Sequence-specific Pausing during in Vitro DNA Replication on Double ...

THEJOURNALOF BIOLOGICAL CHEMISTRY 0 1989 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 264, No. 28, Issue of October 5, pp. 16880-16886, 1989 Printed in U.S.A.

Sequence-specific Pausing during in VitroDNA Replication on Double-stranded DNA Templates* (Received for publication, July 16, 1989)

Patricia BedingerS, Maureen Munng, and Bruce M. Alberts From the Department of Biochemistry and Biophysics, university of California, Sun Francisco, California 94143-0448

Sequence-specific pausing occurs during DNA syn- we have investigated this process in the well-characterized thesis catalyzed by the bacteriophage T4 DNA polym- bacteriophage T4 in vitro DNA replication system, using a erase holoenzyme in the presence of the T4 helix de- double-stranded DNA template of known nucleotide sestabilizing protein (gene 32 protein). Two of the six quence. The complete T4 replication system, consisting of strongest pause sites on a double-stranded bacterio- seven highly purified proteins, closely mimics in vivo repliphage fd DNA template are in regions where hairpin cation in terms of substrate utilization (Nossal and Peterlin, helices are predicted to form when the DNA is single 1979; Sinha et al., 1980), fidelity (Hibner and Alberts, 1980; stranded. However, the other pause sites are in regionsSinha and Haimes, 1980), RNA primer synthesis (Liu and that are not obviously involved in secondary structure. Alberts, 1980; Nossal, 1980) and rate of fork movement (AlThe positions of the DNA chain ends produced at one pause site of each type were determined to within 22 berts e t al., 1980). In thisreport we have examined the pausing nucleotides. At this resolution, a clustering of sites is of various sub-complexes of this multienzyme complex at observed, suggesting that the polymerase holoenzyme specific DNA sequences in reactions that model fork movemay become destabilized when moving along selected ment. regions of the DNA and then pause at one or more of MATERIALS AND METHODS several closely spaced positions. The addition of the T4 gene 4 1 protein (a DNA Enzymes-Bacteriophage fd gene 2 protein was either the generous helicase that forms part of the T4 primosome) to the gift of T. Meyer and K. Geider, purified as described (Meyer and above replication system greatly increases the rate of Geider, 1979), or apreparation made in this laboratory using a fork movement and eliminates detectable pausing. In modification of their protocol.’ The T4 DNA replication proteins contrast, the addition of the T4 dda protein (a second corresponding to genes 32, 44/62, 45, 41, and 43 were purified using procedures (Bittner etal., 1979; Morris et al., 1979a, 197913). DNA helicase that increases the rate of fork movement published The T4 dda protein (DNA-dependent ATPase) was purified in this to a similar extent) has no affect on replication fork laboratory by C. Victor Jongeneel (Jongeneel et al., 1984a). Allof pausing. This differencecould either bedue to specific these preparations were free of detectable nuclease contamination protein-protein interactions formed between the po- and nearly homogeneous as judged by a sensitive analysis using SDS2lymerase holoenzyme and the 41 protein orto the polyacrylamide gel electrophoresis (see Morris et aL, 1979a). Restrichighly processive movement of the 4 1 protein along tion enzymes were purchased from New England Biolabs. Template DNAs-Double-stranded supercoiled fd bacteriophage the displaced DNA strand.

Replication terminationcanin principle occur without regard to DNA sequence whenever two replication forks meet (Lai and Nathans, 1975; Valenzuela, Freifelder and Inman, 1976). However, DNA replication is known to terminatenear specific sites where forks pause in Escherichia coli (Kuempel and Duerr, 1979), Bacillus subtilis (Weiss and Wake, 1984), plasmid R6K (Kolter and Helinski, 1978), and plasmid ColEl (Tomizawa, 1978). Some fork pausing at termination sites in vivo is due to the site-specific binding of specific proteins to the DNA (Hill et al., 1988; Hidaka et al., 1988). In order to contribute to anunderstanding of why replication forks stop, * This work was supported by Grant GM 24020 from the National Institute of General Medical Sciences of the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. $. Submitted in partial fulfillment of the requirement for Ph.D. at the University of California, San Francisco. Present address: Dept. ofBiology, University of North Carolina, Chapel Hill, NC275993280. J Submitted in partial fulfillment of the requirement for Ph.D. at the University of California, San Francisco. Present address: Dept. of Therapeutic Radiology, School of Medicine, Yale University, New Haven, CT 06510.

DNA was purified from fd-infected E. coli cells using the method of Clewell(1972). To nick this DNA at one specific site, fdgene 2 protein (4 units) was incubated with 2 pg of the fd DNA in 20 mM Tris-HC1,pH 8.1,50 mM KCl, 2 mM MgC12,2 mM 0-mercaptoethanol, 200 pg/ml human serum albumin, and 5% glycerol for 30 min a t 30 “C.The gene 2 proteinwas then inactivated by heating the reaction mixture to 65 “C for 10 min and the DNA extracted with buffersaturated phenol. Analysis of the products of this reaction by agarose gel electrophoresis showed that more than 80% of the fd DNA was nicked in the reaction. Other singly nicked DNAs were prepared in the same way: the DNAof the cloning vector M13mp9, with and without an insert of the plasmid R6K replication terminator site (Bastia et al., 1981), was kindly supplied by Dr. D. Bastia, while M13mp7DNAwas the gift ofM. Betlach at the University of California, San Francisco, and M13mp8 DNA was purchased from New England Biolabs. All of these DNAs contain the gene 2-nicking site. Replication Reactions-Unless stated otherwise, in vitro DNA replication was carried out in the presence of 33 mM Tris-acetate, pH 7.8, 66 mM potassium acetate, 10 mM magnesium acetate, 2.5 pg/ml DNA, 100 pg/ml human serum albumin, 0.5 mM dithiothreitol, 0.5 mM rATP, 0.1 mM each dATP, dGTP, dCTP, and [L~-~*P]TTP. In standard reactions, the following T4 DNA replication proteins were present at theindicated concentrations: T4 DNA polymerase, 2.5 pg/ ml; T4 gene 44/62 protein, 20 pg/ml; T4 gene 45 protein, 18 pg/ml; T4 gene 32 protein, 80-100 pg/ml (denoted as the core replication system). Where indicated, the reactions contained in addition 6 pg/ ml of the T4gene 41 protein or 3 pg/ml of the T4 dda protein.

16880

J. Barry, unpublished results. The abbreviation used is: SDS, sodium dodecyl sulfate.

Sequence-specific Pausing during

in Vitro DNA Replication

16881

Replication reactions were started synchronously at a specific nick nick is displaced ahead of the growing DNA chain, producing in the fd DNA template, as outlined in Fig. 1. Reaction mixtures a long single-stranded DNA “tail” thatrepresents the normal lacking only replication proteins and dCTP were prepared at 4 “c. lagging strand template. On a circular DNA molecule, the All of the proteins were added and themixture incubated at 37 “cfor length of this tail can greatly exceed the length of the DNA 1 min; dCTP (0.1 mM) WEW then added to allow replication forks to proceed. At various intervals, aliquots were removed from the reaction circle, since replication proceeds in a “rolling circle” mode into tubes containingNa3EDTA and SDS to produce a final concen- that allows many rounds of copying. tration of 20 mM and 0.2%, respectively. Each aliquot was then “spin In the experiments to be described, we have used doubledialyzed” to remove unincorporated dNTPs through Sepharose CLGB stranded circular DNAs nicked at a unique site with purified (PharmaciaLKB Biotechnology Inc.),, as described by Neal and fd gene 2 protein as the template for replication. Previous Florini (1973).To measure the approximate sizes of newly synthesized DNA chains, buffer was added to each aliquot to produce a final work has shown that thistype of DNA is an effective template concentration of 20 mM Na3EDTA, 10% sucrose and 0.1% bromocre- for the T4 in vitro DNA replication system, with replication sol green dye, and the DNA analyzed by electrophoresis through a proceeding in a rolling circle mode (Meyer et al., 1981). In 0.6% agarose gel, using 30 mM NaOH and 2 mM Na3EDTA as the order to synchronize the startson this template, the procedure running buffer. The gels were then dried onto Whatman 3“ filter shown in Fig. 1was adopted. When the lengths of the growing paper and autoradiographed at -70 “C using Kodak XAR2 film with a Du Pont Lightning Plus intensifying screen. The sizes of the DNA strands were measured by alkaline agarose gel electroradioactively labeled DNA strands were determined by comparison phoresis, as shown in Fig. 2, discrete DNA product sizes were with 32P-laheledrestriction fragments of bacteriophage T4 DNA of observed that represent sites where synthesis stopped prefknown size (OFarrell et ai. 1980). erentially. Because the smaller molecules in this setare readily Precise Mapping of Pause Sites-In order to map the pause sites “chased” into molecules of greater lengthat longer incubation more precisely, the products of DNA synthesis were digested with times, the discrete products observed represent replication one of several restriction nucleases that cleave at a single site on the fd genome. The samples ‘were then analyzed by electrophoresis on pause sites, i.e. sequences where the replication fork has been either a1%alkaline agarose gel or on a 6% polyacrylamide sequencing only temporarily arrested. Analysis of the size of the DNA gel (Maxam and Gilbert, 1980). In preparation for alkaline agarose molecules reveals that thereplication fork pauses at thesame gel electrophoresis, replication reactions were stopped with EDTA DNA sequences in each successive round of rolling circle and SDS (as described previously), phenol extracted, and theaqueous replication (Table I, firstcolumn).For example, a strong phase spin-dialyzed into 10 mM Tris-C1, pH 7.6, 0.5 mM Na3EDTA. is located just “up-stream’’ from the gene 2pause site that After addition of appropriate NaCl and MgCl,, the samples were produces a DNA band at about 12,600 nucledigested with restriction nucleases. Samples stopped after 2 min cutting site first incubation were digested with AccI restriction nuclease (at position otides and then, when the replication fork encounters this 6092), while reactions stopped after 10 min were digested with either sequence for the second time, it produces a second band at HpaI or BalI (at positions 6408 and 5083, respectively). After restric- about 18,800 nucleotides (12,600 nucleotides plus the unit tion digestion, SDS and Na3EDTA were added to 0.2% and 20 mM, length of the fd genome). and the samples were spin dialyzed and analyzed by electrophoresis Replication Must be Initiated at a Specific Site in Order to on 1%alkaline agarose gels as described above. The known position of each restriction site allowed the positions of the replication pauses Detect Discrete Pauses-If the replication fork described abto be determined from the size of each radioactively labeled DNA ove is pausing at a restricted set of DNA sequences, rather fragment. Identities were assigned to these pause site positions by than pausing after fixed time intervalsor distances of synthecomparison to the more approximate positions determined without sis, a specific initiation site should be required to detect the nuclease cleavage. The locations of two of the replication pauses were further refined pauses by our methods. As a test, replication was initiated at by electrophoresing the cleaved DNA replication products on a 6% the random nicks that were present at a level of about 10% polyacrylamide DNA sequencing gel. Samples were withdrawn from in our supercoiled fd DNA preparation, rather than at the replication reactions at 2 nlin and cut with AccI, or at 15 min and cut specific gene 2 protein-nicking site. Fig. 3 displays densitomwith BalI. After ethanol precipitationand resuspension in 80% form- eter tracings of autoradiographs that compare the length amide, 100 mM Tris-borate, pH 8.3,2mM Na3EDTA,and 0.1% xylene cyanol, the samples were electrophoresed until the dye had migrated distribution of reaction products of two replication reactions, twice the length of the gel. The gels were then rinsed for 30 min in 10% methanol plus 10% acetic acid, dried, and autoradiographed as Incubate T4 repllcatlon proteins ( I mln ot 37T) above. The sizes of the fragments were determined by comparison to with.all dNTP‘s dideoxy sequencing ladders prepared by DNA synthesis on BamHI except dCTP cleaved pBR322 DNA that was primed with a complementary oligob nucleotide at theHind111 site (Sanger etal., 1977). It is possible with this method to determine the size of fragments up to about 400 fdDNAclrcle nucleotides in length to within two to four nucleotides. Only two of specifically niched nucleotide at 5781 DNA Llmited synthesis the strong pause sites detected by agarose gel electrophoresis could be readily analyzed by this; technique because of the lack of suitably located restriction sites in the other cases. RESULTS

Replication Forks Lacking the Primosome Pause at Specific Sites on a Double-helical DNATemplute-The simplest in vitro DNA replication reactions catalyzed by the T4 replication system on a double-helical template utilize a mixture of the T4 gene 32 protein and the T4DNA polymerase holoenzyme (the gene 43 DNA polymerase plus the gene 45 and 441 62 accessory proteins). Each of these five proteins is required to achieve efficient DNA synthesis staring from a nick on a double-stranded DNA template (Liu et al., 1979; Nossal and Peterlin, 1979; Sinha et al., 1980). After replication begins by the covalent addition of deoxyribonucleotides to the 3’OH end at thenick, the strandcontaining the 5”phosphate at the

Synchronous start of rolllng circle repllcotton

cleovoge

FIG. 1. An assay that detects specific replication pause sites. The conditions used are described under “Materials and Methods.” Supercoiled bacteriophage fd replicative form DNA was nicked at nucleotide 5781 by the fd gene 2 protein. Addition of T4 replication proteins with dATP, dGTP, and [32P]TTPallows the addition of 12 nucleotides at thenick site as indicated. The delayed addition of the missing deoxyribonucleotide,dCTP, allows further synthesis to occur in a near synchronous manner, and replication proceeds in a rolling circle mode. After unincorporated radioactive nucleotides are removed, the products of synthesis are analyzed by gel electrophoresis.


16882

Vitro in

DNA Replication gene II nick stcrt

-19.1

random nick start

-16.6

-15.1 -13.1

3

-11.6

2

9) v)

0

I

6100

I

I

I

I

1

7350 9200 7950 11000 12200 DNA size (nucleotides)

-10.8

a)

-

9.6 8.9

.Y

v)

-x

2 Q

- 7.0 - 6.8

-

5

10

5.9

20

Minutes at 37°C FIG.2. DNA synthesis catalyzedby the T4 DNA polymerase holoenzyme in the presence of 32 protein Pauses at specific DNA sites on a double-stranded DNA template. Reactions were performed as in Fig. 1. Aliquots of 10 rl were processed and electrophoresed as described under “Materials and Methods.” An autoradiograph of a gel analyzing DNA products of a standard reaction after 5, 10, and 20 min is shown, with DNA bands caused by the pause sites A-F marked (see Table I); the asterisk denotes the unit length strand, which becomes labeled by chew back/fill-in synthesis at the gene 2 nick site (Englund, 1971).

TABLEI Locations ofpause sites Product size

FIG. 3. Replication pause sites are detectable only when replication is initiated at a specific site. This figure presents a densitometer tracing of autoradiographs similar to those shown in Fig. 2 and compares products of reactions beginning at a random versus a specific nick on an fd DNA template.

is used. Presumably the randomly initiated replication forks still pause at the same specific sites, but each site produces DNA products that are heterogeneous in size. The Mapping and Characterization of the ReplicationPause Sites-In order to more accurately map the positions of the replication pause sites, the products of replication were digested with a restriction endonuclease that cleaves the fd DNA at a unique site and then analyzed by electrophoresis through either a 1%agarose gel or a 6% polyacrylamide gel under denaturing conditions. Autoradiographs of some of these gels are shown in Fig. 4. From an autoradiograph of an agarose gel such as that shown in Fig. 4A, it is possible to estimate the sizes of DNA fragments that are between approximately 300 and 4000bases in length. The position of each major pause site was determined from the of cleavage with at least twodifferent restriction endonucleases. These values were averaged to give each ‘‘approximatemap Site” presented in Table 1, where the Sites are labeled A through F Proceeding “downstream” from the gene 2 nick site (i.e. in the direction of in uitro DNA synthesis). Two of the six strongest pauses (E and F) are very near regions that have been reported to form stable hairpinlike helices in single-stranded fd DNA (Huang and Hearst, 1980, 1981). These structures previously have been shown to act as barriers the to DNA synthesis catalyzed by the T4

replication system on a uniquely primed single-stranded fd DNA template (Huangand Hearst, 1980; Huang et al., 1981). However, on a double-stranded DNA template the core replication system also pauses at sites notknown to form helical A 6,900f24100 2 2” structures as a single strand (sitesA through D in Table I). B 8,1501,055 f 50 f 15 C 8,350f 50 1,360 f 20 attempt an In to better understand this phenomenon, we D 9,500f 100 2,255 -t 65 have determined the precise location of two of the pause sites: E 10,400f 100 3,300 f 55 site “A” which does not correlate with a region of hairpin F 12,6002 50 5,494 2 2” helical structure, and site “F,” which does. Fig. 4B shows an 13,250f 50 A autoradiograph of a 6% denaturing polyacrylamide gel used B 14,500f 50 to determine the positions of these two pause sites. At this E 16,600f 100 F 18,800f 100 high resolution (+2 nucleotides), it becomes apparent that “These positions were determined after restriction digestion by each of these pause sites consists of a major site plusa cluster sizing DNA fragments by electrophoresis on a 6% polyacrylamide gel, Of minor Ones* The DNA sequences where pauses occur at sites A and F as shown in Fig. 4B. The map sites of the other pause sites were determined more approximately after restriction digestion on a 1% are shown in Fig. 5. A bold arrow indicates a strong pause, denaturing agarose gel, as described in thelegend to Fig. 44. while weaker pauses are marked by thin arrows. The strong pause site in F is located six nucleotides before the start of an one initiated at these random nicks and the other initiated imperfect hairpin helix of 27 Watson-Crick base pairs (see from the specific fd gene 2 nick used previously. It can beFig. 5A of Huang and Hearst, 1981). However, there is no seen that the broad distribution of DNA sizes in the randomly obvious secondary structure in the region of pause site A. initiated reaction contrasts with the sharply punctuated, de- While several of the pause sites are associated with an alterfined size classes of DNA products when a specific start site nation of GC nucleotides and/or short four nucleotide palinPause site designation

before restriction

endonuclease cleavage

Map site (nucleotide no.)

Sequence-specific Pausing during in Vitro DNA Replication

B.

16883

dromes, no simple feature seems capable of explaining all of the pauses mapped in Fig. 5. Tests for Pausingon Special DNA Templates-DNA double helices containing inverted repeats that are 11or more nucleotides in length (either with or without three to five nucleotide non-palindromic sequences at the center of symmetry) can assume a cruciform structure invitro. However, cruciform formation is generally dependent on the negative superhelicity mC F of the DNA (Panayotatos and Wells, 1981; Sinden et al., 5956 1983).The gene 2-nicked substrates used in these experiments 4 3 6 8 , begin as fully relaxed DNA circles, and themoving replication 4072 fork should, if anything, induce a transient positive super3820 +E coiling in the template DNA (Liu and Wang, 1987). As a 318- & ’ double helix, the template DNA is therefore unlikely to con2640. tain stable cruciform structures. However, hairpin helices 4 D 3 2250’ 2 2372’ could formin a single-stranded template ahead of the leading 285 o 2116‘ strand DNA polymerase, providing that the DNA helix uns 2 1756winds far enough in advance of the moving replication fork 4c s 264to create such a template. 1 3 8 4 4 B .5 The genomes of bacteriophages M13 and fd are 95% homologous. To testwhether regions that form unusually strong 240 hairpin helices in single-stranded DNA invariably act as pause 892 . 840 , sites in our assays, we performed an experiment similar to that in Fig. 4 using as double-stranded DNA templates two genetically engineered derivatives of M13 DNA, namely M13mp7 and M13mp8. These two plasmids are nearly identical and consist of the original M13 DNA with either an 831or 832-base pair insertat position 5868, including a polylinker region. However, in M13mp7 the polylinker region consists 2 2 2 15 of a 48-base pair perfect palindrome, while in the M13mp8 control it contains no obvious secondary structure. The douMinutes at 37°C ble-stranded circular forms of these two DNAs were specifiFIG. 4. Determination oflocations of replication pause sites callynicked with gene 2 proteinandthentested in our on a double-stranded, circular fd DNA template. A, the approxstandard core replication assay. The products of DNA synimate locations of replication pause sites determined by electrophoresis followedby eitherno cleavage or cleavage with AccI. The thesis were cleavedwith AuaII at a unique site, 316 base pairs locations of the pause sites A through F determined from this type of upstream from the start of the palindrome on M13mp7 and experiment are presented in Table I. B, precise determination of two then were analyzed in adjacent lanes on a 6% polyacrylamide replication pause sites. Samples were prepared as described under gel. There werenomajor pause sites in the region of the “Materials and Methods” and then resolved by electrophoresis on a shown). Thus, a 6% polyacrylamide sequencing gel. The first lane on the autoradi- polylinker for eithertemplate(datanot is adideoxy sequencing reaction of pBR322 DNA primed region expected to form a very strong hairpin helix in singleograph ( M ) a t the Hind111 site. To locate pause site A, a replication reaction was stranded DNA does not cause pausing of DNA replication on stopped after a 2-min incubation and cleaved with AccI a t position a double-stranded DNA template. 6092 (second lane). Pause site F was determined by cleaving the 15The specific replication termination site in the plasmid min replication products with Ban a t position 5083. Note that each R6K has been cloned and shown to function as a terminator pause site consists of a cluster of a major position and several minor site during the intracellular replication of several other DNA ones. The time course for pause site A reveals that those positions representing pauses become fainter with increased incubation time, molecules, with a cloned sequence as short as 216 base pairs as expected (data not shown). See also Fig. 5. retaining functional terminator activity (Kolter andHelinski, 1978; Bastia et al., 1981). We have tested whether this terminator sequence exerts an effect on theabove in vitro DNA replication system by using a gene 2-nicked DNA template Pause Site -A* that contains an inserted R6K terminator sequence as the template in our assay. The R6K replication termination seT +l+ AACGCTACTACCAlTAGTAGAATTGATGCCACCfilTCAC quence does not cause the T4 replication fork to pause (data If 50 not shown). This result is consistent with the finding that the R6K replication terminator sequence functions in conjunction Pause Site “F” with special proteins that specifically bind to theterminator ?r region (Germino and Bastia, 1981; Sista et aL, 1989). TGTACGTG’ZEGTCAAAGCAATAGTACGCGCCClGTAGCGGCGCAlT 54613 The Effect of Two DNA Helicases on Replication Fork Paus=510 FIG. 5. Precise location of replication pause sites A and F. ing-The following two different T4 DNA helicases have been The DNA sequence in the region of these two pause sites is given, shown to increase the rate of replication fork movementin in and thepositions that correspond to thepause sites determinedfrom vitro reactions: the T4gene 41protein and the T4 dda protein. the experiment described in Fig. 4B are indicated with arrows. Bold We have used the assay described in Fig. 1 to examine the arrows are used to denote major pauses and faint arrows the minor effect of these proteinson the pausing of the replication fork ones. The numbers denote the standardnucleotide position on the fd genome. The underlining in the pause F sequence indicates the at specific DNA sequences. The T4gene 41protein is a DNA-dependent GTPase (and beginning of a hairpinhelix in asingle-stranded molecule. Replication ATPase) that seems to function as a dimer or higher oligomer is from left to right, and theproduct strand is shown.

0

@

v)

T

T


16884

(Liu and Alberts, 1981). The addition of this protein to the T4 core replication system leads to a dramatic increase inprotein the rate of fork movement on a double-stranded DNA template (Alberts et al., 1980; Cha and Alberts 1988). Since continuous GTP hydrolysis is required forthis effect, the stimulation of fork rate is believed to reflect the action of the 41 protein as a DNA helicase that uses the energy of GTP hydrolysis to move along the lagging strand template and melt the duplex DNA ahead of the fork (Liu and Alberts, 1981); the helicase activity has been directly demonstrated (Venkatesan et al., 1982). As shown in the autoradiogram in Fig. 6, an analysis of nascent DNA in reactions including 41 protein reveals a uniform smear of long DNAproduct lengths from those forks containing 41 protein (core plus 41 protein), very unlike the discrete products seen when the 41 protein is omitted (core replication proteins only). This result indicates that the addition of the T4 gene 41 protein to our reactions eliminates (or greatly reduces) the pausing of the replication fork seen previously. This result is internally controlled by the fact that reactions catalyzed by the T4 DNA polymerase holoenzyme in the presence of 32 protein and 41 protein always contain a

Core

B,C >

- 17.4 - 14.5

c A w

- 13.0

C F *

-12.4 a,

-10.7

2 2 Q

-

9.4

s a,

-

7.9

5

-

7.4

-

6.1

."( v) Q

a*-

Core plus 41protein

Core

Core plus dda

2

8

Minutes at 37OC

-17.9 -17.4 -13.0 -12.4

9.6 8.9-

-10.7

jS,

10.8'

1 7.0

-

5.9-

i I

m '

-

.

,

5 10 15

@ W -4 *6.1

L 1

2

5

Minutes at 37OC FrG. 6. The T4 gene 41 protein eliminates the pausing at a replication fork. Products of replication reactions catalyzed by a mixture of the polymerase holoenzyme and 32 protein ("core system") without and with gene 41 protein present are compared. Gene 41 protein greatly increases the rate of fork movement, so in order to compare DNA products of equivalent size, the reaction that lacked 41 protein included a high concentration (300pg/ml) of 32 protein (the rate of fork movement increases with increasing 32 protein concentration in this system). In addition, aliquots were taken a t later times than for the slower reaction (5, 10, and 15 min uersus 1, 2, and 5 min). The reactions containing 41 protein include some slower moving DNA products, make on forks that failed to acquire this DNA helicase; theseproducts produced by the core system contain characteristic DNA bandsindicating pausing (5-protein forks).

FIG.7. The T4 dda protein increases therate of fork movement, but does not eliminate replication fork pausing. Addition of purified T4 dda protein increases the rate of fork movement about &fold under our conditions. However, the products of the slower reaction a t 8 min and this reaction a t 2 min reveal similar, if not identical, pausing patterns. mixture of replication forks with and without 41 protein; because the 41 protein is highly processive in its action and remains with the same DNA molecule once bound, the products from these two types of forks can be readily distinguished by their very different lengths (Alberts et al., 1980). Thus, the removal of kinetic barriers in front of the replication fork by the T4 gene 41 protein can be most clearly seen in the right panel of Fig. 6 by comparing the absence of discrete bands in the long DNAproducts produced after abrief incubation ("6protein forks") with the presence of bands in the products of the same size produced at later times in the slower reaction catalyzed in the same test tube ("5-protein forks"). The T4 dda (DNA-dependent ATPase) protein has been shown to be a DNA helicasethat uses ATP hydrolysis energy to drive DNAhelix melting whilemoving in the 5' to 3' direction along an adjacent DNA single strand (Krell et al., 1979; Kuhn et al., 1979; Jongeneel et al., 1984a). This DNA helicase also causes an increase in the rateof fork movement in reactions catalyzed by the T4DNA polymerase holoenzyme plus 32 protein (Jongeneel et al., 198413). However, replication pause sites aredetected in these fasterforks that are indistinguishable from those found without dda protein (Fig. 7). Even at theearliest time point shown in Fig. 7,the products of replication in the presence of dda protein are large; the bands labeled A-C therefore correspond to pausing as the replication fork passes these pause sites for the second time. Evidence that a replication fork containing the dda protein pauses at these sites during the first round of synthesis has been presented as partof a previous publication (Bedinger et al., 1983; Fig.6, lanes a-c and g-i). We concludethat theelimination of the kinetic barriers to replication caused by the gene 41 protein is a specific effect,


16885

hydrolysis to move in a 5’ to 3’ direction and melt DNA, thereby speeding the progress of the replication fork (Jongenee1 et al., 1984a; Alberts et al., 1980; Venkatesan et al.,1982). While both of these proteins increase the rate of replication DISCUSSION fork movement, their effect on replication fork pausing inour Nature of the Pause Sites-The experiments reported here in vitro system is quite different. The dda helicase does not have shown that theT4 DNA polymerase holoenzyme pauses affect the pausing, whereas replication pausing is eliminated at specific sites during; the in vitro replication of double- in thepresence of 41 protein (Figs. 6 and 7). This observation stranded DNA templates in the presence of 32 protein. Pre- is presumably due to a difference in the manner that these vious in vitro experiments have demonstrated that purified two DNA helicases interact with the T4replication fork. For DNA polymerases paus’eat sites of secondary structure when example, the 41 helicase acts in a highly processive manner replicating a single-stranded DNA template (Sherman and and is atightly bound component of theT4 replication Gefter, 1976; Challberg and Englund, 1979; Huang and complex (Alberts et al., 1980; Venkatesan et al., 1982; Cha Hearst, 1980; Weaver ,and DePamphilis, 1982; Kaguni and and Alberts, 1988). In contrast, thedda protein operates in a Clayton, 1982). Sensitive assays for pausing carried out with distributive fashion and thus interacts with the replication purified T4 DNA polymerase, E. coli DNA polymerase I11 complex in a transient manner(Jongeneel et al.,198413).Thus, holoenzyme, and eukaryotic DNA polymerase a have revealed the rest of the replication complex may be stabilized by the that additional DNA sequences that arenot involved in 41protein but not by the ddaprotein. Alternatively, the obvious secondary structures can also arrest DNA synthesis suppression of pausing caused by the 41 protein may reflect a (Fairfield et al.,1983; Weaver and DePamphilis, 1982; Kaguni specific interaction of this protein with the DNA polymerase holoenzyme. and Clayton, 1982). Possible Importance of Replication Pausing-In the case of Our results indicate that thepotential for forming a hairpin helix in a DNA single strand does not necessarily cause the DNA transcription, RNA polymerase pausing at specific sites replication fork to pause on a double-strandedDNA template. is thought to allow binding of ribosomes to “leader” RNA. Pause sites E and F are near regions that can form strong The subsequent synchrony of transcription and translation hairpins in single strands (Huang and Hearst, 1980, 1981), plays an important role in the gene expression of the trp and thefine-mapping of pause siteF DNA indicates that itis operon in E. coli (Yanofsky, 1981; Winkler and Yanofsky, located close to the ba.seof the predicted hairpin (Fig. 5). 1982). While the extentof specific replication fork pausing in However, when M13mp17 was used as a template, no pausing vivo is unclear, many potential functions for such events are was detected in the vicinity of the 22-base pair perfect hairpin conceivable. For example, sequence-specific pausing during helix that should form in the polylinker region if this region DNA synthesis could be useful to promote the assembly of becomes single stranded. Thus, there is no clear correlation the complete replication protein complex at a replication origin, in addition to insuring that chromosomal DNA replibetween regions of potential secondary structureandthe cation ends inthe vicinity of a specific termination region. occurrence of replication fork pausing. Since hairpin helices The T4replication forks that lack the gene 41 protein and act aspause siteswhen the T4 DNA polymerase moves along pause at specific DNA sequences are “incomplete” in lacking a single-strandedregion of DNA template (Huang et al., 1981), a primosome. Similar incomplete replication forks could also this finding suggests to us that the DNA template does not exist in uiuo. For example, the strong pauses seen near the become single stranded for more than a few nucleotides ahead terminus of DNA replication in many systems(Nagley, 1986) of the leading strand D:NA polymerase molecule at a replicacould be in part due to the displacement or inhibition of tion fork. particular protein factors on these replication forks that are The fine mapping of pause sites A and F suggests that induced by specific DNA sequences in advance of the pause chain termination occurs at a cluster of positions rather than sites. at one unique position (Fig. 4B).The minor pauses are localized and do not appear to represent background “noise”; REFERENCES for example, in Fig. 4B, no bands are detected in the lower portions of the gel lanes. All of the sites in a cluster become Alberts, B. M., Barry, J., Bedinger, P., Burke, R. L., Hibner, U., Liu, C.-C., and Sheridan, R. (1980) in MechanisticStudies of DNA fainter during continued incubations, as expected for pause Replication and Genetic Recombination: ICN-UCLA Symposia on sites (data not shown). Molecular and Cellular Biology (Alberts, B. M.,ed) Vol. 19, pp. 449To explain the clustering of pause sites observed, we suggest 471, Academic Press, New York that the polymerase holoenzyme may become “destabilized” Bastia, D., Germino, J., Crosa, J. H., and Ram, J. (1981) Proc. Natl. Acad. Sci. U. S. A . 7 8 , 2095-2099 on selected regions of th’etemplate, where it becomes sensitive to specific sequences that are especially difficult to traverse Bedinger, P., Hochstrasser, M., Jongeneel, C. V., and Alberts, B. M. (1983) Cell 34,114-123 and tends to fall off the template (or stall for a prolonged Bittner, M., Burke, R. L., and Alberts, B. M. (1979) J . Biol. Chern. time). We do not know the cause of this destabilization, 254,9565-9572 although it fits with ouI current view of the T4 DNA polym- Cha, T-A., and Alberts, B. M. (1988) Cold Spring Harbor Cancer Celk 6, 1-10 (1988) erase holoenzyme, in which the accessory proteins (the 44/62 and 45 proteins) act asa sliding clamp with multiple possible Challberg, M. D., and Englund, P. T. (1979) J. Biol.Chem. 2 5 4 , 7820-7826 states. According to thisview, the accessory proteins serve as Clewell, D. B. (1972) J. Bacteriol. 1 1 0 , 667-676 an energized “clock” that measures the time of polymerase Englund, P. T. (1971) J . Biol. Chem. 246,3269-3276 stalling (Munn, 1986; Selick et al., 1987);thus, theclusters of Fairfield, F. R., Newport, J. W., Dolejsi, M. K., and von Hippel, P. pause sites could occur in regions where the holoenzyme has H. (1983) J. Biomed. Struct. & Dyn. 1, 715-727 decayed to a lower energy state and has thereby been con- Germino, J., and Bastia, D. (1981) Cell 2 3 , 681-687 Hibner, U., and Alberts, B. M. (1980) Nature 2 8 5 , 300-305 verted from a strongly tfo a more weakly binding enzyme. M., Akiyama, M., and Horiuchi, T. (1988) Cell 55,467-475 The Effects of T4 DNAHelicases on Replication Fork Paus- Hidaka, Hill, T. M.,Pelletier, A. J., Tecklenburg, M. L., and Kuempel, P. L. ing-Both the dda protein and the gene 41 protein are DNA (1988) Cell 55,459-466 helicases that utilize energy from nucleoside triphosphate Huang, C.-C.,and Hearst, J. E. (1980) Anal. Biochem. 103, 127-139 rather than being either a general property of DNA helicase action at the fork, or the result of a faster moving DNA polymerase molecule per se (see “Discussion”).

421-435

16886


Huang, C.-C., and Hearst, J. E. (1981) Nucleic Acids Res. 9 , 55875599 Huang, C.-C., Hearst, J. E., and Alberts, B.M. (1981) J. Biol. Chem. 256,4087-4094 Jongeneel, C. V., Formosa, T., and Alberts, B. M. (1984a) J. Biol. Chem. 259,12925-12932 Jongeneel, C. V., Bedinger, P., and Alberts, B.M. (1984b) J. Biol. Chem. 259,12933-12938 Kaguni, L. S., and Clayton, D.A. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,983-987 Kolter, R., and Helinski, D. R. (1978) J . Mol. Biol. 1 2 4 , 425-441 Krell, H., Dunvald, H., and Hoffmann-Berling, H. (1979) Eur. J . Biochem. 93,387-395 Kuempel, P. L., and Duerr, S. A. (1979) Cold Spring Harbor Symp. Quant. Biol. 4 3 , 563-567 Kuhn, B., Abdel-Monem,M.,&ell,H., and Hoffmann-Berling, H. (1979) J. Biol. Chem. 254, 11343-11350 Lai, C.-J., and Nathans, D. (1975) J.Mol. Biol. 97, 113-118 Liu, C.-C., Burke, R. L., Hibner, U., Barry, J., and Alberts, B. M. (1979) Cold Spring Harbor Symp. Quant. Biol. 43,465-487 Liu, C.-C., and Alberb, B. M. (1980) proc,Natl. Ac&, sei, u, S, A , 77,5698-5702 LiU, c.-c., and Albert%B. M. (1981) J. Bid. Chem. 2569 2813-2820 Liu, L. F., and Wang, J. C. (1987) Proc. Natl. h a d . Sci. U. S. A. 8 4 , 7024-7027 Maxam, A. M.9 and Gilbert, w. (1980) Methods EnzYmol. 6 5 , 499560 MeYer, T. F.9 and Geider, K. (1979) J. B d . Chem. 254,12636-12641 Meyer, T. F.,Baume], I., Geider, K., and Bedinger, P. (1981) J. Biol. Chem. 256,5810-5813 Morris, C. F., Hama-Inaba,H., Mace, D., Sinha, N.K., and Alberts, B. M. (1979a) J. Biol. Chem. 254,6787-6796 Morris, C. F., Moran, L. A., and Alberts, B. M. (1979b) J. Biol. Chem. 254, 6797-6802 Munn, M. (1986) PbD. thesis, University of California, San Francisco Nagley, P. (1986) Trends Genet. 2 , 221-222

in Vitro DNA Replication Neal, M. W., and Florini, J. R. (1973) Anal. Biochem. 5 5 , 328-330 Nossal, N. G., and Peterlin, M. B. (1979) J. Biol. Chem. 254, 60326037 Nossal, N. G. (1980) J. Biol. Chem. 255,2176-2182 O'Farrell, P. H., Kutter, E., and Nakanishi, M. (1980) Mol. Genet. Panayotatos, N., and Wells, R.D. (1981) Nature 2 8 9 , 4 6 6 4 7 0 Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. SCi. u. s. A. 74,5463-5467 Selick, H.E., Barry, J., Cha, T.-A., Munn, M., Nakanishi, Wong, M., M.L., and Alberts, B.M. (1987) in Mechanism of DNA Replication and UCLA SYmPsium Mdadur on and Celhlar Biology, New Series (Kelly, T., and McMacken, R., eds) pp. 183214, R. New Sherman, L. A., and Gefter, M. L. (1976) J. Mol. Biol. 103,61-76 Sinha, N.K., Morris, c. F.9 and Albert% B.M. (1980) J . Chem. 255,4290-4303 Sinden, R. R., Broyles, S. S., and Pettijohn, D.E. (1983) Proc. Natl. .' s. A. 80*1797"01 Sinha, N. K., and Haimes, M.D. (1980) in Mechunistic Studies of DNA and Genetic Recombination:zCN-UcLA on Molecular and Cellular Biology (Alberts, B. M., ed) Vol. 19, pp. 707-723, Academic Press, New York Sista, p. R., ~ ~ k hs.,~patel, i ~p., ~ h, ~ tG.~s., i and , ~ ~D, (1989) proc,Natl. A c d . sei. u, S. A , 86,3026-3030 Tomizawa, J. I. (1978) in DNA Synthesis: Present and Future (Molineux, I., and Kohiyama, M., ed) pp. 797-825, plenum presspublishing Co., New York Valenzuela, M. s., Freifelder, D., and Inman, R. B. (1976) J , ~ 0 1 ~ i ~102, l . 569-589 Venkatesan, M., Silver, L. L., and Nossal, N. G . (1982) J. Biol. Chem. 257,12426-12434 Weaver, D.T.,and DePamphilis, M. L. (1982) J. Bwl. Chem. 2 5 7 , 2075-2086 Weiss, A. S., and Wake, R. G. (1984) Cell 39,683-689 Winkler, M. E., and Yanofsky, C. (1981) Biochemistry 20,3738-3744 Yanofsky, C. (1981) Nature 2 8 9 , 751-758

~

.

~