SOMATIC EMBRYOGENESIS, PLANT REGENERATION AND

SOMATIC EMBRYOGENESIS, PLANT REGENERATION AND GENETIC TRANSFORMATION IN FRAGARIA spp. R. Donnoli, F. Sunseri, G. Martelli and I. Greco Dipartimento Biologia, Difesa e Biotecnologie AgroForestali Università degli Studi della Basilicata, C.da Macchia Romana I-85100 Potenza Italy Keywords: strawberry, Agrobacterium tumefaciens Abstract Three strawberry cultivars (Clea, Irvine and Paros) useful for South Italy pedoclimatic conditions and several genotypes of Fragaria vesca L. were tested for plant regeneration and genetic transformation. Four different MS-based media were utilized for callus proliferation and shoot regeneration. In order to obtain genetic transformation, leaf disks were also cocultivated with a LBA 4404 Agrobacterium tumefaciens harbouring a plasmid with the marker gene NPTII. High percentage of organogenesis and plant regeneration were obtained in strawberry and Fragaria vesca by using a MS medium supplemented with 1 mg/l IBA and 1 mg/l BAP. Somatic embryogenesis events were observed when the explants were mantained in darkness during callus induction step. A sufficient number of genetic transformation events were obtained either in strawberry or in Fragaria vesca. 1. Introduction Strawberry (Fragaria x ananassa Duch.) is an important fruit-crop in the world. In order to extend its cultivation area worldwide, genetic improvement of the cultivated strawberry for several important traits could be necessary. Several interesting genes could be included into the strawberry gene pool to increase the field value using either interspecific/intergeneric crosses or genetic transformation. Unfortunately, the utilization of many wild species is limited by natural barriers to the reproductive process and by the different level of ploidy among Fragaria species. The availability of genetic engineering techniques (e.g. somatic hybridization and genetic transformation) on strawberry and its applications in plant breeding could be useful. Several studies on organogenesis and genetic transformation have been reported (Nehra et al., 1990; El Mansouri et al., 1996; Orlando et al., 1997; Mazzara et al., 1998; Barcelo et al., 1998). Different tissues and genotypes have been used as source of explants. High rate of regenerated plants have been produced via organogenesis starting from leaf disks (Nehra et al., 1990), cotyledons (El Mansouri et al., 1996) and petiols (Rugini and Orlando, 1992). However, a low rate of normal morphogenesis in plant regeneration and a high rate of escape in plant transformation are the major problems not yet solved. In order to improve the technique, a method to produce transformed plants via somatic embryogenesis has been explored. A negative effect of light on somatic embryogenesis induction was observed. Therefore, the explant cultivation in darkness during the first experimental step, as reported in other species (Coutos-Thevenot et al., 1990; Fiore et al., 1997), could be the key factor influencing somatic embryogenesis in Fragaria spp. In the present study, an efficient and reliable protocol for plant regeneration and Agrobacterium-mediated transformation in strawberry and in Fragaria vesca has been Proc. IV IS on In Vitro Cult. & Hort. Breeding Eds. S. Sorvari et al. Acta Hort 560, ISHS 2001

236

reported, either organogenesis or somatic embryogenesis has been observed. 2. Materials and methods 2.1. Plant material Three strawberry (Fragaria x ananassa Duch.) cultivars (Clea, Irvine and Paros) useful for South Italy pedoclimatic conditions, three cultivars (Alpine, Ilaria and Regina delle Valli) and four accessions of Fragaria vesca, selected in Southern Italy areas such as Pollino (PZ-V1), Alburni (PZ-V4 and PZ-V8) and Sila (PZ-V9), were utilized in plant regeneration and genetic transformation experiments. 2.2. Plant regeneration Leaf disks of strawberry and Fragaria vesca were surface-sterilized in 2% sodium hypochlorite for 20 min, followed by treatment with 50% of EtOH for 3 min and rinse several time in sterile distilled water. Leaf disks were cultivated on different MS media (Table 1) and maintained in darkness in order to obtain etiolated calli. After eight weeks the calli obtained were transferred into the light and subcultured for three months. Finally, organogenic and putative embryogenic calli were transferred on two different media named L1 and L2 (Table 2) for the germination of embryos and the shoot elongation. Samples of different kind of calli obtained from different media were analyzed by laser confocale miscroscope with the aim to distinguish organogenic and embryogenic phenomena. Regenerated shoots were easily excised from callus and placed onto a MS medium, named R1 (Table 2) in order to obtain rooted plantlets. After two weeks they were put into pots and were incubated in environment-controlled growth chamber (34 µE m-2 s-1 light intensity, 25°C and 16/8 photoperiod). After other 2 weeks the acclimatized plantlets were transferred into the greenhouse. 2.3. Genetic transformation With the aim to obtain transgenic plants in strawberry and Fragaria vesca leaf disks coming from all the genotypes indicated above were infected and cocultivated with Agrobacterium tumefaciens, a LBA 4404 strain harbouring a plasmid with the selectable marker gene NPTII, conferring kanamycin resistance. The infection with Agrobacterium was performed for 20 minutes either at atmospheric pressure or in a vacuum chamber (-0.4 bar). Explants were transferred to a selection medium supplemented with 25 mg/l kanamycin and 500 mg/l carbenicillin. Finally, shoot elongation and rooting were obtained onto media supplemented with 25 mg/l kanamycin. In order to perform Polymerase Chain Reaction analysis plant DNA was isolated from young leaves according to the method of Doyle and Doyle (1987) and 50-100 ng of DNA was used. The primers position in the NPTII gene used are at nucleotides 1-29 (5'ATGATTGAACAAGATGGATTGCACGCAGG 3') and 769 - 792 (5' GAAGAAC TCGTCAAGAAGGCGATA 3'), respectively. 3. Results and Discussion Starting from the medium described by Orlando, et al. (1997) and compared with the media utilized in sunflower by Fiore, et al. (1997) to obtain somatic embryogenesis, several hormonal and nitrogen source combinations were studied (Donnoli et al., submitted). Different rates of organogenesis were observed on different media and in all the genotypes utilized (Table 3). Nevertheless, the best results in high percentage of organogenesis and plant regeneration (Figure 1 and 2) were obtained in strawberry cv. Clea and Fragaria vesca accession PZ-V4 by using the D medium. Proc. IV IS on In Vitro Cult. & Hort. Breeding Eds. S. Sorvari et al. Acta Hort 560, ISHS 2001

237

Isolated phenomena of somatic embryogenesis were reported only in cv. Clea always cultured on D medium (Figure 3), in particular 8% of embryogenic calli were observed. A portion of putative embryogenic calli were analyzed under laser confocal microscope that revealed the typical globular embryo and torpedo structures (Figure 4). In our conditions, the embryogenic calli were detected after 20-25 days on the adaxial surface of the explants cultured on darkness. It seem important to maintain the explants completely in the dark until the embryos were formed. In Agrobacterium experiments a sufficient number of transformation events were obtained either in strawberry or in Fragaria vesca, in particular when the infection were performed in a vacuum chamber (Table 4). In the diploid species, different genotypes for genetic transformation were utilized with the aim to obtain transformed plants starting from cultivated varieties. PCR experiments on different transformed plants revealed the presence of transgene in 10 plantlets out of 14 (data not shown). This is the first preliminary report on somatic embryogenesis in strawberry. Considering the interest on this phenomenon for genetic transformation, several experiments are currently developing in order to point out the putative key factors (light intensity, orientation of leaf disk and age of explant) inducing the embryogenetic process in Fragaria spp. References Barcelo, M., El Mansouri, I., Mercado, J.A., Quesada, M.A. and Pliego-Alfaro, F. 1998. Regeneration and transformation via Agrobacterium tumefaciens of the strawberry cultivar Chandler. Plant Cell Tiss. Org. Cult. 54:29-36 Coutos-Thevenot, P., Jouanneau, J.P., Brown, S., Petiard, V. and Guern, J. 1990. Embryogenic and non-embryogenic cell lines of Daucus carota cloned from meristematic cell clusters: relation with cell ploidy determined by flow cytometry. Plant Cell Rep. 8:605-608 Doyle, J.J. and Doyle, J.L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15 El Mansouri, I., Mercado, J.A., Valpuesta, V., Lopez-Aranda, J.M., Pliego-Alfaro, F. and Quesada, M.A. 1996. Shoot regeneration and Agrobacterium-mediated transformation of Fragaria vesca L. Plant Cell Rep. 15:642-646 Fiore, M.C., Trabace, T. and Sunseri, F. 1997. High frequency of plant regeneration in sunflower (Helianthus annuus L.) via somatic embryogenesis. Plant Cell Rep. 16:295-298 Mazzara, M., Mezzetti, B., James, J.D. and Negri, P. 1998. Il gene rolC in fragola. L’Informatore Agrario 29:46-49 Nehra, N.S., Stushnoff, C. and Kartha, K.K. 1990. Regeneration of plants from immature leaf-derived callus of strawberry (Fragaria x ananassa). Plant Sci. 66:119-126 Orlando, R., Magro, P. and Rugini, E. 1997. Pectic enzymes as a selective pressure tool for in vitro recovery of strawberry plants with fungal disease resistance. Plant Cell Rep. 16:272-276 Rugini, E. and Orlando, R. 1992. High efficiency shoot regeneration from calluses of strawberry (Fragaria x ananassa Duch.) stipules of in vitro shoot cultures. J. Hort. Sci. 67:577-582

Proc. IV IS on In Vitro Cult. & Hort. Breeding Eds. S. Sorvari et al. Acta Hort 560, ISHS 2001

238

Tables Table 1. Composition somaticembryogenesis.

of

Component MS Basal Medium BAP IBA Sucrose Phytagel

MS

media

Medium D 4.4 g/l 1.1 mg/l 1.0 mg/l 29 g/l 2.8 g/l

utilized

to

Medium E 4.4 g/l 2.0 mg/l 0.5 mg/l 20 g/l 2.8 g/l

induce

Medium F 4.4 g/l 10 mg/l 1.0 mg/l 20 g/l 2.8 g/l

organogenesis

and

Medium G 4.4 g/l 30 mg/l 1.0 mg/l 20 g/l 2.8 g/l

Table 2. Elongation (L1 and L2) and rooting (R1) media. Component MS Basal Medium BAP IBA Sucrose Phytagel

Medium L1 4.4 g/l 1.13 mg/l 29 g/l 3.0 g/l

Medium L2 4.4 g/l 0.5 mg/l 0.25 mg/l 20 g/l 2.8 g/l

Medium R1 4.4 g/l 0.22 mg/l 0.20 mg/l 20 g/l 2.8 g/l

Table 3. Organogenesis and plant regeneration on medium D. Genotype

Explant

Calli %

Shoot%

Rooted shoot %

Clea Paros Irvine PZ-V1 PZ-V4 PZ-V8 PZ-V9

30 30 30 30 30 30 30

100 100 100 60 100 60 20

316 166 200 222 300 183 250

82 72 68 70 81 63 66

Table 4. Genetic transformation and plant regeneration on medium D. Genotype

Explant

Calli %

Shoot %

Clea Paros Irvine Alpine Ilaria Regina

50 50 50 50 50 50

86 62 64 56 24 42

74 80 71 64 58 38


Rooted shoot % 15 6 4 6 1 3

239

Figures

Fig. 1. Organogenesis in cv Clea.

Fig. 3. Somatic embryogenesis in cv. Clea


Fig. 2. Plant regeneration in strawberry.

Fig. 4. Globular structure at laser confocal microscope.

240