formalin-fixed crustaceans from archival research collections. Molecular Marine Biology and Biotechnology 5(4):304–313.

Literature Cited

260

Frank, T.S., S.M. Svoboda-Newman, and E.D. Hsi. 1996. Comparison of methods for extracting DNA from formalin-fixed paraffin sections for nonisotopic PCR. Diagnostic Molecular Pathology 5(3):220–224.

Freeland, W.J. 1986. Populations of cane toad, Bufo marinus, in relation to time since colonization. Australian Wildlife Research 13(2): 321–329.

Friedman, M. and R. DeSalle. 2008. Mitochondrial DNA extraction and sequencing of formalin-fixed archival snake tissue. Mitochondrial DNA 19(5):443–437. Fry, B.G. 2005. From genome to ―venome‖: molecular origin and evolution of the snake venom proteome inferred from phylogenetic analysis of toxin sequences and related body proteins. Genome Research 15(3):403–420.

Fry, D.B. 1914. On a collection of reptiles and batrachians from Western Australia. Records of the Western Australian Museum and Art Gallery 1(3):174–210.

Gelman, A., and D.B. Rubin. 1992. Inference from iterative simulation using multiple sequences. Statistical Science 7(4), 457–511.

Gilbert, M.T.P. and E. Willerslev. 2007. Rescuing ancient DNA. Nature Biotechnology 25(8):872–874.

Gilbert, M.T.P., H.-J. Bandelt, M. Hofreiter, and I. Barnes. 2005. Assessing ancient DNA studies. Trends in Ecology and Evolution 20(10):541–544.

Gillam, M.W. 1979. The genus Pseudonaja (Serpentes: Elapidae) in the Northern Territory. Territory Parks and Wildlife Commission Research Bulletin 1(1):1–28.

Glauert, L. 1950. A handbook of the snakes of Western Australia. Western Australian Naturalists‘ Club, Perth. 48 pp. Glauert, L. 1957. A handbook of the snakes of Western Australia, 2nd edition. Western Australian Naturalists‘ Club, Perth. 60 pp.

Literature Cited

261

Godfray, H.C.J. 2002. Towards taxonomy‘s ‗glorious revolution‘. Nature 420(6915):461.

Golay, P., H.M. Smith, D.G. Broadley, J.R. Dixon, C. McCarthy, J.-C. Rage, B. Schätti, and M. Toriba. 1993. Endoglyphs and other major venomous snakes of the world: a checklist. Azemiops, Geneva. 478 pp.

Gow, G.F. 1976. Snakes of Australia. Angus and Robertson, Sydney. 88 pp.

Gow, G.F. 1983. Snakes of Australia, revised edition. Angus and Robertson, Sydney. 168 pp.

Graham, D.E. 1978. The isolation of high molecular weight DNA from whole organisms or large tissue masses. Analytical Biochemistry 85(2):609–613.

Graybeal, A. 1998. Is it better to add taxa or characters to a difficult phylogenetic problem? Systematic Biology 48(1):9–17.

Greer, A.E. 1997. The biology and evolution of Australian snakes. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 358 pp.

Greer, C.E., S.L. Peterson, N.B. Kiviat, and M. Manos. 1991. PCR amplification from paraffin-embedded tissues – effects of fixative and fixation time. American Journal of Clinical Pathology 95(2):117–124.

Gregory, C.J., R.R. Carthy, and L.G. Pearlstine. 2006. Survey and monitoring of species at risk at Camp Blanding Training Site, northeastern Florida. Southeastern Naturalist 5(3):473–498.

Griffiths, A.J.F., S.R. Wessler, R.C. Lewontin, W.M. Gelbart, D.T. Suzuki, and J.H. Miller. 2004. An introduction to genetic analysis, 8th edition. W.H. Freeman, New York. 800 pp.

Literature Cited

262

Gugerli, F., L. Parducci, and R.J. Petit. 2005. Ancient plant DNA: review and prospects. New Phytologist 166(2):409–418.

Günther, A. 1858. Catalogue of Colubrine Snakes in the British Museum. British Museum, London. 281 pp.

Günther, A. 1863. Note on Diemennia superciliosa. The Annals and Magazine of Natural History (3)(12):239–240.

Günther, A. 1872. Seventh account of new species of snakes in the collection of the British Museum. The Annals and Magazine of Natural History 9(4):13–37.

Haahr, M. 2007. www.random.org. Last accessed: 31/12/2007.

Hall, B.G. 2005. Comparison of the accuracies of several phylogenetic methods using protein and DNA sequences. Molecular Biology and Evolution 22(3):792–802.

Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 41(1):95– 98.

Heath, T., S.M. Hedtke, and D.M. Hillis. 2008. Taxon sampling and the accuracy of phylogenetic analyses. Journal of Systematics and Evolution 46(3):239–257.

Hebert, P.D.N., A. Cywinska, S.L. Ball, and J.R. deWaard. 2003a. Biological identifications through DNA barcodes. Proceedings of the Royal Society London, Series B–Biological Sciences 270(1512):313–322.

Hebert, P.D.N., S. Ratnasingham, and J.R. DeWaard. 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society London, Series B–Biological Sciences 270(Supplement):S96–S99.

Hennig, W. 1966. Phylogenetic Systematics. University of Illinois Press, Urbana. 263 pp.

Literature Cited

263

Higuchi, R., B. Bowman, M. Freiberger, O.A. Ryder, and A.C. Wilson. 1984. DNA sequences from the quagga, an extinct member of the horse family. Nature 312(5991):282–284.

Hillis, D.M. 1987. Molecular versus morphological approaches to systematics. Annual Review of Ecology and Systematics 18(1):23–42.

Hillis, D.M. 1996. Inferring complex phylogenies. Nature 383(6596):130–131.

Hillis, D.M. and J.J. Wiens. 2000. Molecules versus morphology in systematics. Pages 1–19 in Phylogenetic analysis of morphological data. J.J. Wiens, ed. Smithsonian Institution Press, Washington. 220 pp. Hillis, D.M., C. Moritz, and B.K. Marble. 1996. Molecular systematics, 2nd edition. Sinauer Associates, Sunderland. 655 pp.

Hillis, D.M., D.D. Pollock, J.A. McGuire, and D.J. Zwickl. 2003. Is sparse taxon sampling a problem for phylogenetic inference? Systematic Biology 52(1):124–126.

Hipes, D.L. and D.R. Jackson. 1996. Rare vertebrate fauna of Camp Blanding Training Site, a potential landscape linkage in northeastern Florida. Florida Scientist 59:296–114.

Hirzel, A.H. and A. Guisan. 2002. Which is the optimal sampling strategy for habitat suitability modelling? Ecological Modelling 157(2–3):331–341.

Holder, M. and P.O. Lewis. 2003. Phylogeny estimation: traditional and Bayesian approaches. Nature Reviews Genetics 4(4):275–284.

Holder, M.T., D.J. Zwickl, and C. Dessimoz. 2008. Evaluating the robustness of phylogenetic methods to among-site variability in substitution processes. Philosophical Transactions of the Royal Society B: Biological Sciences 363(1512):4013–4021.

Literature Cited

264

Hofreiter, M., D. Serre, H.N. Poinar, M. Kuch, and S. Pääbo. 2001. Ancient DNA. Nature Reviews Genetics 2(5):353–359.

Hoser, R. 1998. A new snake from Queensland, Australia (Serpentes: Elapidae). Monitor - Journal of the Victorian Herpetological Society 10(1):5–9,31.

Hoser, R. 2002. An overview of taipans, genus (Oxyuranus) (Serpentes:Elapidae) including the description of a new subspecies. Crocodilian - Journal of the Victorian Association of Amateur Herpetologists 3(1):43–50.

Hoser, R. 2009. Eight new taxa in the genera Pseudonaja Gunther 1858, Oxyuranus Kinghorn 1923 and Panacedechis Wells and Wellington 1985 (Serpentes:Elapidae). Australasian Journal of Herpetology 4(2009):1–27.

Hoser, R.T. 2003a. A new species of elapid (Serpentes: Elapidae) from New Guinea. Boydii - Journal of the Herpetological Society of Queensland Incorporated Autumn (May) (1):2–4.

Hoser, R.T. 2003b. A new species of elapid (Serpentes: Elapidae) from Western New South Wales. Crocodilian - Journal of the Victorian Association of Amateur Herpetologists 4(2):19–26.

Hsu, H.-C., S.-Y. Peng, and C.T. Shun. 1991. High quality of DNA retrieved for southern blot hybridization from microwave-fixed, paraffin embedded liver tissues. Journal of Virological Methods 31(2–3):251–262.

Huelsenbeck, J.P. and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17(8):754–755.

Huelsenbeck, J.P. and J.P. Bollback. 2001. Empirical and hierarchical Bayesian estimation of ancestral states. Systematic Biology 50(3):351–366.

Literature Cited

265

Huelsenbeck, J.P. and K.A. Crandall. 1997. Phylogeny estimation and hypothesis testing using maximum likelihood. Annual Review of Ecology and Systematics 28(1):437–466. Hull, D.L. 1997. The ideal species concept – and why we can‘t get it. Pages 357–380 in: Species: the units of biodiversity. M.F. Claridge, H.A. Dawah, M.R. Wilson, eds. Springer, Berlin. 460 pp.

Hunt, J.L. 2008. Molecular pathology in atomic pathology practice: a review of basic principles. Archives of Pathology and Laboratory Medicine 132(2):248–260.

Hunt, R.A. 1947. A key to the identification of Australian snakes (other than blind snakes, rock snakes and pythons, files snakes, and sea snakes). Victorian Naturalist 64(8):153–167.

Hyde, J.R. and R.D. Vetter. 2007. The origin, evolution, and diversification of rockfishes of the genus Sebastes (Cuvier). Molecular Phylogenetics and Evolution 44(2):790–811. Hyliš, M., J. Weiser, M. Oborník, and J. Vávra. 2005. DNA isolation from museum and type collection slides of microsporidia. Journal of Invertebrate Pathology 88(3):257– 260.

International Commission on Zoological Nomenclature. 1999. International code of zoological nomenclature, 4th edition. International Trust for Zoological Nomenclature, London. 306 pp.

Inadome, Y. and M. Noguchi. 2003. Selection of higher molecular weight genomic DNA for molecular diagnosis from formalin-fixed material. Diagnostic Molecular Pathology 12(4):231–236.

Iudica, C.A., W.M. Whitten, and N.H. Williams. 2001. Small bones from dried mammal museum specimens as a reliable source of DNA. BioTechniques 30(4):732–736.

Literature Cited

266

Jan, G. 1859. Plan d‘une Iconographie descriptive des Ophidiens, et Description sommaire de nouvelles espèces de Serpents. Revue et Magasin de Zoologie Pure et Appliquée 2(11–12):122–130.

Jan, G. 1863. Elenco Sistematico Degli Ofidi Descritti e Disegnati per l‘Iconografia Generale. A. Lombardi, Milan. 143 pp.

Jan, G. and F. Sordelli. 1873. Iconographie Générale des Ophidiens. Tome III, Livraison 43, Plats IV–V. Jan and Sordelli, Milan. 50 pp.

Johnson, D.R., S. Levanat, and A.E. Bale. 1995. Direct molecular analysis of archival tumor tissue for loss of heterozygosity. BioTechniques 19(2):190–192.

Keogh, J.S. 1999. Evolutionary implications of hemipenial morphology in the terrestrial Australian elapid snakes. Zoological Journal of the Linnean Society 125(2):239–278.

Keogh, J.S. and S.A. Smith. 1996. Taxonomy and natural history of the Australian bandy-bandy snakes (Elapidae: Vermicella) with a description of two new species. Journal of Zoology (London) 240(4):677–701.

Keogh, J.S., J.K. Webb, and R. Shine. 2007. Spatial genetic analysis and long-term mark–recapture data demonstrate male-biased dispersal in a snake. Biology Letters 3(1):33–35.

Keogh, J.S., R. Shine, and S. Donnellan. 1998. Phylogenetic relationships of terrestrial Australo-Papuan elapid snakes (subfamily Hydrophiinae) based on cytochrome b and 16S rRNA sequences. Molecular Phylogenetics and Evolution 10(1):67–81.

Kerns, M.J.J., M.A. Darst, T.G. Olsen, M. Fenster, P. Hall, and S. Grevey. 2008. Shrinkage of cutaneous specimens: formalin or other factors involved? Journal of Cutaneous Pathology 35(12):1093–1096.

Literature Cited

267

Killian, J.K., T.R. Buckley, N. Stewart, L. Barry, B.L. Munday, and R.L. Jirtle. Marsupials and eutherians reunited: genetic evidence for the theria hypothesis of mammalian evolution. Mammalian Genome 12(7):513–517.

Kinghorn, J.R. 1923. A new genus of elapine snake from north Australia. Records of the Australian Museum 14(1):42–46.

Kinghorn, J.R. 1955. Herpetological notes number 5. Records of the Australian Museum 23(5):283–287.

Kinghorn, J.R. 1964. The snakes of Australia. Angus and Robertson LTD, Sydney. 197 pp.

Kohn, A.J. and G.H. Orians. 1962. Ecological data in the classification of closely related species. Systematic Zoology 11(3):119–127.

Kolaczkowski, B. and J.W. Thornton. 2004. Performance of maximum parsimony and likelihood phylogenetics when evolution is heterogeneous. Nature 431(7011):980–984.

Krefft, G. 1862a. Note on Furina textilis. The Annals and Magazine of Natural History 3(10):393–394.

Krefft, G. 1862b. Notes upon Australian snakes, and their geographical distribution. Proceedings of the Zoological Society of London 10(3):224–226.

Krefft, G. 1869. The snakes of Australia: an illustrated and descriptive catalogue of all the known species. Thomas Richards, Government Printer, Sydney. 108 pp.

Kuch, U. and F.B. Yuwono. 2002. First record of brown snakes Pseudonaja cf. textilis (Duméril, Bibron and Duméril, 1854) from Papua, Indonesia (Squamata: Serpentes: Elapidae). Herpetozoa 15(1/2):75–78.

Literature Cited

268

Kuch, U., J.S. Keogh, J. Weigel, L.A. Smith, and D. Mebs. 2005. Phylogeography of Australia‘s king brown snake (Pseudechis australis) reveals Pliocene divergence and Pleistocene dispersal of a top predator. Naturwissenschaften 92(3):121–127.

Kumazawa, Y., H. Ota, M. Nishida, and T. Ozawa. 1998. The complete nucleotide sequence of a snake (Dinodon semicarinatus) mitochondrial genome with two identical control regions. Genetics 150(1):313–329.

Lahnsteiner, F. and A. Jagsch. 2005. Changes in phenotype and genotype of Austrian Salmo trutta populations during the last century. Environmental Biology of Fishes 2005(74):1.

Leaché, A.D. and T.W. Reeder. 2002. Molecular systematics of the eastern fence lizard (Sceloporus undulatus): a comparison of parsimony, likelihood, and Bayesian approaches. Systematic Biology 51(1):44–68.

Lee, J.C. 1982. Accuracy and precision in anuran morphometrics: artifacts of preservation. Systematic Zoology 31:266–281.

Legrand, B., P. de Mazancourt, M. Durigon, V. Khalifat, and K. Crainic. 2002. DNA genotyping of unbuffered formalin fixed paraffin embedded tissues. Forensic Science International 125(2):205–211.

Lehmann, U. and H. Kreipe. 2001. Real-time PCR analysis of DNA and RNA extracted from formalin-fixed and paraffin-embedded biopsies. Methods 25(4):409–418.

Leviton, A. E., R.H. Gibbs, E. Heal, and C.E. Dawson. 1985. Standards in herpetology and ichthyology: Part 1. Standard symbolic codes for institutional resource collections in herpetology and ichthyology. Copeia 1985(3):802–832.

Li, J., X. Liao, and H. Yang. 2000. Molecular characterization of a parasitic tapeworm (Ligula) based on DNA sequences from formalin-fixed specimens. Biochemical Genetics 38(9/10):309–322.

Literature Cited

269

Lin, J., S.H. Kennedy, T. Svarovsky, J. Rogers, J.W. Kemnitz, A. Xu, and K.T. Zondervan. 2009. High-quality genomic DNA extraction from formalin-fixed and paraffin-embedded samples deparaffinized using mineral oil. Analytical Biochemistry 395(2):265–267.

Lindahl, T. 1993. Instability and decay of the primary structure of DNA. Nature 362(6422):709–715.

Linne, C.v. 1956. Caroli Linnaei Systema naturae: a photographic facsimile of the first volume of the tenth edition (1758): regnum animale. Trustees of the British Museum, London. 823 pp.

Lleonart, J., J. Salat, and G.J. Torres. 2000. Removing allometric effects of body size in morphological analysis. Journal of Theoretical Biology 205(1):85–93.

Longman, H.A. 1915. Reptiles from Queensland and the Northern Territory. Memoirs of the Queensland Museum 3(1):30–34.

Longmore, R. 1986. Atlas of elapid snakes of Australia. Australian Government Publishing Service, Canberra. 115 pp.

Los Alamos National Laboratory. 2009. ElimDupes: duplicate sequence removal (http://hcv.lanl.gov/content/sequence/ELIMDUPES/elimdupes.html). Last accessed 31/12/2009.

Loveridge, A. 1934. Australian reptiles in the Museum of Comparative Zoology, Cambridge, Massachusetts. Bulletin of the Museum of Comparative Zoölogy (Harvard) 77(6):243–383.

Mack, G. and S.B. Gunn. 1953. De Vis‘ types of Australian snakes. Memoirs of the Queensland Museum 13(1):58–70.

Literature Cited

270

MacKenzie, D.I. and J.A. Royle. 2005. Designing efficient occupancy studies: general advice and tips on allocation of survey effort. Journal of Applied Ecology 42(6):1105– 1114.

Macleay, W. 1881. Description of two new species of snakes. Proceedings of the Linnean Society of New South Wales 1(6):811–813.

Macleay, W. 1885. On a new snake from the Barrier Ranges. Proceedings of the Linnean Society of New South Wales 10(1):61–62.

Maddison, D.R., D.L. Swofford, and W.P. Maddison. 1997. NEXUS: an extensible file format for systematic information. Systematic Biology 46(4):590–621.

Magnusson, W.E., F. Costa, A. Lima, F. Baccaro, R. Braga-Neto, R.L. Romero, M. Menin, J. Penha, J.-M. Hero, and B.E. Lawson. 2008. A program for monitoring biological diversity in the Amazon: an alternative perspective to threat-based monitoring. Biotropica 40(4):409–411.

Magnusson, W.E. and G. Mourão. 2000. Statistics without math. Sinauer Associates, Inc., Sunderland. 136 pp.

Mallet, J. 1995. A species definition for the Modern Synthesis. Trends in Ecology and Evolution 10(7):294–299.

Mason, S.F. 1977. A history of the sciences, new revised edition. Collier Books, New York. 638 pp.

Masuda, N., T. Ohnishi, S. Kawamoto, M. Monden, and K. Okubo. 1999. Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples. Nucleic Acids Research 27(22):4436– 4443.

Literature Cited

271

Mayden, R.L. 1997. A hierarchy of species concepts: the denouement in the saga of the species problem. Pages 381–424 in: Species: the Units of Biodiversity. M.F. Claridge, H.A. Dawah, M.R. Wilson, eds. Springer, Berlin. 460 pp.

Mayr, E. 1940. Speciation phenomena in birds. American Naturalist 74(752):249–278.

Mayr, E. 1969. Principles of Systematic Zoology. McGraw-Hill, New York. 428 pp.

McCoy, F. 1867. On the recent zoology and palaeontology of Victoria. The Annals and Magazine of Natural History (3)(20):175–202.

McCoy, F. 1879a. The common brown snake; small-scaled brown snake; the shieldfronted brown snake. Prodromus of the Zoology of Victoria 3(1):11–14, plate 23.

McCoy, F. 1879b. The two-hooded furina snake. Prodromus of the Zoology of Victoria 4(1):13–15, plate 32.

McDowell, S.B. and H.G. Cogger. 1967. Aspidomorphus, a genus of New Guinea snakes of the family Elapidae, with notes on related genera. Journal of Zoology (London) 151(4):497–543.

McPhee, D.R. 1979. The observer‘s book of snakes and lizards of Australia. Methuen of Australia Pty Ltd, Sydney. 157.

Melville, J. and R. Swain. 2000. Evolutionary relationships between morphology, performance and habitat openness in the lizard genus Niveoscincus (Scincidae: Lygosominae). Biological Journal of the Linnean Society 70(4):667–683.

Melville, J., J.A. Schulte II, and A. Larson. 2004. A molecular study of phylogenetic relationships and evolution of antipredator strategies in Australian Diplodactylus geckos, subgenus Strophorus. Biological Journal of the Linnean Society 82(1):123–138.

Mengden, G.A. 1982. Chromosomal evolution and the phylogeny of elapid snakes. PhD thesis, Australian National University. 219 pp.

Literature Cited

272

Mengden, G.A. 1983. The taxonomy of Australian elapid snakes: a review. Records of the Australian Museum 35(5):195–222.

Mengden, G.A. 1985a. A chromosomal and electrophoretic analysis of the genus Pseudonaja. Pages 193–208 in: Biology of Australasian frogs and reptiles. G. Grigg, R. Shine, and H. Ehmann, eds. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 527 pp.

Mengden, G.A. 1985b. Australian elapid phylogeny: a summary of the chromosomal and electrophoretic data. Pages 185–192 in: Biology of Australasian frogs and reptiles. G. Grigg, R. Shine, and H. Ehmann, eds. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 527 pp.

Mengden, G.A. and M. Fitzgerald. 1987. The paradoxical brown snakes. Pages 458–469 in: Toxic plants and animals - a guide for Australia. J. Covacevich, P. Davie, J. Pearn, eds. Queensland Museum, Brisbane. 504 pp.

Miller, M.A., M.T. Holder, R. Vos, P.E. Midford, T. Liebowitz, L. Chan, P. Hoover, and T. Warnow. The CIPRES portals (http://www.phylo.org/sub_sections/portal). Last accessed 31/12/2009.

Miller, S.E. 2007. DNA barcoding and the renaissance of taxonomy. Proceedings of the National Academy of Sciences 104(12):4775–4776.

Minelli, A. 2003. The status of taxonomic literature. Trends in Ecology and Evolution 18(2):75–76.

Minton, Jr., S.A. and S.K. Salanitro. 1972. Serological relationships among some colubrid snakes. Copeia 1972(2):246–252.

Mirtschin, P. and R. Davis. 1983. Dangerous snakes of Australia. Rigby Limited, Adelaide. 208 pp.

Literature Cited

273

Mirtschin, P.J., P. Masci, D.C. Paton, and T. Kuchel. 1998. Snake bites recorded by veterinary practices in Australia. Australian Veterinary Journal 76(3):195–198.

Mitchell, F.J. 1951. The South Australian reptile fauna. Part I. Ophidia. Records of the South Australian Museum 9(4):545–557.

Mitchell, F.J. 1955. Preliminary account of the Reptilia and Amphibia collected by the National Geographic Society-Commonwealth Government-Smithsonian Institution expedition to Arnhem Land (April to November, 1948). Records of the South Australian Museum 11:373–407.

Moore, P. 2005. Replicating success. Nature 435(7039):235–238.

Morrison, D.A. 2007. Increasing the efficiency of searches for the maximum-likelihood tree in a phylogenetic analysis of up to 150 nucleotide sequences. Systematic Biology 56(6):988–1010.

Müller, K. 2005. The efficiency of different search strategies in estimating parsimony jackknife, bootstrap, and Bremer support. BMC Evolutionary Biology 5(1):58.

Nagai, M., A. Yoshida, and N. Sato. 1998. Additive effects of bovine serum albumin, dithiothreitol, and glycerol on PCR. Biochemistry and Molecular Biology International 44(1):157–163.

Nagelkerke, N.J.D., R.M.D. Bernsen, and D.E.E. Rizk. 2007. Authors should publish their raw data. International Urogynecological Journal 18(12):1387–1390.

Nixon, K.C. 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15(4):407–414.

Noguchi, M., N. Maezawa, Y. Nakanishi, Y. Matsuno, Y. Shimosato, and S. Hirohashi. 1993. Application of the p53 gene mutation pattern for differential diagnosis of primary versus metastatic lung carcinomas. Diagnostic Molecular Pathology 2(1):29–35.

Literature Cited

274

Noguchi, M., S. Furuya, T. Takeuchi, and S. Hirohashi. 1997. Modified formalin and methanol fixation methods for molecular biological and morphological analyses. Pathology International 47(10):685–691.

Nuin, N.A.S. 2009. MrMTgui, a simple interface to Modeltest and MrModeltest. Program distributed by the author, Queen‘s University. Available at (http://genedrift.org/mtgui.php). Last accessed 31/12/2009.

Nylander, J.A.A. 2004. MrModeltest v2.3. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

Orange, P. 1992. Colour morphs in Pseudonaja nuchalis (Serpentes: Elapidae) variation on a theme? Herpetofauna 22(1):22–23.

O‘Shea, M. 1996. A guide to the snakes of Papua New Guinea. Beaumont Publishing Pte Ltd, Singapore. 239 pp.

Pääbo, S. 1985. Molecular cloning of ancient Egyptian mummy DNA. Nature 314(6012):644–645.

Pääbo, S., J.A. Gifford, and A.C. Wilson. 1988. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Research 16(20):9775–9787.

Page, R.D.M. and E.C. Holmes. 1998. Molecular evolution: a phylogenetic approach. Wiley-Blackwell, Oxford. 352 pp.

Parker, H.W. 1926. New reptiles and a new frog from Queensland. Annals and Magazine of Natural History (9)(17):665–670. Pavelic, J., K. Gall-Trošelj, M.H. Bosnar, M.M. Kardum, and K. Pavelic. 1996. PCR amplification of DNA from archival specimens. A methodological approach. Neoplasma 43(2):75–81.

Literature Cited

275

Pearson, H. and D. Stirling. 2003. DNA extraction from tissue. Pages 33–34 in: PCR protocols (Methods in molecular biology, volume 226). J.M. Bartlett and D. Stirling, eds. Humana Press, Totowa. 556 pp.

Peters, W. 1863. Übersicht der von Hrn. Richard Schomburgk an das zoologische Museum eingesandten Amphibien, aus Buchsfelde bei Adelaide in Südaustralien. Monatsberichte der königlich Preussischen Akademie der Wissenschaften zu Berlin 1863: 228–236.

Peters, W.C.H. 1867. Über Flederthiere (Pteropus gouldii, Rhinolophus deckenii, Vespertilio lobipes, Vesperugo temminckii) und Amphibien (Hypsilurus godeffroyi, Lygosoma scutatum, Stenosoma narisostre, Onychocephalus unguirostris, Ahaetulla poylepis, Pseudechis scutellatus, Hoplobatrachus reinhardtii, Hyla coriacea). Monatsberichte der königlich Preussischen Akademie der Wissenschaften zu Berlin. 1867(11 November):703–712.

Phillips, B.L., G.P. Brown, M. Greenlees, J.K. Webb, and R. Shine. 2007. Rapid expansion of the cane toad (Bufo marinus) invasion front in tropical Australia. Austral Ecology 32(2):169–176.

Phillips, M.L. 2008. Crime scene genetics: transforming forensic science through molecular technologies. BioScience 58(6):484–489.

Pierson, M.J., R. Martinez-Arias, B.R. Holland, N.J. Gemmell, M.E. Hurles, and D. Penny. 2006. Deciphering past human population movements in Oceania: provably optimal trees of 127 mtDNA genomes. Molecular Biology and Evolution 23(10):1966– 1975.

Poe, S. 1998. Sensitivity of phylogeny estimation to taxonomic sampling. Systematic Biology 47(1):18–31.

Pohl, F.J. 1944. Amerigo Vespucci: pilot major. Columbia University Press, New York. 249 pp.

Literature Cited

276

Pollock, D.A. 2009. A new species of Ischyomius from Venezuela (Coleoptera, Tenebrionoidea, Pythidae) with a revised key to world species. ZooKeys 6(1):69–74.

Pollock, D.D., D.J. Zwickl, J.A. McGuire, and D.M. Hillis. 2002. Increased taxon sampling is advantageous for phylogenetic inference. Systematic Biology 51(4):664– 671.

Pompanon, F., A. Bonin, E. Bellemain, and P. Taberlet. 2005. Genotyping errors: causes, consequences and solutions. Nature Reviews Genetics 6(11):847–859.

Posada, D. and K.A. Crandall. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14(9):817–818.

Posada, D. and T.R. Buckley. 2004. Model selection and model averaging in phylogenetics: advantages of the AIC and Bayesian approaches over likelihood ratio tests. Systematic Biology 53(5):793–808.

Puorto, G., M.D.G. Salomão, R.D.G. Theakston, R.S. Thorpe, D.A. Warrell, and W. Wüster. 2001. Combining mitochondrial DNA sequences and morphological data to infer species boundaries: phylogeography of lanceheaded pitvipers in the Brazilian Atlantic forest, and the status of Bothrops pradoi (Squamata: Serpentes: Viperidae). Journal of Evolutionary Biology 14(4):527–538.

Quinn, G.P. and M.J. Keogh. 2002. Experimental design and data analysis for biologists. University Press, Cambridge. 537.

Ralser, M., R. Querfurth, H.J. Warnatz, H. Lehrach, M.L. Yaspo, and S. Krobitsch. An efficient and economic enhancer mix for PCR. Biochemical and Biophysical Research Communications 347(3):747–751.

Rambaut, A. 2009. FigTree: a graphical viewer of phylogenetic trees, version 1.2.1. Self-published, available at (http://tree.bio.ed.ac.uk/software/figtree/). Last accessed 31/12/2009.

Literature Cited

277

Rannala, B., J.P. Huelsenbeck, Z. Yang, and R. Nielsen. 1998. Taxon sampling and the accuracy of large phylogenies. Systematic Biology 47(4):702–710.

Raykov, T. and G.A. Marcoulides, G.A. 2008. An introduction to applied multivariate analysis. Taylor and Francis, New York. 485 pp.

Reed, R.N. 2001. Effects of museum preservation techniques on length and mass of snakes. Amphibia-Reptilia 22(4):488–491.

Ren, Z.-P., J. Sällström, C. Sundström, M. Nistér, and Y. Olsson. 2000. Recovering DNA and optimizing PCR conditions from microdissected formalin-fixed and paraffinembedded materials. Pathobiology 68(4–5):215–217. Ridley, M. 1993. Evolution (3rd edition). Wiley-Blackwell, Oxford. 792 pp.

Robin, E.D. and R. Wong. 1988. Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells. Journal of Cellular Physiology. 136(3): 507– 513.

Rohland, N. and M. Hofreiter. 2007. Comparison and optimization of ancient DNA extraction. BioTechniques 42(3):343–352.

Ronquist, F. and A.R. Deans. 2010. Bayesian phylogenetics and its influence on insect systematics. Annual Review of Entomology 55(1):189–206.

Ronquist, F. and J.P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19(12):1572–1574.

Rosenberg, M.S., and S. Kumar (2001) Incomplete taxon sampling is not a problem for phylogenetic inference. Proceedings of the National Academy of Sciences USA 98(19):10751–10756.

Rosenberg, M.S., and S. Kumar. 2003. Taxon sampling, bioinformatics, and phylogenomics. Systematic Biology 52(1):119–124.

Literature Cited

278

Rydin, C. and M. Källersjö. 2002. Taxon sampling and seed plant phylogeny. Cladistics 18(5):485–513. Sambrook, J. 2001. Molecular cloning: a laboratory manual, 3rd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 999 pp.

Sanders, K.L., A. Malhotra, and R.S. Thorpe. 2006. Combining molecular, morphological and ecological data to infer species boundaries in a cryptic tropical pitviper. Biological Journal of the Linnaean Society, 87(3):343–364.

Sarkar, I.N. 2006. Phylogenetics in the modern era. Journal of Biomedical Informatics 39(1):3–5.

Sato, Y., R. Sugie, B. Tsuchiya, T. Kameya, M. Natori, and K. Mukai. 2001. Comparison of the DNA extraction methods for polymerase chain reaction amplification from formalin-fixed and paraffin-embedded tissues. Diagnostic Molecular Pathology 10(4):265–271.

Savioz, A., J.-L. Blouin, S. Guidi, S.E. Antonarakis, and C. Bouras. 1997. A method for the extraction of genomic DNA from human brain tissue fixed and stored in formalin for many years. Acta Neuropathologica 93(4):408–413.

Sawada, H., H. Saito, M. Hosoi, and H. Toyohara. 2008. Evaluation of PCR methods for fixed bivalve larvae. Journal of the Marine Biological Association of the United Kingdom 88(7):1441–1449.

Sawaya, R.J. and I. Sazima. 2003. A new species of Tantilla (Serpentes: Colubridae) from southeastern Brazil. Herpetologica 59(1):119–126.

Scanlon, J.D. and M.S.Y. Lee. 2004. Phylogeny of Australasian venomous snakes (Colubroidea, Elapidae, Hydrophiinae) based on phenotypic and molecular evidence. Zoologica Scripta 33(4):335–366.

Literature Cited

279

Schander, C. and K.M. Halanych. 2003. DNA, PCR and formalinized animal tissue - a short review and protocols. Organisms, Diversity, and Evolution 3(3):195–205.

Scheiner, S.M. and J. Gurevitch. 1993. Design and analysis of ecological experiments. Chapman and Hall, New York. 445 pp.

Schill, R.O. 2007. Comparison of different protocols for DNA preparation and PCR amplification of mitochondrial genes of tardigrades. Journal of Limnology 66(Supplement 1):164–170.

Schizas, N.V., G.T. Street, B.C. Coull, G.T. Chandler, and J.M. Quattro. 1997. An efficient DNA extraction method for small metazoans. Molecular Marine Biology and Biotechnology 6(4):381–383.

Schmelz, R.M., R.M.C. de la Peña, and J. Römbke. 2009. Benefits from ecological study methods to taxonomy of enchytraeids in southern Mata Atlântica. Pesquisa Agropecuária Brasileira 44(8):861–867.

Schwaner, T.D., P.R. Baverstock, H.C. Dessauer, and G.A. Mengden. 1985. Immunological evidence for the phylogenetic relationships of Australian elapid snakes. Pages 177–184 in: Biology of Australasian frogs and reptiles. G. Grigg, R. Shine, and H. Ehmann, eds. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 527 pp.

Schwaner, T.D. 1988. An inventory of reptiles on Wardang Island, South Australia, with recommendations for their conservation and management. Final report to the Australian National Parks and Wildlife Service. T.D. Schwaner, Montacute Heights. 31 pp.

Shaffer, H.B., P. Meylan, and M.L. McKnight. 1997. Tests of turtle phylogeny: molecular, morphological, and paleontological approaches. Systematic Biology 46(2):235–268.

Literature Cited

280

Shea, G., R. Shine, and J.C. Covacevich. 1993. Family Elapidae. Pages 295–309 in: Fauna of Australia volume 2A: Amphibia and Reptilia. G.J.B.R. C.J. Glasby, and P.L. Beesley, eds. Australian Government Publishing Service, Canberra. 439 pp.

Shedlock, A.M., M.G. Haygood, T.W. Pietsch, and P. Bentzen. 1997. Enhanced DNA extraction and PCR amplification of mitochondrial genes from formalin-fixed museum specimens. BioTechniques 22(3):394–400.

Shi, S.-R., C. Liu, B.M. Balgley, C. Lee, and C.R. Taylor. 2006. Protein extraction from formalin-fixed, paraffin-embedded tissue sections: quality evaluation by mass spectrometry. The Journal of Histochemistry and Cytochemistry 54(6):739–743.

Shi, S.-R., R. Datar, C. Liu, L. Wu, Z. Zhang, R.J. Cote, and C.R. Taylor. 2004. DNA extraction from formalin-fixed, paraffin-embedded tissues: heat-induced retrieval in alkaline solution. Histochemistry and Cell Biology 122(3):211–218.

Shi, S.-R., R.J. Cote, and C.R. Taylor. 1997. Antigen retrieval immunohistochemistry: past, present, and future. The Journal of Histochemistry and Cytochemistry 45(3):327– 343.

Shi, S.-R., R.J. Cote, L. Wu, C. Liu, R. Datar, Y. Shi, D. Liu, H. Lim, and C.R. Taylor. 2002. DNA extraction from archival formalin-fixed, paraffin-embedded tissue sections based on the antigen retrieval principle: heating under the influence of pH. The Journal of Histochemistry and Cytochemistry 50(8):1005–1011.

Shine, R. 1989. Constraints, allometry, and adaptation: food habits and reproductive biology of Australian brownsnakes (Pseudonaja: Elapidae). Herpetologica 45(2):195– 207.

Shine, R. 1994. Allometric patterns in the ecology of Australian snakes. Copeia 1994(4):851–867.

Shine, R. and J. Covacevich. 1983. Ecology of highly venomous snakes: the Australian genus Oxyuranus (Elapidae). Journal of Herpetology 17(1):60–69.

Literature Cited

281

Shiozawa, D.K., J. Kudo, R.P. Evans, S.R. Woodward, and R.N. Williams. 1992. DNA extraction from preserved trout tissues. Great Basin Naturalist 52(1):29–34.

Siddall, M.E., F.M. Fontanella, S.C. Watson, S. Kvist, and C. Erséus. 2009. Barcoding bamboozled by bacteria: convergence to metazoan mitochondrial primer targets by marine microbes. Systematic Biology 58(4):445–451.

Simmons, M.P., K.M. Pickett, and M. Miya. 2004. How Meaningful Are Bayesian Support Values? Molecular Biology and Evolution 21(1):188–199.

Simpson, G.G. 1961. Principles of Animal Taxonomy. Columbia University Press, New York. 247 pp.

Skinner, A. 2009. A multivariate morphometric analysis and systematic review of Pseudonaja (Serpentes, Elapidae, Hydrophiinae). Zoological Journal of the Linnaean Society 155(1):171–197.

Skinner, A., S.C. Donnellan, M.N. Hutchinson, and R.G. Hutchinson. 2005. A phylogenetic analysis of Pseudonaja (Hydrophiinae, Elapidae, Serpentes) based on mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 37(2):558–571.

Skinner, A.W. 2003. Systematics of Hydrophiine Brown Snakes (Pseudonaja). Department of Environmental Biology. The University of Adelaide, Adelaide. 175 pp.

Slater, K.R. 1956. On the New Guinea taipan. Memoirs of the National Museum of Victoria, Melbourne 20(1):1–5.

Slater, K.R. 1968. A guide to the dangerous snakes of Papua. V.P. Biolink, Government Printer, Port Moresby. 22.

Slowinski, J.B., A. Knight, and A.P. Rooney. 1997. Inferring species trees from gene trees: a phylogenetic analysis of the Elapidae (Serpentes) based on the amino acid sequences of venom proteins. Molecular Phylogenetics and Evolution 8(3):349–362.

Literature Cited

282

Slowinski, J.B., J. Boundy, and R. Larson. 2001. The phylogenetic relationships of Asian coral snakes (Elapidae: Calliophis and Maticora) based on morphological and molecular characters. Herpetologica 57(2):233–245.

Smith, H.M. 1955. Effect of preservation upon pattern in a Mexican garter snake. Herpetologica 11:165–168.

Smith, M.A., N.A. Poyarkov, and P.D.N. Hebert. 2008. CO1 DNA barcoding amphibians: take the chance, meet the challenge. Molecular Ecology Resources 8(2):235–246.

Smith, H.M. and R.B. Smith. 1972. Chresonymy ex Synonymy. 21(4):445.

Sompuram, S.R., K. Vani, E. Messana, and S.A. Bogen. 2004. A molecular mechanism of formalin fixation and antigen retrieval. Anatomic Pathology 121(2):190–199.

Srinivasan, M., D. Sedmark, and S. Jewell. 2002. Effect of fixatives and tissue processing on the content and integrity of nucleic acids. American Journal of Pathology 161(6):1961–1971.

Stamatakis, A., P. Hoover, and J. Rougemont. 2008. A Rapid Bootstrap Algorithm for the RAxML Web-Servers. Systematic Biology, 75(5):758–771.

Stamatakis, A., T. Ludwig, and H. Meier. 2005. RAxML-II: a program for sequential, parallel and distributed inference of large phylogenetic. Concurrency and ComputationPractice and Experience 17(14):1705–1723.

Start, R.D., C.M. Layton, S.S. Cross, and J.H.F. Smith. 1992. Reassessment of the rate of fixative diffusion. Journal of Clinical Pathology 45(12):1120–1121.

Stefanovic, S., D.W. Rice, and J.D. Palmer. 2004. Long branch attraction, taxon sampling, and the earliest angiosperms: Amborella or monocots? BMC Evolutionary Biology 4(1):35.

Literature Cited

283

Steindachner, F. 1867. Reptilien. Pages 91–92 in: Reise der österreichischen Fregatte Novare um die Erde in den Jahren 1857, 1858, 1859. Zoologischer Theil. B. von Wüllerstorf-Urbair, eds. State Printer, Vienna. 98 pp.

Storr, G.M. 1989. A new Pseudonaja (Serpentes: Elapidae) from Western Australia. Records of the Western Australian Museum 14(3):421–423.

Storr, G.M., L.A. Smith, and R.E. Johnstone. 1986. Snakes of Western Australia. Western Australian Museum, Perth. 187 pp.

Strimple, P.D. and J. Covacevich. 1997. The taipans of Australia and New Guinea. Reptiles 5(12):32–45.

Su, B., Y.-X. Wang, H. Lan, W. Wang, and Y. Zhang. 1999. Phylogenetic study of complete cytochrome b genes in musk deer (Genus Moschus) museum samples. Molecular Phylogenetics and Evolution 2(3):241–249.

Sullivan, J., D.L. Swofford, and G.J.P. Naylor. 1999. The effect of taxon sampling on estimating rate heterogeneity parameters of maximum-likelihood models. Molecular Biology and Evolution 16(10):1347–1356.

Sung, H.W., Y. Chang, I-L. Liang, W.-H. Chang, and Y.-C. Chen. 2000. Fixation of biological tissues with a naturally occurring crosslinking agent: fixation rate and effects of pH, temperature, and initial fixative concentration. Journal of Biomedical Materials Research 52(1):77–87.

Sutherland, S.K. 1992. Deaths from snake bite in Australia, 1981–1991. The Medical Journal of Australia 157(11–12):740–746.

Sutherland, S.K. and R.L. Leonard. 1995. Snakebite deaths in Australia 1992–1994 and a management update. The Medical Journal of Australia 163(11–12):616–618.

Literature Cited

284

Sutherst, R.W., R.B. Floyd, and G.F. Maywald. 1996. The Potential Geographical Distribution of the Cane Toad, Bufo marinus L. in Australia. Conservation Biology 10(1): 294–299.

Swofford, D.L. 2003. PAUP*: phylogenetic analysis using parsimony (*and other methods), Version 4.0b10. Sinauer Associates, Sunderland.

Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.1, build 4104. Molecular Biology and Evolution 24(8):1596–1599.

Tang, E.P.Y. 2006. Path to effective recovering of DNA from formalin-fixed biological samples in natural history collections: workshop summary. National Academies Press, Washington. 52 pp.

Taylor, W.R. 1981. On preservation of color and color patterns. Curation Newsletter 3(1):2–10.

Teynié, A. and P. David. 2005. Additions to the snake fauna of southern Laos, with the second Laotian specimen of Naja siamensis (LAURENTI, 1768) and the first country record of Oligodon taeniatus (Günther, 1861) (Squamata, Serpentes). Russian Journal of Herpetology 14(1):39–44.

Thiele, K. 1993. The holy grail of the perfect character: the cladistic treatment of morphometric data. Cladistics 9(3):275–304.

Thompson, J.D., D.G. Higgins, and T.J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22(22):4673–4680.

Thomson, D.F. 1933. Notes on the Australian snakes of the genera Pseudechis and Oxyuranus. Proceedings of the Zoological Society of London 1933(4): 855–860.

Literature Cited

285

Underwood, G. 1967. A comprehensive approach to the classification of higher snakes. Herpetologica 23(2):161–168.

Urban, M.C., B.L. Phillips, D.K. Skelly, and R. Shine. 2008. A toad more traveled: the heterogeneous invasion dynamics of cane toads in Australia. The American Naturalist 171(3):E134–E148.

Vachot, A.-M. and M. Monnerot. 1996. Extraction, amplification and sequencing of DNA from formaldehyde-fixed specimens. Ancient Biomolecules 1(1):3–16.

Van Beers, E.H., S.A. Joosse, M.J. Ligtenberg, R. Fles, F.B.L. Hogervorst, S. Verhoef, and P.M. Nederlof. 2006. A multiplex PCR predictor for a CGH success of FFPE samples. British Journal of Cancer 94(2):333–337.

Van Eenennaam, A.L., R.L. Weaber, D.J. Drake, M.C.T. Penedo, R.L. Quaas, D.J. Garrick, and E.J. Pollak. 2007. DNA-based paternity analysis and genetic evaluation in a large, commercial cattle ranch setting. Journal of Animal Science 85(12):3159–3169.

Van Regenmortel, M.H. 1997. Viral species. Pages 17–24 in: Species: the units of biodiversity. M.F. Claridge, H.A. Dawah, M.R. Wilson, eds. Springer, Berlin. 460 pp.

Van Valen, L. 1976. Ecological species, multispecies, and oaks. Taxon 25(2/3):233– 239.

Varadaraj, K. and D.M. Skinner. 1994. Cytoplasmic localization of transcripts of a complex G+C-rich crab satellite DNA. Chromosoma 103(6): 423–431.

Waite, E.R. 1898. Snakes of Australia - a popular account of Australian snakes with a complete list of the species and an introduction to their habits and organisation. Thomas Shine, Sydney. 1–71.

Waite, E.R. 1925. Field notes on some Australian reptiles and batrachians. Records of the South Australian Museum 3(1):17–32.

Literature Cited

286

Wall P.K., J. Leebens-Mack, K.F. Müller, D. Field, N.S. Altman, and C.W. dePamphilis. 2008. PlantTribes: A gene and gene family resource for comparative genomics in plants. Nucleic Acids Research, 36, D970–D976.

Wallach, V. 1985. A cladistic analysis of the terrestrial Australian Elapidae. Pages 223– 253 in: Biology of Australasian frogs and reptiles. G. Grigg, R. Shine, and H. Ehmann, eds. Surrey Beatty and Sons Pty Limited, Chipping Norton, NSW. 527 pp.

Welch, K.R.G. 1994. Snakes of the world - a checklist. 1. Venomous snakes. KCM Books, Somerset, England. 135 pp.

Wells, R.W. 2002. Taxonomy of the Genus Pseudonaja (Reptilia: Elapidae) in Australia. Australian Biodiversity Record 7(1):1–41.

Wells, R.W. and C.R. Wellington. 1983. A synopsis of the class Reptilia in Australia. Australian Journal of Herpetology 1(3–4):73–129.

Wells, R.W. and C.R. Wellington. 1985. A classification of the Amphibia and Reptilia of Australia. Australian Journal of Herpetology Supplementary Series 1(1):1–61.

Werner, Y.L., N. Sivan, V. Kushnir, and U. Motro. 1999. A statistical approach to variation in Cerastes (Ophidia: Viperidae) with the description of two endemic subspecies. Kaupia 8:83–97.

Whitaker, P.B. and R. Shine. 2003. A radiotelemetric study of movements and sheltersite selection by free-ranging brownsnakes (Pseudonaja textilis, Elapidae). Herpetological Monographs 17(1):130–144.

White, J. 1790. Journal of a voyage to New South Wales with sixty-five plates of non descript animals, birds, lizards, serpents, curious cones of trees and other natural productions. J. Debrett, London. 299 pp.

Literature Cited

287

White, J. 1987. Elapid snakes: aspects of envenomation. Pages 390–429 in: Toxic plants and animals - a guide for Australia. P.D. J. Covacevich, J. Pearn eds. Queensland Museum, Brisbane. 504 pp.

Wiegand, P., J. Domhöver, and B. Brinkmann. 1996. DNA-Degradation in formalinfixierten Gewerben. Der Pathologe 17(6):451–454.

Wiens, J.J. and T.A. Penkrot. 2002. Delimiting species using DNA and morphological variation and discordant species limits in spiny lizards (Sceloporus). Systematic Biology 51(1):69–91.

Wiens, J.J. and T.W. Reeder. 1997. Combining data sets with different numbers of taxa for phylogenetic analysis. Systematic Biology 44(4):548–558.

Wiley, E.O. 1981. Phylogenetics: the theory and practice of phylogenetic systematics. John Wiley and Sons, New York. 456 pp.

Wilgenbusch J.C., D.L. Warren, and D.L. Swofford. 2004. Are We There Yet: A system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference. Self-published, available at (http://ceb.csit.fsu.edu/awty). Last accessed 31/12/2009.

Willerslev, E. and A. Cooper. 2005. Ancient DNA. Proceedings of the Royal Society of London B 272(1558):3–16.

Williams, C., F. Pontén, C. Moberg, P. Söderkvist, M. Uhlén, J. Pontén, G. Sitbon, and J. Lundeberg. 1999. A high frequency of sequence alterations is due to formalin fixation of archival specimens. American Journal of Pathology 155(5):1467–1471.

Williams, D., W. Wüster, and B.G. Fry. 2006. The good, the bad and the ugly: Australian snake taxonomists and a history of the taxonomy of Australia‘s venomous snakes. Toxicon 48(7):919–930. Williams, D.J., M. O‘Shea, R.L. Daguerre, C.E. Pook, W. Wüster, C.J. Hayden, J.D. McVay, O. Paiva, T. Matainaho, K.D. Winkel, and C.C. Austin. 2008. Origin of the

Literature Cited

288

eastern brownsnake, Pseudonaja textilis (Duméril, Bibron and Duméril) (Serpentes: Elapidae: Hydrophiinae) in New Guinea: evidence of multiple dispersals from Australia, and comments on the status of Pseudonaja textilis pughi Hoser 2003. Zootaxa 1703(1):47–61.

Wilson, S. 2005. A field guide to reptiles of Queensland. Reed New Holland, French‘s Forest. 256 pp.

Wilson, S. and G. Swan. 2003. Reptiles of Australia. Princeton University Press, Princeton. 480 pp.

Wilson, S. and G. Swan. 2008. A complete guide to reptiles of Australia. New Holland Publishers (Australia) Pty Ltd., Sydney. 512 pp.

Worrell, E. 1961a. A new insular brown snake. Proceedings of the Royal Society of New South Wales 1958–1959(1):56–58.

Worrell, E. 1961b. Herpetological name changes. Western Australian Naturalist 8(1):18–27.

Worrell, E. 1963. Reptiles of Australia: crocodiles, turtles, tortoises, lizards, snakes; describing all Australian species, their appearance, their haunts, their habits. Angus and Robertson Ltd., Sydney. 169 pp.

Worrell, E. 1970. Reptiles of Australia: crocodiles, turtles, tortoises, lizards, snakes; describing all Australian species, their appearance, their haunts, their habits, 2nd edition. Angus and Robertson Ltd., Sydney. 169 pp.

Wu, L., N. Patten, C.T. Yamashiro, and B. Chui. 2002. Extraction and amplification of DNA from formalin-fixed, paraffin-embedded tissues. Applied Immunohistochemistry and Molecular Morphology 10(3):269–274.

Wüster, W., A.J. Dumbrell, C. Hay, C.E. Pook, D.J. Williams, B.G. Fry. 2005. Snakes across the Strait: trans-Torresian phylogeographic relationships in three genera of

Literature Cited

289

Australasian snakes (Serpentes: Elapidae: Acanthophis, Oxyuranus, and Pseudechis). Molecular Phylogenetics and Evolution 34(1):1–14. Wüster, W., B. Bush, J.S. Keogh, M. O‘Shea, and R. Shine. 2001. Taxonomic contributions in the ‗amateur‘ literature: comments on recent descriptions of new genera and species by Raymond Hoser. Litteratura Serpentium 21(3):67–91.

Xiao, W.H., C.H. Wu, B. Su, Y. Zhang, and G. Cui. 1997. DNA extracted from formalin-fixed Xenocrypis yunnanensis and sequence analysis of its cytochrome B gene. Zoological Research 18(3):242,252,258,284.

Yang, H., E.M. Golenberg, and J. Shoshani. 1997. Probiscidean DNA from museum and fossil specimens: an assessment of ancient DNA extraction and amplification techniques. Biochemical Genetics 35(5/6):165–179.

Yue, G.H. and L. Orban. 2001. Rapid Isolation of DNA from fresh and preserved fish scales for polymerase chain reaction. Marine Biotechnology 3(3):199–204.

Zimmermann, J., M. Hajibabaei, D.C. Blackburn, J. Hanken, E. Cantin, J. Posfai, and T.C. Evans, Jr. 2008. DNA damage in preserved specimens and tissue samples: a molecular assessment. Frontiers in Zoology 5(1):18–30.

Zusi, R.L. 1982. Infraspecific geographic variation and the subspecies concept. Auk 99(3)606–608.

Zwickl, D.J. and D.M. Hillis. 2002. Increased taxon sampling greatly reduces phylogenetic error. Systematic Biology 51(4):588–598.

Appendix I. Timeline of Pseudonaja taxonomy

Below is simplified chresonymy (listing of all nomenclature through time) of Pseudonaja, showing taxonomic name changes occurring within this genus. As per the rules of the International Code of Zoological Nomenclature (International Commission on Zoological Nomenclature 1999), listed synonymies do not constitute an official taxonomic revision and are used for illustrative purposes only. The format for the entries contained within each species is as follows: year of publication, genus, species, (subspecies), author, and first page number of description (in square brackets). The first unique entry of each binomial (or trinomial) combination is listed in bold font, while subsequent entries are listed in normal font. Additionally, the entry for each (sub)species type specimen includes the following information: type status, museum, museum registration number, and type locality. Taxonomic placements were confirmed by reviewing the results of previous taxonomic checklists or reviews (e.g., the zoological overview of Cogger et al. 1983, the chromosome analyses of Mengden 1985a, and the mitochondrial DNA analyses of Skinner et al. 2005) in conjunction with systematic results presented in chapters four and five of this thesis. Type specimens not located (Cogger et al. 1983, personal search) are placed based on original descriptions and the results of previous taxonomic reviews (such as Cogger et al. 1983). Taxonomic terminology used in this appendix is defined as follows (Smith and Smith 1972, International Commission on Zoological Nomenclature 1999): Holotype – The single specimen designated or otherwise fixed as the name-bearing type of a nominal species or subspecies when the nominal taxon is established. Paratype – Each specimen of a type series other than the holotype. Syntype – Each specimen of a type series from which neither a holotype nor a lectotype has been designated. The syntypes collectively constitute the name-bearing type. Lectotype – A syntype designated as the single name-bearing type specimen subsequent to the establishment of a nominal species or subspecies. Paralectotype – Each specimen of a former syntype series remaining after the designation of a lectotype.

Appendix I. Pseudonaja timeline Pseudonaja Günther 1858 1858 Pseudonaja Günther [227] Type Species: Pseudonaja nuchalis Günther 1858 1860 Euprepiosoma Fitzinger [410] Type Species: Furina textilis Duméril et al.1854 1862a Pseudonaia Krefft [394] Type Species: Pseudonaja nuchalis Günther 1858 2002 Placidaserpens Wells [10] Type Species: Demansia guttata Parker 1926 2002 Notopseudonaja Wells [11] Type Species: Cacophis modesta Günther 1872 2002 Dugitophis Wells [14] Type Species: Pseudonaja affinis Günther 1872 2002 Euprepiosoma (Fitzinger) Wells [16] Type Species: Furina textilis Duméril et al.1854

Pseudonaja affinis Günther 1872 1872 Pseudonaja affinis Günther [35] Holotype: The Natural History Museum 1946.1.19.77 Type Locality: Australia 1914 Demansia affinis Fry 1934 Demansia textilis affinis Loveridge 1947 Demansia affinis Hunt 1950 Demansia nuchalis affinis Glauert 1961a Demansia nuchalis tanneri Worrell [56] Holotype: Museum Victoria D47286 Type Locality: Boxer Island, Recherche Archipelago, Western Australia Paratype: Australian Museum R125973 Type Locality: Boxer Island, Recherche Archipelago, Western Australia 1964 Demansia affinis Kinghorn 1970 Pseudonaja nuchalis affinis Worrell 1970 Pseudonaja nuchalis tanneri Worrell 1982 Pseudonaja affinis Mengden 1983 Pseudonaja tanneri Wells and Wellington 1986 Pseudonaja affinis affinis Storr et al. 1986 Pseudonaja affinis tanneri Storr et al. 1989 Pseudonaja affinis exilis Storr [421] Holotype: Western Australian Museum 19870 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 3294 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 12794 Type Locality: Rottnest Island, Western Australia

291

Appendix I. Pseudonaja timeline Paratype: Western Australian Museum 12795 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 12796 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 12797 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 14922 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 15028 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 15029 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 19867 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 23998 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 28896 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 48633 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 56888 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 83928 Type Locality: Rottnest Island, Western Australia Paratype: Western Australian Museum 87904 Type Locality: Rottnest Island, Western Australia 2002 Dugitophis affinis affinis Wells 2002 Dugitophis affinis exilis Wells 2002 Dugitophis affinis tanneri Wells 2003 Pseudonaja affinis affinis Wilson and Swan 2003 Pseudonaja affinis exilis Wilson and Swan 2003 Pseudonaja affinis tanneri Wilson and Swan 2009 Pseudonaja affinis charlespiersoni Hoser [15] Holotype: Australian National Wildlife Collection R1968 Type Locality: 25 miles east of Ceduna, South Australia

Pseudonaja guttata (Parker 1926) 1926 Demansia guttata Parker [668] Holotype: The Natural History Museum 1946.1.20.67 Type Locality: Winton, Queensland Paratype: The Natural History Museum 1946.1.20.68 Type Locality: Winton, Queensland 1970 Pseudonaja guttata Worrell 2002 Placidaserpens guttatus Wells 2003 Pseudonaja guttata Wilson and Swan

292

Appendix I. Pseudonaja timeline 2009 Pseudonaja guttata whybrowi Hoser [15] Holotype: Museum and Art Gallery of the Northern Territory R4646 Type Locality: Anthony‘s Lagoon Station, Northern Territory Paratype: Museum and Art Gallery of the Northern Territory R33899 Type Locality: Brunette Downs Station, Northern Territory Paratype: Museum and Art Gallery of the Northern Territory R33900 Type Locality: Brunette-Alroy Boundary, Northern Territory Paratype: Museum and Art Gallery of the Northern Territory R33901 Type Locality: Brunette-Alroy Boundary, Northern Territory

Pseudonaja inframacula (Waite 1925) 1925 Demansia textilis inframacula Waite [26] Syntype: South Australian Museum unknown registration (presumed lost) Type Locality: Horse Peninsula, South Australia Syntype: South Australian Museum unknown registration (presumed lost) Type Locality: Horse Peninsula, South Australia 1964 Demansia textilis inframalcula Kinghorn 1970 Pseudonaja textilis inframacula Worrell 1983 Pseudonaja inframacula Wells and Wellington 1986 Pseudonaja affinis inframacula Storr et al. 2002 Euprepiosoma inframacula Wells 2003a Pseudonaja textilis inframacula Hoser 2003 Pseudonaja inframacula Wilson and Swan

Pseudonaja ingrami (Boulenger 1908) 1908 Diemenia ingrami Boulenger [334] Holotype: The Natural History Museum 1946.1.20.32 Type Locality: Alexandria, Northern Territory 1947 Demansia ingrami Hunt 1979 Pseudonaja ingrami Gillam 2002 Euprepiosoma ingrami Wells 2003 Pseudonaja ingrami Wilson and Swan

Pseudonaja modesta (Günther 1872) 1872 Cacophis modesta Günther [35] Lectotype (syntype by Günther 1872, lectotype designated by Wells and Wellington 1985): The Natural History Museum 1946.1.17.46 Type Locality: Western Australia Paralectotype: The Natural History Museum 1946.1.18.42 Type Locality: Perth, Western Australia

293

Appendix I. Pseudonaja timeline Paralectotype: The Natural History Museum 1946.1.18.44 Type Locality: North-western Australia 1884 Brachysoma sutherlandi De Vis [139] Holotype: Queensland Museum J190 Type Locality: Carl Creek, Norman River, Queensland 1885 Furina Ramsayi Macleay [61] Lectotype (syntype by Macleay 1885, lectotype designated by Wells and Wellington 1985): Australian Museum R131724 Type Locality: Silverton, New South Wales Paralectotype: Australian Museum R131725 Type Locality: Silverton, New South Wales Paralectotype: Australian Museum R131726 Type Locality: Silverton, New South Wales 1896 Pseudelaps sutherlandi Boulenger 1896 Furina ramsayi Boulenger 1896 Diemenia modesta Boulenger 1914 Demansia modesta Fry 1970 Pseudonaja modesta Worrell 1983 Pseudonaja ramsayi Wells and Wellington 1983 Pseudonaja sutherlandi Wells and Wellington 1985a Brachysoma sutherlandi Mengden 1985 Pseudonaja sutherlandi Wells and Wellington 2002 Notopseudonaja modesta Wells 2002 Notopseudonaja ramsayi Wells 2002 Notopseudonaja sutherlandi Wells 2003 Pseudonaja modesta Wilson and Swan

Pseudonaja nuchalis Günther 1858 1858 Pseudonaja nuchalis Günther [227] Lectotype (syntype by Günther 1858, lectotype designated by Wells and Wellington 1985): The Natural History Museum 1946.1.20.41 Type Locality: Port Essington, Northern Territory Paralectotype: The Natural History Museum 1946.1.20.33 Type Locality: N.W. Australia Paralectotype: The Natural History Museum 1946.1.20.57 Type Locality: N.W. Australia 1862b Pseudonaia nuchalis Krefft 1867 Pseudonaja nuchalis McCoy 1879a Diemenia aspidorhyncha McCoy [13] Holotype: Museum Victoria D12352 Type Locality: Junction of Murray and Darling rivers, New South Wales 1896 Diemenia nuchalis Boulenger 1911 Pseudelaps bancrofti De Vis [25] Holotype: Queensland Museum J187 Type Locality: Stannary Hills, Queensland

294

Appendix I. Pseudonaja timeline 1914 Demansia nuchalis Fry 1915 Diemenia carinata Longman [31] Holotype: Queensland Museum J1508 Type Locality: Cane Grass Station, viâ Charleville, Western Queensland 1934 Demansia textilis nuchalis Loveridge 1947 Demansia nuchalis Hunt 1950 Demansia nuchalis nuchalis Glauert 1951 Demansia acutirostris Mitchell [547] Holotype: South Australian Museum R3133 Type Locality: Island in Lake Eyre, South Australia 1951 Demansia textilis nuchalis Mitchell 1957 Demansia nuchalis nuchalis Glauert 1961b Pseudonaja nuchalis nuchalis Worrell 1964 Demansia nuchalis nuchalis Kinghorn 1964 Demansia carinata Kinghorn 1970 Pseudonaja nuchalis nuchalis Worrell 1970 Pseudonaja acutirostris Worrell 1970 Diemenia aspidorhynchus Coventry 1983 Pseudonaja aspidorhyncha Wells and Wellington 1983 Pseudonaja carinata Wells and Wellington 1985 Pseudonaja acutirostris Wells and Wellington 1985 Pseudonaja bancrofti Wells and Wellington 1985 Pseudonaja imperitor Wells and Wellington [48] Holotype: Museum and Art Gallery of the Northern Territory R3352 Type Locality: Groote Eylandt, Northern Territory 1985 Pseudonaja jukesi Wells and Wellington [48] Holotype: Museum and Art Gallery of the Northern Territory R1186 Type Locality: Oenpelli, Arnhem Land, Northern Territory 1985 Pseudonaja kellyi Wells and Wellington [48] Holotype: Museum and Art Gallery of the Northern Territory R1689 Type Locality: 160km north of Ayer‘s Rock turnoff (Stuart Highway), Northern Territory 1985 Pseudonaja mengdeni Wells and Wellington [48] Holotype: Museum and Art Gallery of the Northern Territory R1989 Type Locality: 2km east of Maryvale, Northern Territory 1985 Pseudonaja vanderstraateni Wells and Wellington [49] Holotype: Museum and Art Gallery of the Northern Territory R371 Type Locality: 100km north of Katherine (Stuart Highway), Northern Territory 2002 Pseudonaja gowi Wells [6] Holotype: South Australian Museum R40497 (―...largest specimen of this species from the vicinity of Lyndhurst, SA in the South Australian Museum.‖) Type Locality: Eastern end of Beltana ruins, South Australia

295

Appendix I. Pseudonaja timeline Pseudonaja textilis (Duméril et al. 1854) 1854 Furina textilis Duméril et al. [1242] Holotype: Muséum National d‘Histoire Naturelle 3944 (presumed lost) Type Locality: Australia 1856 Pseudoëlaps superciliosus Fischer [107] Holotype: Zoologisches Museum Hamburg R04434 Type Locality: Sidney [sic], Neuholland (Sydney, Australia) 1858 Demansia annulata Günther [213] Holotype: The Natural History Museum 1946.1.17.54 Type Locality: New-Holland (Australia) 1858 Pseudonaja superciliosus Günther 1859 Pseudoelaps Sordellii Jan [127] Holotype: Milan Civic Museum of Natural History unknown registration (presumed lost) Type Locality: Nouvelle-Hollande (Australia) 1859 Pseudoelaps Kubingii Jan [127] Holotype: Pesth unknown registration (presumed lost) Type Locality: New South Wallis (New South Wales, Australia) 1860 Euprepiosoma textilis Fitzinger 1862a Pseudonaia textilis Krefft 1862b Pseudo-elaps kubingii Krefft 1862b Diemansia annulata Krefft 1863 Pseudoëlaps Kubingii Günther 1863 Diemennia superciliosa Günther 1863 Pseudoelaps superciliosus Jan 1863 Pseudoelaps superciliosus Beckeri Jan [116] Holotype: Zoologisches Museum Hamburg R01261 Type Locality: Sydney, Australia 1863 Pseudoelaps Kubinyi Jan 1863 Pseudoelaps textilis Jan 1863 Diemansia superciliosa Peters 1867 Cacophis Güntherii Steindachner [91] Holotype: unknown museum and registration (presumed lost) Type Locality: Neu-Holland (Australia) 1867 Furina textilis Steindachner 1867 Diemenia superciliaris McCoy 1869 Diemenia superciliosa Krefft 1873 Pseudelaps superciliosus Jan and Sordelli 1873 Pseudelaps Beckeri Jan and Sordelli 1873 Pseudelaps textilis Jan and Sordelli 1879a Diemenia superciliosa McCoy 1879b Furina bicucullata McCoy [13] Lectotype: (syntype by McCoy 1879b, lectotype designated by Coventry 1970): Museum Victoria D1832 Type Locality: Longwood, Victoria

296

Appendix I. Pseudonaja timeline Paralectotype: Museum Victoria D4610 Type Locality: Benalla, Victoria Paralectotype: Museum Victoria D8939 Type Locality: Benalla, Victoria Paralectotype: Museum Victoria D8940 Type Locality: Benalla, Victoria Paralectotype: Museum Victoria D8941 Type Locality: Benalla, Victoria Paralectotype: Museum Victoria D8942 Type Locality: Benalla, Victoria 1885 Furina cucullata Macleay 1896 Pseudoelaps sordellii Boulenger 1896 Pseudoelaps kubingii Boulenger 1896 Pseudonaja textilis Boulenger 1896 Cacophis guentherii Boulenger 1896 Diemenia textilis Boulenger 1896 Pseudechis cupreus (part.) Boulenger [329] Syntype: Museum Victoria D12711 Type Locality: Kewell, Victoria 1914 Demansia textilis Fry 1934 Demansia textilis textilis Loveridge 1967 Pseudonaja textilis McDowell and Cogger 1968 Demansia textilis textilis Slater 1970 Furina bicuculata Coventry 1970 Pseudonaja textilis textilis Worrell 1983 Cacophis guntheri Cogger et al. 1985 Pseudonaja bicucullata Wells and Wellington 1985 Pseudonaja ohnoi Wells and Wellington [48] Holotype: Museum and Art Gallery of the Northern Territory R1970 Type Locality: Mt. Gillen, Alice Springs, Northern Territory 2002 Euprepiosoma textilis Wells 2003a Pseudonaja textilis textilis Hoser 2003a Pseudonaja textilis bicucullata Hoser 2003a Pseudonaja textilis ohnoi Hoser 2003a Pseudonaja textilis Pughi Hoser [2] Holotype: American Museum of Natural History R73959 Type Locality: Baiawa, Moi Biri Bay, Papua New Guinea Paratype: American Museum of Natural History R73949 Type Locality: Cape Vogel, Menapi, Papua New Guinea 2003b Pseudonaja textilis pughi Hoser 2003b Pseudonaja elliotti Hoser [22] Holotype: Australian Museum R132991 Type Locality: 30km north of Wilcannia, New South Wales Paratype: Museum Victoria D71085 Type Locality: Wilcannia, New South Wales

297

Appendix I. Pseudonaja timeline 2009 Pseudonaja textilis cliveevattii Hoser [7] Holotype: Museum and Art Gallery of the Northern Territory R33952 Type Locality: Wave Hill, Northern Territory 2009 Pseudonaja textilis leswilliamsi Hoser [8] Holotype: Museum and Art Gallery of the Northern Territory R5205 Type Locality: Number one bore, Barkly stock route, Northern Territory Paratype: Museum and Art Gallery of the Northern Territory R5203 Type Locality: Brunette Downs, Northern Territory 2009 Pseudonaja textilis rollinsoni Hoser [8] Holotype: Museum Victoria D73622 Type Locality: Paradise, South Australia Paratype: Field Museum of Natural History 73532 Type Locality: South Australia 2009 Pseudonaja textilis jackyhoserae Hoser [12] Holotype: Australian Museum R147652 Type Locality: Merauke, Irian Jaya Paratype: Australian Museum R147659 Type Locality: Merauke, Irian Jaya

298

Appendix II. Timeline of Oxyuranus taxonomy

Below is simplified chresonymy (listing of all nomenclature through time) of Oxyuranus, showing taxonomic name changes occurring within this genus. As per the rules of the International Code of Zoological Nomenclature (International Commission on Zoological Nomenclature 1999), listed synonymies do not constitute an official taxonomic revision and are used for illustrative purposes only. The format for the entries contained within each species is as follows: year of publication, genus, species, (subspecies), author, and first page number of description (in square brackets). The first unique entry of each binomial (or trinomial) combination is listed in bold font, while subsequent entries are listed in normal font. Additionally, the entry for each (sub)species type specimen includes the following information: type status, museum, museum registration number, and type locality. Taxonomic placements were confirmed by reviewing the results of previous taxonomic checklists or reviews (e.g., the zoological overview of Cogger et al. 1983 and the chromosome analyses of Mengden 1985a) in conjunction with systematic results presented in chapters four and five of this thesis. Type specimens not located (Cogger et al. 1983, personal search) are placed based on original descriptions and the results of previous taxonomic reviews (such as Cogger et al. 1983). Taxonomic terminology used in this appendix is defined as follows (Smith and Smith 1972, International Commission on Zoological Nomenclature 1999): Holotype – The single specimen designated or otherwise fixed as the name-bearing type of a nominal species or subspecies when the nominal taxon is established. Paratype – Each specimen of a type series other than the holotype. Syntype – Each specimen of a type series from which neither a holotype nor a lectotype has been designated. The syntypes collectively constitute the name-bearing type. Lectotype – A syntype designated as the single name-bearing type specimen subsequent to the establishment of a nominal species or subspecies. Paralectotype – Each specimen of a former syntype series remaining after the designation of a lectotype.

Appendix II. Oxyuranus Timeline

300

Oxyuranus Kinghorn 1923 1923 Oxyuranus Kinghorn [42] Type Species: Oxyuranus maclennani Kinghorn 1923 1955 Parademansia (Boulenger 1896) Kinghorn [285] Type Species: Diemenia microlepidota McCoy 1879a

Oxyuranus microlepidotus McCoy 1879a 1879a Diemenia microlepidota McCoy [12] Lectotype: (syntype by McCoy 1879a, lectotype designated by Coventry 1970): Museum Victoria D12354 Type Locality: junction of Murray and Darling Rivers, New South Wales Paralectotype: Museum Victoria D12353 Type Locality: junction of Murray and Darling Rivers, New South Wales 1881 Diemenia ferox Macleay [812] Holotype: Macleay Museum, University of Sydney unknown registration (presumed lost) Type Locality: on station near Fort Bourke, New South Wales 1896 Pseudechis microlepidotus Boulenger 1896 Pseudechis ferox Boulenger 1955 Parademansia microlepidotus Kinghorn 1981 Oxyuranus microlepidotus Covacevich et al. 1982 Oxyuranus microlepidota Mengden 1983 Oxyuranus microlepidotus Shine and Covacevich 1983 Oxyuranus microlepidota Gow 1983 Parademansia microlepidota Wells and Wellington 1985 Oxyuranus microlepidotus Wallach 1985 Parademansia microlepidota Wells and Wellington 1987 Oxyuranus microlepidotus Covacevich et al. 1994 Oxyuranus microlepidota Welch 1998 Oxyuranus microlepidotus Keogh et al. 2009 Oxyuranus microlepidota Hoser

Oxyuranus scutellatus Peters 1867 1867 Pseudechis scutellatus Peters [710] Holotype: Zoologisches Museum Berlin 5883 Type Locality: Rockhampton, Australia 1911 Pseudechis wilesmithii De Vis [24] Holotype: Queensland Museum J201 Type Locality: Walsh River, Queensland 1923 Oxyuranus maclennani Kinghorn [42] Holotype: Australian Museum R7901 Type Locality: Coen, Cape York Peninsula, Queensland

Appendix II. Oxyuranus Timeline Paratype: Australian Museum R7900 Type Locality: Coen, Cape York Peninsula, Queensland 1933 Oxyuranus scutellatus Thomson 1947 Pseudechis scutellatus Hunt 1955 Oxyuranus scutellatus Mitchell 1956 Oxyuranus scutellatus canni Slater [2] Holotype: Museum Victoria D8614 Type Locality: Napa Napa, Port Moresby, Papua-New Guinea 1983 Oxyuranus canni Wells and Wellington 1994 Oxyuranus scutellatus scutellatus Welch 1994 Oxyuranus scutellatus canni Welch 2002 Oxyuranus scutellatus barringeri Hoser [47] Holotype: Western Australian Museum 60666 Type Locality: 6 km west-northwest of Amax Camp, Western Australia 2009 Oxyuranus scutellatus adelynhoserae Hoser [18] Holotype: The Natural History Museum 1992.542 Type Locality: Senggo, Irian Jaya, Papua-New Guinea Paratype: California Academy of Sciences 133796 Type Locality: Obo, Fly River, Papua-New Guinea 2009 Oxyuranus scutellatus andrewwilsoni Hoser [20] Holotype: Western Australian Museum 60666 Type Locality: 6 km west-northwest of Amax Camp, Western Australia

Oxyuranus temporalis Doughty et al. 2007 2007 Oxyuranus temporalis Doughty et al. [52] Holotype: Western Australian Museum 166250 Type Locality: Walter James Range, Western Australia

301

Appendix III. Abbreviations and their definitions

Below is a list of abbreviations, along with their definitions, used within this thesis (Leviton et al. 1985). Each abbreviation refers to an organisation or individual which/who has provided information about Oxyuranus and Pseudonaja specimens (or their tissues) to GenBank, to an online database, or directly to me.

ABTC AM AMNH ANSP ANWC ASU BF BMNH CAS CM CU EBU FLMNH FMNH KU LACM LSU MCZ MNHP MSNM MVZ NMV NTM Other QM ROM SAM SDNHM SMNS UCM USNM WAM WW YPM ZMB ZMH

Australian Biological Tissue Collection Australian Museum American Museum of Natural History Academy of Natural Sciences Australian National Wildlife Collection Department of Zoology, Arizona State University Brian Fry The Natural History Museum, London California Academy of Sciences Carnegie Museum Cornell University, Division of Biological Sciences Evolutionary Biology Unit, Australian Museum Florida Museum of Natural History Field Museum of Natural History University of Kansas, Museum of Natural History Los Angeles County Museum of Natural History Louisiana State University, Museum of Natural Science Museum of Comparative Zoology, Harvard University Musée National d‘Histoire Naturelle Museo Civico di Storia Naturale di Milano University of California, Museum of Vertebrate Zoology National Museum of Victoria Northern Territory Museum and Art Gallery Referenced when no snakes could be examined (see ABTC, BF, EBU, and WW) Queensland Museum Royal Ontario Museum South Australia Museum San Diego Natural History Museum Staatliches Museum für Naturkunde, Stuttgart University of Colorado Museum of Natural History United States National Museum of Natural History Western Australia Museum Wolfgang Wüster Yale Peabody Museum of Natural History Zoologisches Museum Berlin (Museum für Naturkunde; Humboldt Museum) Zoologisches Institut und Museum, Universität Hamburg

Appendix IV. List of external morphological measurements taken or calculated from all specimens, along with an internal reference number for each measurement (see Appendix V for images) and how each measurement was classified. Measurement IDs listed in bold (n = 75) represent new characters introduced in this study and not found in previously published accounts of Oxyuranus and Pseudonaja morphology. Measurement IDs are a function of a personal referencing system and do not equate to the total number of measurements taken. That is, although 313 measurements were taken (and are summarised below), the maximum ID listed below is 380. Eight external characters were not measured due to faded or absent colours of preserved specimens (Eye Colour, Iris Colour, Pupil Colour, and Tongue Colour), due to a lack of published definition on how to measure the character (Lingua Fossa and Tail Shape), or if character could not consistently be measured as described (Umbilicus Scar and Body in Cross-Section).

ID 1 12 55 56 57 58 59 60 61 63 64 65 66 67 68 70 71 72 73 74

Measurement Tail Length Snout-Vent Length Mental Scale Width Mental Scale Height Second Infralabial Scale Width Along Mouth Plane First Infralabial Scale Width Along Mouth Plane First Infralabial Scale Width Perpendicular to Internal Suture First Infralabial Scale Suture Length Longest First Infralabial Scale Distance Preocular Scale Width Pregenial Scale Suture Length Longest Pregenial Scale Distance Postgenial Scale Width Perpendicular to ‗Suture‘ Postgenial Scale Suture Length Longest Postgenial Scale Distance Head Length to End of Skull Head Length to End of Supralabial Scales (Upper Jaw Length) Lower Jaw Length Height of Largest Supralabial Scale (at longest distance perpendicular to mouth plane) Width of Largest Supralabial Scale (at longest distance perpendicular to above)

Measurement Type Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous

Appendix IV: Character List

ID 75 76 77 78 79 80 81 82 83 84 85 86 89 93 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113

304

Measurement Height of Largest Infralabial Scale (at longest distance perpendicular to mouth plane) Width of Largest Infralabial Scale (at longest distance perpendicular to above) Head Width at End of Skull Head Width at End of Supralabial Scales Upper Jaw Width at Mid-point of Eyes (MPE) Lower Jaw Width at MPE Head Width at MPE Head Length to Aft-End of Suture of Parietal Scales Head Height at Widest Width of Head Mouth Plane to Lowest Part of Eye Orbit Eye Height Eye Width Length of Suture Between Parietal Scales Width Between Deepest Points of Aft-Parietal Scales (used as a proxy for the character ―Occipital Scale Shape‖) Width Across Parietal Scales Between Temporal Scales Length of Suture Between Parietal Scale and Supraocular Scale Width Across Parietal Scales Between Supraocular Scales Width Across Frontal Scale Between Parietal Scales Length of Suture Between Frontal Scale and Parietal Scale Frontal Scale Length Frontal Scale Width at MPE Width Across Frontal Scale Between Prefrontal Scales Length of Suture Between Frontal Scale and Supraocular Scale Length of Suture Between Frontal Scale and Prefrontal Scale Distance Between Frontal Scale and Rostral Scale (FRD) Width Between Junction Between Supraocular Scale, Prefrontal Scale, and Preocular Scale and Edge of Head Length of Suture Between Supraocular Scale and Prefrontal Scale Width Between Junctions of Supraocular Scales and Preocular Scales Width Between Junctions of Preocular Scales and Prefrontal Scales Width Between Junctions of Preocular Scales, Nasal Scales, Prefrontal Scales, and Internasal Scales Length of Suture Between Prefrontal Scales Internasal Scales-Prefrontal Scales Width (used as the width for both Internasal and Prefrontal Scales) Length of Suture Between Prefrontal Scale and Internasal Scale

Measurement Type Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous


305

ID

Measurement

114 117 118 119 120 121

Length of Suture Between Internasal Scales Length of Suture Between Internasal Scale and Rostral Scale Rostral Scale Width at Bottom of First Supralabial Scales Rostral Scale Width at Nasal Scale Bottom Rostral Scale Width at Nasal Scale Top Rostral Scale Height (curved) Length of Suture Between Preocular Scale and Third Supralabial Scale Length of Suture Between Preocular Scale and Second Supralabial Scale Distance from Eye to Nasal Scale Internarial Width Nasal Scale Width Fore-Nasal Scale Height Aft-Nasal Scale Height Length of Supraocular Scale ‗Overlapped‘ by Parietal Scale Distance from Junction of Supraocular Scale, Frontal Scale, and Prefrontal Scale to Aft-End of Rostral Scale As with 131, Distance Across Prefrontal Scale Only Distance from Junction of Supraocular Scale, Frontal Scale, and Prefrontal Scale to Top, Fore-End of Nasal Scale As with 133, Distance Across Prefrontal Scale Only Distance from Eye to Nare Length of Suture Between Parietal Scale and Lower Postocular Scale Length of Suture Between Temporal Scale and Lower Postocular Scale Length of Suture Between Rostral Scale and First Supralabial Scale Upper Postocular Scale Aft-Height Lower Postocular Scale Aft-Height Upper Postocular Scale Diagonal Length Lower Postocular Scale Diagonal Length Length of Suture Between Nasal Scale and Preocular Scale Tail Tip Length Preocular Scale Height Gape Width Rostral Scale Length from Bottom Junction with First Supralabial Scale to End of Snout Distance from Eye to End of Snout Supraocular Scale Length (average) Aft-Supraocular Scales Width (average)

123 124 125 126 127 128 129 130 131 132 133 134 136 138 139 143 144 145 146 147 148 149 151 153 155 156 203 204

Measurement Type Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous


306

ID

Measurement

228 229 230 231 232 233 234 235 236 237

Third Infralabial Scale Width Along Mouth Plane First Supralabial Scale Width Along Mouth Plane Second Supralabial Scale Width Along Mouth Plane Third Supralabial Scale Width Along Mouth Plane Fourth Supralabial Scale Width Along Mouth Plane Fifth Supralabial Scale Width Along Mouth Plane Primary Temporal Scale Width Length of Suture Between Upper and Lower Postocular Scales Iris Width at Mid-point of Circularity Parietal Scales Length (average) Eye to Ventral Junction of Nasal Scales and Rostral Scale (average) Distance from Junction of Internasal Scales, Prefrontal Scales, and Nasal Scale to End of Snout (average) Distance from Junction of Nasal Scales, First Supralabial Scales, and Second Supralabial Scales to End of Snout (average) Total Length, calculated using {1 + 12} Distance from Aft-End of Frontal Scale to Aft-End of Rostral Scale Distance, calculated using {100 + 105} Width of Fore-Supraocular Scale, calculated using {(108 - 102) / 2} Prefrontal Scale Size, calculated using {112 * 134} Internasal Scale Size, calculated using {114 * ( 133 - 134)} Length of Rostral Scale from Dorsal Perspective, calculated using {|121 - 155|} Width of First Two Supralabial Scales Along Mouth Plane, calculated using {229 + 230} Width of First Two Infralabial Scales Along Mouth Plane, calculated using {58 + 57} Difference in Lengths of Upper and Lower Jaws, calculated using {71 - 72} Width of Sixth Supralabial Scale Along Mouth Plane Width of Supraocular Scale at MPE, calculated using {(81 - 101) / 2} Distance from Fore-End of Frontal Scale to End of Snout, calculated using {82 - 89 - 100} Eye Size, calculated using {85 * 86} Sixth Infralabial Scale Size Seventh Infralabial Scale Size Neck Width Formula: 234 / 235 Formula: 69 / 200 Formula: 105 / 89

255 258 259 293 316 324 326 329 331 341 351 356 357 361 362 365 374 375 378 238 239 240

Measurement Type Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Continuous Ratio Ratio Ratio


ID 241 250 277 278 279 294 297 298 299 300 301 302 306 307 308 309 310 311 312 313 314 315 317 318 319 320 321 322 323 325 327 328 330 332 333 334 335 336 337 338 339 340

307

Measurement Formula: 98 / 204 Formula: 125 / 110 Percentage of Frontal Scale Darkened Percentage of Parietal Scales Darkened Total Percentage of Frontal and Parietal Scales Darkened Formula: 1 / 12 Formula: (112 * 134) / (114 * (133 - 134)) Formula: |(121 - 155)| / 105 Formula: |(121 - 155)| / 120 Formula: (229 + 230) / (58 + 57) Formula: 356 / 156 Formula: 361 / 112 Formula: 1 / (1 + 12) Formula: 96 / 99 Formula: 100 / (82 - 89 - 100) Formula: 100 / 102 Formula: 100 / 105 Formula: 100 / 111 Formula: 100 / 203 Formula: 100 / 237 Formula: 100 / 89 Formula: 100 / 98 Formula: 101 / 361 Formula: 102 / 101 Formula: 102 / 103 Formula: 102 / 89 Formula: 102 / 98 Formula: 103 / 99 Formula: 324 / 204 Formula: 112 / 111 Formula: 114 / 111 Formula: 114 / 112 Formula: 120 / 105 Formula: 127 / 114 Formula: 128 / (255 - 136) Formula: 128 / 129 Formula: 147 / 144 Formula: 147 / 235 Formula: 151 / 63 Formula: 203 / (100 + 111) Formula: 203 / 361 Formula: 203 / 111

Measurement Type Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio


308

ID

Measurement

342 343 344 345 346 347 349 350 352 353 354 355 358 359 360 363 364 366 367 368 369 370 371 376 379 380

Formula: 230 / 231 Formula: 236 / 86 Formula: 237 / (100 + 105) Formula: 237 / (100 + 111) Formula: 237 / 89 Formula: 237 / 95 Formula: 57 / 228 Formula: 57 / 58 Formula: 60 / (64 + 67) Formula: 60 / 64 Formula: 61 / 65 Formula: 65 / 68 Formula: 357 / (232 + 233) Formula: 81 / (100 + 105) Formula: 81 / 105 Formula: 85 / 84 Formula: 85 / 86 Formula: 86 / 136 Formula: 86 / 156 Formula: 86 / 71 Formula: 86 / 84 Formula: 89 / (96 + 144) Formula: 108 / 110 Formula: 375 / 374 Formula: (max of 77 and 78) / 378 Formula: 67 / 64 Angle Between Central Meeting Point and Fore-End of Pregenial Scales Angle Between Central Meeting Point and Aft-End of Postgenial Scales Head Angle Regardless of Where Head Slopes Aft-Angle of Frontal Scale Angle Between Central Meeting Point and Deepest Points of Aft-Parietal Scales Angle Between Central Meeting Point and First Two Straight Edges of Parietal Scales Aft-angle of Rostral Scale Fore-angle of Frontal Scale Gape Angle Perpendicular to Ventral Perspective Angle Between Sutures of Nasal Scales with First Supralabial Scales and Sutures of First Supralabial Scales with Second Supralabial Scales (average)

62 69 87 90 91 92 122 154 200 254

Measurement Type Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Ratio Angle Angle Angle Angle Angle Angle Angle Angle Angle Angle


ID 256 2 3 5 6 13 17 18 19 20 25 26 27 28 29 30 31 32 33 34 116 205 215 216 217 221 222 223 243 260 261 262 263 264 265 266 267

309

Measurement Angle Between Sutures of Internasal Scales with Nasal Scales and Sutures of Internasal Scales with Prefrontal Scales (average) Number of Subcaudal Scales Number of Iffy Subcaudal Scales (scales that do not cross or touch in middle; average) Number of Single Subcaudal Scales Placement of Single Subcaudal Scales (median) Number of Ventral Scales Number of Completely Dark Ventral Scales Number of Mixed Dark Ventral Scales Number of Ventral Scales at End of Supralabials Number of Ventral Scales at End of Jaw Number of Wide Body Bands Width of Wide Bands (average) Number of Narrow Body Bands Number of Narrow Body Bands Between Wide Body Bands (average) Width of Narrow Bands (average) Number of Dorsal Scale Rows Behind Parietal Scales Number of Dorsal Scale Rows One Head Length Behind Parietal Scales Number of Dorsal Scale Rows at Mid-body Number of Dorsal Scale Rows One Head Length Before Vent Number of Dorsal Scale Rows Before Vent Number of Internasal Scales Tallest Supralabial Scale (average) Narrowest Supralabial Scale Along Mouth Plane (average) Number of Supralabial Scales Touching Eye (average) Number of Supralabials in Contact with Nasal (average) Number of Parietal Scales Number of Postgenial Scales Number of Pregenial Scales Number of Mini-ventral Scales Number of Infralabial Scales (average) Number of Supralabial Scales (average) Number of Preocular Scales (average) Number of Postocular Scales (average) Number of Scales Around Eye (average) Largest Supralabial Scale (average) Number of Overall Largest Infralabial Scale (average) Number of Infralabial Scales in Contact with Genial Scales (average)

Measurement Type Angle Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic


310

ID

Measurement

268 269 273 274 275 276 283 284 285 286 296

Number of Infralabial Scales Under Supralabial Scales (average) Number of Gular Scales Number of Primary Temporal Scales (average) Number of Secondary Temporal Scales (average) Number of Tertiary Temporal Scales (average) Number of Quaternary Temporal Scales (average) Number of Divided Ventral Scales Where are Divided Ventral Scales? (median) Number of Half or Symmetrical Subcaudal Scales Where are Half or Symmetrical Subcaudal Scales? (median) Widest Supralabial Scale Along Mouth Plane (average) Number of Vertebral Scales One Head Length Past Parietal Scales (used as a proxy for the characters ―Vertebral Scale Count Along Snout-Vent Length‖ and ―Vertebral Scale Count Along Total Body Length‖) Paired or Single Anal Scale? – Single (1) or paired (2). Is Body Banded? – The dorsal and lateral areas of the body (from the beginning of the neck through to the beginning of the tail) either have no bands (1) or are banded (2). Is Tail Banded? – The dorsal and lateral areas of the tail either have no bands (1) or are banded (2). Loreal Scale Present? – No (1) or yes (2). Single or Split Nasal? – The nasal scale is either single (1) or divided (2). Smoothness of Dorsal Head Scales – Smooth (1) or rough (2). Presence of Band Across Neck? – No (1) or yes (2). Head Band/Interorbital Colour Stripe? – Indicates the presence of complete or partial darkening of the Frontal, Supraocular, and/or Parietal scales. No (1) or yes (2). Unique Parietal Markings Present? – Are the Parietal scales incompletely developed, possess additional and unconnected sutures, etc.? No (1) or yes (2). Is Any Part of the Eye Visible When Head Viewed Perpendicular to Ventral Perspective? No (1) or yes (2). Is Any Part of the Eye Visible When Head Viewed Perpendicular to Dorsal Perspective? No (1) or yes (2). Glossy Scales Present? – Refers to several darkened, glossy scales typically found in the dorsal nuchal region, often appearing in small clumps. No(1) or yes (2). Head Colour Cap? – Indicates the complete darkening of the head (and typically the neck) as compared to the rest of the body. No (1) or yes (2).

377 7 23 24 41 42 45 52 53

94 196 197 201

210

Measurement Type Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Meristic Binomial Binomial Binomial Binomial Binomial Binomial Binomial Binomial

Binomial Binomial Binomial Binomial

Binomial


ID

311

Measurement

Does a Temporal Scale Wedge Between Supralabial Scales? – 218 The lowest Temporal scale in the first column either rests on top of (1) or wedges between (2) the Supralabial scales. Do Internasal Scales Touch Preocular Scales? – No (1) or yes 219 (2). 220 Subocular Scales Present? – No (1) or yes (2). Does Darker Colouration Continue from Tail Scales onto Sides 270 of Subcaudal Scales? – No (1) or yes (2). Are Edges of (Paired) Subcaudal Scales Darkened Where They 271 Meet? – No (1) or yes (2). Does Darker Colouration Continue from Dorsal Scales onto 272 Sides of Ventral Scales? – No (1) or yes (2). 282 Dark Markings Below or Around Eye? – No (1) or yes (2). 295 Parietal Scales Shaped Like a Star? – No (1) or yes (2). 303 Do Preocular Scales Touch Frontal Scale? – No (1) or yes (2). 304 Do Nasal Scales Touch Preocular Scales? – No (1) or yes (2). Is There a Suture Between Postgenial Scales? (used as a proxy 305 for the character ―Gular Scales Separating Postgenial Scales‖) – No (1) or yes (2). Paired, Single, or Mixed Subcaudal Scales? – Single (1), mixed 4 (2), or paired (3). Colouration of Subcaudal Scales – Arranged in scale from light 8 to dark: cream to pink (1), yellow, orange, or gold (2), beige to tan (3), brown (4), dark brown to black (5), or other (6). Pattern of Subcaudal Scales – Subcaudal scales are either single 9 or paired symmetrically (1), a mixture of single and overlapping pairs (2), or completely overlap in pairs (3). Aft-Fringe Colour of Subcaudal Scales – Light or plain fringe 10 (1), opaque or light and dark fringe (2), or dark fringe (3). Colouration of Ventral Scales – Arranged in scale from light to 14 dark: cream to pink (1), yellow, orange, or gold (2), beige to tan (3), brown (4), dark brown to black (5), or other (6). Pattern of Ventral Scales – Plain (1), mostly plain with some 15 blotches (2), irregular blotches (3), stippled or mixed irregular and parallel blotches (4), or parallel rows of blotches (5). Aft-Fringe Colour of Ventral Scales – Light or plain fringe (1), 16 light and dark fringe (2), or dark fringe (3). General Body Colouration – Arranged in scale from light to 21 dark: cream to pink (1), yellow, orange, or gold (2), beige to tan (3), brown (4), dark brown to black (5), or other (6). 22 General Body Pattern – Plain (1), speckled (2), or banded (3).

Measurement Type Binomial Binomial Binomial Binomial Binomial Binomial Binomial Binomial Binomial Binomial Binomial Categorical Categorical

Categorical Categorical Categorical

Categorical Categorical Categorical Categorical


ID 35 36 37 44 46

51

88

115

137

141

150 152

312

Measurement Colouration of Dorsal Scales – Arranged in scale from light to dark: cream to pink (1), yellow, orange, or gold (2), beige to tan (3), brown (4), dark brown to black (5), or other (6). Pattern of Dorsal Scales – Plain with noticeable trim (1), plain (2), mottled (3) or mottled with noticeable trim (4). Imbrication of Dorsal Scales – Narrow and highly overlapping (1), normal (2), or widely broad and spaced (3). Where Does Rostral End in Relation to the Nares? – Before both (1), even with both (2), past and even (3), past both (4). Buccal Colour – Light or fleshy (1), dingy (2), top and bottom of mouth in complete contrast (3), rear half of top and all of bottom parts of mouth dark (4), or dark (5). Pattern of Third Infralabial Scale – Clear (1), mixed clear and noticeable wee spot (2), noticeable wee spot (3), mixed noticeable wee spot and large spot (4), or large spot (5). Where Does Head Angle When Viewed from Lateral Perspective? – Head is completely flat (0), at rear of eye (1), between rear of eye and eye middle (2), eye middle (3), between eye middle and front of eye (4), at front of eye (5), closer to the eye front than to the beginning of Nasal scale (6), closer to the beginning of the Nasal scale than to the eye front (7), or at beginning of Nasal scale (8). Meeting Pattern of Internasal Scales and Prefrontal Scales from Dorsal Perspective, Facing the Snake – Left slanted (1), closer to left than even (2), closer to even than left (3), even, as with a plus sign (4), closer to even than right (5), closer to right than even (6), or right slanted (7). Pattern of Nasal Division – Nasal scale single (1), division with small projections at top and bottom (2), division with either top (usually) or bottom with larger projection (3), or division with large projections at top and bottom (4). Relative Size of Postocular Scales Compared to Each Other – Snake has only one postocular (1), the lower Postocular scale is larger (2), there is no perceptible difference (3), or the upper Postocular scale is larger (4). Colour of Skin Between Dorsal Scales – White (1), pink (2), grey (3), or dark (4). Tail Tip Colour – Lighter than rest of body (1), same as rest of body (2), or darker than rest of body (3).

Measurement Type Categorical Categorical Categorical Categorical Categorical

Categorical

Categorical

Categorical

Categorical

Categorical

Categorical Categorical


ID

198

199

202 206 207

208

209

212

213

214

313

Measurement Forward Angularity of Sutures Between Rostral Scale and First Supralabial Scales When Viewed Perpendicular to Ventral Perspective – Both pinching inward (1), one inward and the other straight (2), parallel straight (3), one straight and the other opening outward (4), or both opening outward (5). Upward Angularity of Sutures Between Rostral Scale and Nasal Scales When Viewed Perpendicular to Front of Snake – Both pinching inward (1), one inward and the other straight (2), parallel straight (3), one straight and the other opening outward (4), or both opening outward (5). Is Lowest Part of Lower Postocular Scale Below or Above the Lowest Part of Eye Orbit? – Lower (1), even (2), or above (3). Iris Circularity – Iris scored as with a twelve hour mechanical clock. If there was only the slightest bit of iris present (1), ..., half the iris present (6), ..., no gaps in the iris = full circle (12). Pupil Shape – Horizontal ovoid (1), round (2), or vertical ovoid (3). General Pattern of Eye Region When Viewed Perpendicular to Ventral Perspective – Top slanted backward (1), top flat with rest of eye round (2), round (3), bottom slanted as with the Nike® swoosh logo (4), or top and bottom narrowed and angled backward (5). Supralabial Scales Colour Pattern – Lighter than rest of head scales (1), final ~two scales lighter (2), same (3), or darker (4). Snout and Head Shape – Appearance is rectangular and straight along most of head and snout (1), entire head and snout narrows towards the front end of snake (2), or lateral sides of head are straight and then narrow at the snout (3). What Part of Fore-Frontal Scale Does Line Drawn Between Furthest-Forward Points of Supraocular Scales Intersect? – Aft of the ‗base‘ = meeting points of Frontal scale, Supraocular scales, and Prefrontal scales (1), even with base (2), nearer to base than middle (3), middle (4), nearer to fore-end of Frontal scale than middle (5), even with forward end of Frontal scale (6), or forward of Frontal scale (7). What Part of Aft-Frontal Scale Does Line Drawn Between Furthest-Rear Points of Supraocular Scales Intersect? – Forward of the ‗base‘ = meeting points of Frontal scale, Supraocular scales, and Parietal scales (1), even with base (2), nearer to base than middle (3), middle (4), nearer to aft-end of Frontal scale than middle (5), even with aft end of Frontal scale (6), or rear of Frontal scale (7).

Measurement Type

Categorical

Categorical

Categorical Categorical Categorical

Categorical

Categorical

Categorical

Categorical

Categorical


ID

314

Measurement

On Which Side of Body Are Mini-ventral Scales Located? – No 244 mini-ventral scales (0), left (1), both sides or in the middle (2), or right (3). Is There a Visible Vertebral Stripe? – No (1), there may have 251 been (2), or yes (3). Junction of Internasal Scales, Prefrontal Scales, and Nasal Scales Meeting Point (Top) vs. Junction of Nasal Scales, First Supralabial Scales, and Second Supralabial Scales (Bottom): 257 Which Is Forward and What Is Magnitude (average)? – Bottom greatly forward (1), bottom medium (2), bottom little (3), bottom barely (4), even (5), top barely(6), top little (7), top medium (8), or top greatly forward. Directionality of Sutures Between Internasal Scales and Prefrontal Scales Outward from Meeting Point – Toward the 280 front of the snake (1), laterally outward (2), or toward the rear of the snake (3). Pattern of Sutures Between Internasal Scales and Prefrontal 281 Scales – Straight (1), one straight and one curved or both with slight curvature (2), or large curvature (3). Which Side Are Half or Symmetrical Subcaudal Scales On? – 287 No half or symmetrical subcaudal scales (0), on left (1), on both sides or in middle (2), or on right (3). Combined Pattern of Rostral Scale Sutures (see Characters 198 and 199) – In with anything else (1), opening outward then 288 pinching inward (2), opening outward then straight (3), completely opening outward (4), straight then opening outward (5), both straight (6), or straight then pinching inward (7). Position of Final Dorsal Scale (in Relation to and In-line with 289 Other Dorsal Scales) by Anal Scale – Normally aligned (1), one normal and one below (2), or noticeably below other scales (3). Size of Final Dorsal Scale by Anal – Noticeably smaller than 290 nearby scales (1), normal size or one smaller and one larger (2), or noticeably larger than nearby scales (3). Relative Size of Egress of Dorsal Scales Between Parietal Scales 291 – Nearly none (1), fairly little (2), some (3), or a fair amount (4). Ending Shape of Parietal Scales – Fairly round (1), slightly 292 round or chunky (2), or fairly chunky (3). Band Type – No bands (1), little bands only (2), both big and 348 little bands (3), or big bands only (4).

Measurement Type Categorical Categorical

Categorical

Categorical

Categorical

Categorical

Categorical

Categorical

Categorical Categorical Categorical Categorical

Appendix V. Head scale names and the locations of head scales, continuous measurements, and angular measurements used during this study. Head measurements are presented following a legend of scale names. Numbers refer to the measurement identification numbers listed in Appendix IV. Body and tail scales can be seen in Chapter 2, Figures 2.7 and 2.8.

Colour Black Blue-Grey

Top Primary Temporal Secondary Temporals

Brown

Rostral

Dark Green

Frontal

Perspective Bottom Side Front Primary Primary – Temporal Temporal Secondary – – Temporals Rostral (top); Rostral (top); Rostral (top); Mental (bottom) Mental (bottom) Mental (bottom) Frontal (top); Gulars Frontal Gulars (bottom)

Light Green Orange

Number of Dorsals immediately behind Parietals Supralabials (top); Infralabials (bottom) Parietals Supraoculars

Supralabials (top); Infralabials (bottom) Ventrals –

Pink

Internasals

Pregenials

Purple

Preoculars (fore); Upper and Lower Postoculars (aft)

–

Red

Prefrontals

Postgenials

Non-measured scales Nasals (fore); Eyes (aft)

Non-measured scales Nasals (fore); Eyes (aft)

Grey

Light Blue

White Yellow

–

–

–

Supralabials Supralabials (top); (top); Infralabials Infralabials (bottom) (bottom) Parietals – Supraoculars Supraoculars Internasals Internasals (top); Pregenials (top); Pregenials (bottom) (bottom) Preoculars Preoculars (fore); Upper (fore); Upper and Lower and Lower Postoculars (aft) Postoculars (aft) Prefrontals Prefrontals (top); (top); Postgenials Postgenials (bottom) (bottom) Non-measured Non-measured scales scales Nasals (fore); Nasals (fore); Eyes (aft) Eyes (aft)

Appendix V: Morphological Characters

316


317


318


319


320


321

Appendix VI. Summary of published information for all DNA extraction protocols (and modifications) examined or discussed in Chapter 3.

Protocol – 1 Citation – Frank et al. 1996 Modification of...? – N/A Kit Used? – N/A DNA Extraction Time (days) – 1 Size of Starting Tissue – 5 μm-thick slice Tissue Taxa and Type – Human lymph node Fixation and Storage Length – Overnight; Not mentioned Successful PCR Length (base pairs) – 255 Day 1 – Place tissue in 500 μL deionised, distilled, autoclaved water within microcentrifuge tube. Heat in boiling water bath for 8 minutes. Proceed with PCR. Days 2–7 – N/A Protocol – 2a Citation – Shi et al. 2002 Modification of...? – N/A Kit Used? – N/A DNA Extraction Time (days) – 2 Size of Starting Tissue – 20 μm-thick slice Tissue Taxa and Type – Human tonsil, lymph node, and colon Fixation and Storage Length – 24 hours; Not mentioned, but samples collected 2–11 years before publication Successful PCR Length (base pairs) – 90, 168, and 368 Day 1 – Make buffer (28.6 mM of each chemical: citrate acid, KH2PO4, H3BO3, and diethylbarbituric acid. Add 0.2 N sodium hydroxide to reach pH of 8, 9 [best], or 10). Put tissue in tube with 500 μL buffer. Heat to 80–120° C (higher is better) for 20 minutes in autoclave + cool-down for 5 minutes. One standard phenol-chloroform-isopropanol

Appendix VI: Extraction Protocols

323

extraction. One standard chloroform extraction. Add 0.1x volume of 3 M sodium acetate, vortex, and add 1x volume of isopropanol. Incubate at -20° C overnight. Day 2 – Centrifuge at 12,000 g at 4° C. Discard fluid and wash once with 75% EtOH. Centrifuge at 12,000 g at 4° C. Dry in hood. Dissolve pellet in 50 μL deionised water. Proceed with PCR. Days 3–7 – N/A Protocol – 2b As above, except: Day 1 – Trialled in heat block instead of autoclave. Protocol – 3a Citation – Shi et al. 2004 Modification of...? – Shi et al. 2002 Kit Used? – N/A DNA Extraction Time (days) – 1 Size of Starting Tissue – Two 10 μm-thick slices Tissue Taxa and Type – Human lymph node, colon, small intestine, breast cancer tumour, and bladder cancer tumour Fixation and Storage Length – 24 hours; 3–12 years Successful PCR Length (base pairs) – 152, 347, and 541 Day 1 – Heat (80–120° C [higher is better]) tissue sections in 500 μL alkaline solution (preferably 0.1 M NaOH) for 20 minutes in autoclave. Cool down for 15 minutes. Proceed with PCR. Days 2–7 – N/A Protocol – 3b As above, except: Day 1 – Trialled in heat block instead of autoclave.


324

Protocol – 4a Citation – Shi et al. 2004 Modification of...? – Shi et al. 2002 Kit Used? – N/A DNA Extraction Time (days) – 2 Size of Starting Tissue – Two 10 μm-thick slices Tissue Taxa and Type – Human lymph node, colon, small intestine, breast cancer tumour, and bladder cancer tumour Fixation and Storage Length – 24 hours; 3–12 years Successful PCR Length (base pairs) – 152, 347, and 541 Day 1 – Add 500 μL 0.1 M NaOH (pH ~13). Heat to 80–120° C (higher is better) for 20 minutes in autoclave. Cool down for 5 minutes. Add 500 μL 25:24:1 phenol:chloroform:isopropanol alcohol. Mix by vortex. Centrifuge at room temp for 10 minutes at 12,000 rpm. Move supernatant to new tube. Add 0.1x volume 3 M sodium acetate. Mix by vortex. Add 1x volume isopropanol. Incubate at -20° C overnight. Day 2 – Centrifuge at 4° C at 12,000 rpm. Discard supernatant. Wash pellet with 75% EtOH. Dry in fume hood. Dissolve pellet in 50 μL distilled water. Proceed with PCR. Days 3–7 – N/A Protocol – 4b As above, except: Day 1 – Trialled in heat block instead of autoclave. Protocol – 5a Citation – Hyde and Vetter 2007 Modification of...? – Shi et al. 2002 Kit Used? – QIAamp DNA extraction kit (Qiagen) DNA Extraction Time (days) – 2 Size of Starting Tissue – ~100 mg Tissue Taxa and Type – Fish white muscle or pectoral fin Fixation and Storage Length – Not mentioned; Not mentioned


325

Successful PCR Length (base pairs) – 200–300 Day 1 – Soak tissue overnight in 95% EtOH. Day 2 – Same as Day 1 of Shi et al. 2002 (Protocol 2a) except: 180 μL extraction buffer, and after cooling from autoclave, add 1.5 μL of 5.2 pH 3 M sodium acetate. Then follow QIAamp DNA extraction kit (Qiagen) instructions except: after Pro-K digestion, add 1 μL of carrier RNA (1 μg/μL) and 0.5 μL of 3 M sodium acetate (pH 5.2). Days 3–7 – N/A Protocol – 6 Citation – Cawkwell and Quirke 2000 Modification of...? – N/A Kit Used? – N/A DNA Extraction Time (days) – 1 Size of Starting Tissue – 4 μm-thick slice Tissue Taxa and Type – Human tumour Fixation and Storage Length – Not mentioned; Not mentioned Successful PCR Length (base pairs) – Up to 250 Day 1 – Heat tissue to 65° C for 30 minutes. Graded EtOH series of tissue washes (started from 70% and continued to 100%). Rinse with sterile deionised water. Air dry. Place in 0.2 mL tube + add 20 μL sterile deionised water. Agitate tissue with pipette tip in water. Proceed with PCR. Days 2–7 – N/A Protocol – 7 Citation – Fang et al. 2002 Modification of...? – N/A Kit Used? – N/A DNA Extraction Time (days) – 2 Size of Starting Tissue – 0.5 g Tissue Taxa and Type – Fish liver, frog muscle, snake muscle, bird liver, rat liver, panda liver, and human kidney and liver


326

Fixation and Storage Length – Not mentioned; 16–70 years Successful PCR Length (base pairs) – 403, 1198, and 1844 Day 1 – Divide tissue into smaller portions. Soak in 500 μL 30% EtOH 20 minutes, then centrifuge 10 minutes at 3,000 g. Repeat at 10% graded EtOH intervals until 100% reached/finished. Transfer sediments to isoamyl acetate and soak overnight. Day 2 – Centrifuge at 3,000 g and remove liquid. Put sediments in filter paper and place in critical point drying device. Add liquid carbon dioxide to chamber until paper immersed completely. Dry at 31° C for two hours. Release fixation chemicals and EtOH by gas valve. Extract DNA as with fresh samples (Protocol 37). Proceed with PCR. Days 3–7 – N/A Protocol – 8 As above, except: Day 1 – Started graded EtOH series at 70%. Protocol – 9 Citation – Bhadury et al. 2005 Modification of...? – Floyd et al. 2002 Kit Used? – N/A DNA Extraction Time (days) – 3 Size of Starting Tissue – 1 specimen Tissue Taxa and Type – Nematodes Fixation and Storage Length – Overnight; 2 days–1 month Successful PCR Length (base pairs) – ~400 Day 1 – Place tissue in 0.5 mL tube. Add 20 μL 0.25 M NaOH. Freeze overnight (8–9 hours) at -20° C. Day 2 – Incubate overnight at 60° C. Day 3 – Heat tubes at 99° C on heating block for 3 minutes. Cool to room temperature. Centrifuge at 16,000 rpm for 30 seconds. Add 4 μL of buffer (1 M HCl, 10 μL of 0.5 M Tris-HCl [pH 8.0], 5 μL of 2% Triton X-100). Mix briefly then microcentrifuge for 30


327

seconds at 16,000 rpm. Heat tubes to 99° C for 3 minutes. Cool to room temperature. Proceed with PCR. Days 4–7 – N/A Protocol – 10 Citation – Chase et al. 1998 Modification of...? – N/A Kit Used? – QIAamp® tissue extraction kit (Qiagen) DNA Extraction Time (days) – 5 Size of Starting Tissue – 1 specimen Tissue Taxa and Type – Molluscs Fixation and Storage Length – Not mentioned; Not mentioned Successful PCR Length (base pairs) – 196, 199, and 330 Day 1 – Add tissue to microcentrifuge tube. Add 200 μL of ATL buffer from QIAamp® tissue extraction kit (Qiagen). Incubate for 24 hours at 55° C. Day 2 – Add 5 μL of 50 mg/mL Pro-K and 95 μL of ATL buffer. Incubate at 55° C for 72 hours. Day 3 – Incubating at 55° C. Day 4 – Incubating at 55° C. Day 5 – QIAamp® tissue extraction kit instructions (except increase buffer and EtOH volume to 300 μL from 200 μL). Elute DNA with 200 μL of 10 mM Tris-HCl (pH 8.0). Proceed with PCR. Days 6–7 – N/A Protocol – 11 Citation – Coombs et al. 1999 Modification of...? – N/A Kit Used? – QIAamp® DNA mini kit (Qiagen) DNA Extraction Time (days) – 1 Size of Starting Tissue – 20 μm section Tissue Taxa and Type – Human colonic tumour


328

Fixation and Storage Length – 24–48 hours; 1–30 years Successful PCR Length (base pairs) – Not mentioned Day 1 – Follow directions as per QIAamp® DNA minikit (Qiagen). Days 2–7 – N/A Protocol – 12 Citation – Iudica et al. 2001 Modification of...? – N/A Kit Used? – DNeasy® tissue extraction kit (Qiagen) DNA Extraction Time (days) – 4 Size of Starting Tissue – 3 mm x 2 mm; bone: 1–2 pieces, 2–9 mm Tissue Taxa and Type – Bat liver, skin, hair, ribs, and wing bones Fixation and Storage Length – Not mentioned; Not all samples detailed: 8, 19, and 66 years listed as having been successful Successful PCR Length (base pairs) – ~200 Day 1 – Cut tissue into 0.5 mm3 bits and put in tubes. Wash 3–5 times in 250 μL PBS buffer for 10 minutes at 55° C with occasional vortex mixing. Spin briefly and toss liquid. Add 180 μL buffer ATL (DNeasy® tissue extraction kit) + 20 μL Pro-K (20 mg/mL). Incubate at 55° C with gentle mixing. Add 20 μL Pro-K every 12 hours until no sediments are visible. Day 2 – Incubate at 55° C with gentle mixing. Add 20 μL Pro-K every 12 hours until no sediments are visible. Day 3 – Incubate at 55° C with gentle mixing. Add 20 μL Pro-K every 12 hours until no sediments are visible. Day 4 – Add 200 μL buffer AL. Vortex mix. Incubate at 70° C for 10 minutes. Add 200 μL 100% EtOH. Vortex mix. Adjust pH to 6.5–7.0 with 0.25 M HCl. Pass through Qiagen column. Wash column with 500 μL AW1 buffer, 500 μL AW2 buffer, and spin dry. Elute DNA twice from column in 40–50 μL AE buffer (10 mM Tris [pH 8.0]). Incubate column and buffer for 5 minutes at 65° C. Centrifuge. Proceed with PCR. Days 5–7 – N/A


329

Protocol – 13 Citation – Legrand et al. 2002 Modification of...? – N/A Kit Used? – QIAamp® tissue extraction kit (Qiagen) DNA Extraction Time (days) – 1 Size of Starting Tissue – Two 8 μm sections Tissue Taxa and Type – Human lymph node, brain, kidney, stomach, pancreas, spleen, small bowel, duodenum, skin, tongue, salivary gland, parotid gland, and sublingual gland Fixation and Storage Length – Original fixation length not mentioned, subsequent fixation length 3–32 days; Original storage length 15 years, subsequent storage length not mentioned Successful PCR Length (base pairs) – 103–250 Day 1 – Add tissue to microtube. Follow directions as per QIAamp® tissue kit (Qiagen) Days 2–7 – N/A Protocol – 14 Citation – Wu et al. 2002 Modification of...? – N/A Kit Used? – QIAamp® DNA mini kit (Qiagen) DNA Extraction Time (days) – 1 Size of Starting Tissue – 10 or 20 μm-thick slices Tissue Taxa and Type – Human thyroid, breast, colon, kidney, spleen, tonsil, pancreas, lung, jejunum, ileum, liver, and ovary Fixation and Storage Length – Not mentioned; 1–8 years Successful PCR Length (base pairs) – 90 and 368 Day 1 – QIAamp® kit (Qiagen) instructions, with the following modifications: 1) no separate paraffin removal step, 2) kit lysis buffer was added directly to tissues in microcentrifuge tubes, and 3) tissue in lysis buffer was heated to 98° C for 15 minutes before the addition of Pro-K. Days 2–7 – N/A


330

Protocol – 15bl Citation – Coura et al. 2005 Modification of...? – N/A Kit Used? – UltraClean BloodSpin® kit (MoBio Laboratories) DNA Extraction Time (days) – 2 Size of Starting Tissue – 20 μm-thick slice Tissue Taxa and Type – Human rectal carcinoma Fixation and Storage Length – 24 hours; 8–16 years Successful PCR Length (base pairs) – 121, 123, 162, and 227 Day 1 – Rehydrate tissue with 1x volume Tris-EDTA for 5 minutes at 55° C. Add 1 M Tris (pH 7.5) and incubate overnight at 55° C. Day 2 – Digest with Pro-K (20 mg/mL) for 1–3 hours. Extract with UltraClean BloodSpin® kit (MoBio Laboratories). Resuspend in 200 μL Tris-EDTA. Proceed with PCR. Days 3–7 – N/A Protocol – 15t Citation – N/A Modification of...? – Coura et al. 2005 Kit Used? – UltraClean Tissue® DNA isolation kit DNA Extraction Time (days) – 2 Size of Starting Tissue – N/A Tissue Taxa and Type – N/A Fixation and Storage Length – N/A Successful PCR Length (base pairs) – N/A Day 1 – As above Day 2 – As above, except trialled UltraClean Tissue® DNA isolation kit (MoBio Laboratories). Days 3–7 – N/A


331

Protocol – 16 Citation – Lahnsteiner and Jaysch 2005 Modification of...? – Masuda et al. 1999 Kit Used? – NucleoSpin® tissue kit (Macherey-Nagel) DNA Extraction Time (days) – 1 Size of Starting Tissue – Unspecified, but presumed to be 20–30 mg based on instructions for FT extractions Tissue Taxa and Type – Fish gills Fixation and Storage Length – Not mentioned; Samples collected 3–106 years before publication Successful PCR Length (base pairs) – 2000–2500 Day 1 – Protein digestion presumably as per Masuda et al. 1999: homogenise tissue in 1.0 mL digestion buffer (200 mM Tris-HCl, 200 mM NaCL, 1.5 mM MgCl2, 2% SDS, pH 7.5) with 500 μg Pro-K and incubate for 1 hour at 45° C. Incubate extractions for 4 hours at 70° C. NucleoSpin® Ready Kit. Proceed with PCR. Days 2–7 – N/A Protocol – 17q Citation – Austin and Melville 2006 Modification of...? – N/A Kit Used? – DNeasy® tissue extraction kit (Qiagen) DNA Extraction Time (days) – 2 Size of Starting Tissue – Unspecified Tissue Taxa and Type – Lizard leg muscle, liver, and toe clip Fixation and Storage Length – Not mentioned; Samples collected 8–112 years before publication Successful PCR Length (base pairs) – 89–136 Day 1 – Wash tissue in 1 mL of 10 mM Tris-HCl (pH 8.0) on a rotary mixer for 24 hours. Day 2 – Qiagen DNeasy® extraction kit instructions. Proceed with PCR. Days 3–7 – N/A


332

Protocol – 17l Citation – Austin and Melville 2006 Modification of...? – N/A Kit Used? – DNeasy® tissue extraction kit (Qiagen) DNA Extraction Time (days) – 4 Size of Starting Tissue – Unspecified Tissue Taxa and Type – Lizard leg muscle, liver, and toe clip Fixation and Storage Length – Not mentioned; Samples collected 8–112 years before publication Successful PCR Length (base pairs) – 89–136 Day 1 – Wash tissue in 1 mL of 10 mM Tris-HCl (pH 8.0) on a rotary mixer for 24 hours. Day 2 – Wash tissue in 1 mL of 10 mM Tris-HCl (pH 8.0) on a rotary mixer for 24 hours. Days 3 – Wash tissue in 1 mL of 10 mM Tris-HCl (pH 8.0) on a rotary mixer for 24 hours. Days 4 – Follow instructions of Qiagen DNeasy® extraction kit. Proceed with PCR. Days 5–7 – N/A Protocol – 18 Citation – Sato et al. 2001 Modification of...? – Banerjee et al. 1995 Kit Used? – N/A DNA Extraction Time (days) – 2 Size of Starting Tissue – Three 5 mm x 6 mm x 10 μm slices Tissue Taxa and Type – Human B-cell lymphoma and gastric carcinoma Fixation and Storage Length – Overnight; Up to 6 years Successful PCR Length (base pairs) – Overnight; Up to 6 years Day 1 – Crush tissue with pipette tips in 200 μL digestion buffer (50 mM/L Tris-HCl, pH 8.0, 1 mM/L EDTA, and 0.5% Tween 20). Seal tube and put pinhole through top. Microwave 15 seconds four times (cool down in between so tubes do not over-boil). Centrifuge 12,000 g for 10 minutes. Add another 200 μL of buffer + 2 μL of 10 mg/mL Pro-K. Incubate at 48° C overnight.


333

Day 2 – Centrifuge 3,000 g for 5 minutes. Put supernatant in new 1.5 mL microcentrifuge tube. Boil sample for 10 minutes. Proceed with PCR. Days 3–7 – N/A Protocol – 19 Citation – Schander and Halanych 2003 Modification of...? – Savioz et al. 1997 and Schizas et al. 1997 Kit Used? – N/A DNA Extraction Time (days) – 4 Size of Starting Tissue – 3–78 mg Tissue Taxa and Type – Molluscs or crustaceans Fixation and Storage Length – Not mentioned; Samples not detailed: 30 years listed as having been successful Successful PCR Length (base pairs) – 450, 600, and 1000 Day 1 – Cut tissue into