Stimulation of Duodenal Biopsies and Whole Blood from Dogs with ...

EXPERIMENTAL IMMUNOLOGY doi: 10.1111/sji.12186 ..................................................................................................................................................................

Stimulation of Duodenal Biopsies and Whole Blood from Dogs with Food-Responsive Chronic Enteropathy and Healthy Dogs with Toll-Like Receptor Ligands and Probiotic Enterococcus faecium S. Schmitz*†, M. Henrich‡, R. Neiger†, D. Werling§ & K. Allenspach*

Abstract *Department of Veterinary Sciences and Services, Royal Veterinary College, University of London, North Mymms, Hatfield, Hertfordshire, UK; †Small Animal Clinic (Internal Medicine), Justus-Liebig University, Giessen, Germany; ‡Institute for Veterinary Pathology, JustusLiebig University Giessen, Giessen, Germany; and §Department of Pathology and Pathogen Biology, Royal Veterinary College, University of London, North Mymms, Hatfield, Hertfordshire, UK

Received 28 June 2013; Accepted in revised form 3 May 2014 Correspondence to: K. Allenspach, Department of Veterinary Sciences and Services, Royal Veterinary College, University of London, Hawkshead Campus, Hawkshead Lane, North Mymms, Hatfield, Hertfordshire AL9 7TA, UK. E-mail: [email protected]

The composition of the microbiome plays a significant role in the pathogenesis of inflammatory bowel disease (IBD) in humans and chronic enteropathies (CE) in dogs. The administration of probiotic micro-organisms is one way of modulating the microbiome, but experiments elucidating mechanisms of action of probiotics in the intestine of healthy and CE dogs are lacking. The aim of our study was to investigate the effects of different Toll-like receptor (TLR) ligands and Enterococcus faecium (EF) on ex vivo cultured duodenal samples and whole blood (WB) from dogs with food-responsive chronic enteropathy (FRE) when compared to healthy dogs. Biopsy stimulation was performed in 17 FRE and 11 healthy dogs; WB stimulation was performed in 16 FRE and 16 healthy dogs. Expression of TLR2, 4, 5 and 9, IL-17A, IL-22, IFNy, TNFa, IL-4, IL-10, TGFb and PPARy was determined in biopsies by quantitative polymerase chain reaction (PCR). In addition, production of TNFa, IL-10, IFNy and IL-17A protein in WB and biopsy supernatants was assessed by ELISA. Treatment with individual TLR ligands or EF induced a variety of changes in the expression of different TLRs and cytokines, but not necessarily a consistent change with a single stimulating agent. Even though cytokine protein could not be detected in supernatants from ex vivo stimulated biopsies, we found TNFa protein responses in blood to be opposite of the transcriptional responses seen in the biopsies. Stimulation of canine duodenal biopsies with TLR ligands can potentially induce anti-inflammatory gene expression, especially in healthy tissue, whereas the effects of EF were limited.

Introduction Several studies in humans and animal models suggest that the composition of the microbiome plays a significant role in the pathogenesis of chronic enteropathies (CE) like inflammatory bowel disease (IBD) [1–3]. The most widely held hypothesis on the pathogenesis of IBD is that overly aggressive acquired (T cell) immune responses to a subset of commensal enteric bacteria develop in genetically susceptible hosts, and widely unknown environmental factors precipitate the onset or reactivation of the disease [4]. The microbiome composition of humans and dogs with IBD differs significantly from the composition seen in healthy individuals [3, 5, 6]. However, it is not clear whether these differences are cause or effect of dysregulated immune responses. The administration of probiotic micro-organisms

Ó 2014 John Wiley & Sons Ltd

is one way of trying to modulate the microbiome. Beneficial effects of a single probiotic strain or combinations of strains (such as Lactobacillus spp., Bifidobacterium spp. or Enterococcus spp.) on inflammatory processes in the intestine have been reported in several animal models [7–9] and in clinical trials in humans, especially in the treatment of ulcerative colitis (UC) or prevention of UC relapses [4, 10]. Probiotics, either as intact viable bacteria, their cell wall components or microbial DNA, can exert their beneficial effects by communicating directly with the host cells [9]. These microbial-associated molecular patterns (MAMPs) are recognized by pattern-recognition receptors (PRRs) on intestinal epithelial cells, macrophages and dendritic cells [11–13]. Both in humans and dogs with IBD, dysregulation of PRRs, for example, Toll-like receptors (TLRs) or nucleotide-oligomerization domain (NOD) receptors have

85

RVC n/a Healthy Rhodesian Ridgeback n = 2, Labrador n = 2, Greyhound n = 1

me n = 3, mn n = 2, fe n = 1, fs n = 10 5 Privately owned (blood donors)

Median 30 (range 23–96) 11 Experimental colony

Me, male entire; mn, male neutered; fs, female spayed; fe, female entire; FRE, food-responsive enteropathy; RVC, Royal Veterinary College London; JLU, Justus Liebig University Giessen (Germany); WB, whole blood; ASPA, Animal Scientific Procedure Act.

n/a (residual blood samples)

Regional council approval no. 36/2011

Ex vivo biopsy stimulation in n = 11, WB in n = 11 WB in n = 5 JLU 0 Healthy

ASPA approval number 70/7393; approval by the RVC ethics and welfare committee Ex vivo biopsy stimulation in n = 17, WB in n = 16 RVC Median 5 (range 1–9) FRE

Labrador n = 7, Golden Retriever n = 3, Border Collie n = 1, Boxer n = 1, Bracco Italiano n = 1, Cockapoo n = 1, Dogue de Bordeaux n = 1, Miniature Schnauzer n = 1, cross-breed n = 1 Beagle n = 11 me n = 5, mn n = 6, fs n = 6

Breeds Gender Age (months)

Median 40 (range 5–98) 17 Privately owned (recruited for prospective clinical trial)

Tests performed CCECAI

Samples acquired and processed at Disease status Sample source

Healthy and diseased animals used in the study. Dogs with FRE were recruited as part of a prospective clinical trial investigating properties of EF. Control dogs consisted of 11 Beagles from an experimental colony and five privately owned blood donor dogs. A comprehensive list of samples used and tests performed can be found in Table 1. The diagnosis of FRE was based on the presence of appropriate clinical signs (vomiting and/or diarrhoea weight loss) of at least 3-week duration, exclusion

Number (n)

Materials and methods

Table 1 Details of the individual dogs from which samples for the present study were acquired.

been reported [14–17]; and for some of those, genetic causes (mutations, single nucleotide polymorphisms) have been identified [18–21]. Only few studies have assessed the effect of probiotics on immune function or microbial composition in vivo in sufficient numbers of patients or in a placebo-controlled double-blinded manner to achieve overall convincing conclusions about their benefits in human chronic inflammatory gut conditions like IBD. Similarly, clinical trials in other species suffering from CE examining the efficiency of probiotic administration are scarce [22, 23]. One study reported no effect of the administration of the most commonly used probiotic Enterococcus faecium SF68 NCIMB 10415 on chronic giardia cyst shedding [24]. In a more recent study, Enterococcus faecium (EF) administration reduced the duration of acute diarrhoea in shelter-housed cats, but not dogs [25]. Using intestinal explants in ex vivo experiments has been shown to be a good way of examining tissue-specific changes in gene and/ or protein expression upon induction of inflammation/infection or to assess the effect of several ‘treatments’ in many species [2, 3, 5, 26, 27], which have included the application of probiotics [1, 3, 27, 28]. In some cases, these responses could be mirrored by changes seen in protein and/or gene expression from human peripheral blood cells [6, 14, 15]. Based on these described observations, our hypothesis was that the previously reported dysregulated expression of TLR and cytokine mRNA in dogs with FRE could be ‘reverted’ by the treatment with EF. Therefore, the aim of our study was to investigate the effects of different TLR ligands and EF on ex vivo cultured canine duodenal samples and WB on the expression of TLR 2, 4, 5 and 9 (these TLRs are most commonly associated with bacterial recognition) and peroxisome proliferator-activated receptor gamma (PPARy, a nuclear receptor that is activated by Enterococci and induces anti-inflammatory cytokine production) as well as on inflammatory and regulatory cytokines (IL-17A and IL22 as markers for Th17 cells, IFNy and TNFa as Th1 cytokines, IL-4 as Th2 cytokine, and IL-10 and TGFb as cytokines commonly associated with regulatory T cells), and to compare these effects between healthy dogs and dogs with FRE.

Ethical approval

86 Culture of Canine IBD Tissues with TLR Ligands S. Schmitz et al. ..................................................................................................................................................................

Scandinavian Journal of Immunology, 2014, 80, 85–94

S. Schmitz et al. Culture of Canine IBD Tissues with TLR Ligands 87 ..................................................................................................................................................................

of other causes of chronic gastrointestinal signs, the presence of lymphoplasmacytic and/or eosinophilic inflammation on histopathological review of duodenal biopsies and the resolution of clinical signs when fed a hydrolysed protein diet (Purina HA) exclusively for a duration of 6 weeks. Control dogs were deemed healthy based on the absence of clinical signs, normal physical examination and no abnormalities on routine haematology, serum biochemistry and intestinal histopathology. Parts of the results from WB stimulation in healthy dogs have been published elsewhere [29]. Bacterial cultures. Enterococcus faecium NCIMB 10415 primary cultures were grown from glycerol stock in standard nutrient broth no. 1 (Sigma-Aldrich, Dorset, UK) and plated on nutrient agar plates (Sigma-Aldrich). Fresh secondary cultures in nutrient broth were obtained from the plates for each stimulation assay. EF was grown for 4–6 h to an optical density (OD) of >0.5 at 600 nm and then diluted with nutrient broth to the required concentration. Ex vivo stimulation of duodenal biopsies with TLR ligands and EF. Ex vivo culture of duodenal biopsies was performed using a previously described protocol [28] with minor modifications: Eight duodenal pinch biopsies from each dog obtained during duodenoscopy were immediately transferred into ice cold culture medium (RPMI 1640 + glutamine, Gibco, Paisley, UK) with 100 U ml1 penicillin and 100 lg ml1 streptomycin (PAA, Somerset, UK) and rinsed by decanting 3 times in order to reduce the adherent microbiota. Biopsies were transferred to 24-well flat-bottomed plates and different TLR ligands (lipopolysaccharide [LPS; Escherichia coli 0111:B4; 1 ng ml1, TLR4 ligand], Pam3CSK4 [100 ng ml1; TLR1/2 ligand], recombinant flagellin from Salmonella typhimurium [1 lg ml1;TLR5 ligand], all from Invivogen, San Diego, CA, USA) or EF (at 1 9 107 CFU ml1) were added. PBS was used as a negative control. Plates were incubated for 5 h at 37 °C and 5% CO2, after which biopsies were transferred to cryotubes holding RNA later (Ambion, Huntingdon, UK), kept at 4 °C for 24 h and then transferred to 80 °C. Culture supernatants were stored at 20 °C until further use. Whole blood stimulation with TLR ligands and EF. Whole blood (WB) culture was performed using a previously described protocol [30] with minor modifications. Blood was diluted 1:1 with medium (RPMI plus penicillin/ streptomycin for TLR ligand stimulation; RPMI sine penicillin/ streptomycin for stimulation with EF, as above). TLR ligands and EF were added in the same concentrations as described above for biopsy stimulation, and PBS was used as control. Each stimulation assay was carried out in duplicates. Plates were incubated for 5 h at 37 °C and 5% CO2, centrifuged at 1133 g for 8 min at 4 °C and supernatants harvested and stored at 20 °C until further use. Ó 2014 John Wiley & Sons Ltd

Reverse transcriptase quantitative PCR for the detection of cytokine gene expression in ex vivo stimulated biopsies. After thawing on ice, biopsies were homogenized in 350 ll RLT lysis buffer each (Qiagen, Manchester, UK), using 5-mm stainless steel beads (Qiagen) and the Mixer Mill MM300 tissue grinder (Retch, Leeds, UK). Total RNA was extracted using the RNeasy micro kit including an oncolumn DNAse treatment (Qiagen) as per manufacturer’s instructions. Samples were eluted in 30 ll distilled water. RNA quantity and quality was assessed using the Eukaryote Total RNA Nano chip with the Agilent BioAnalyzer (Agilent Technologies, Wokingham, UK). Mean RIN for duodenal samples was 6.2 (SD 0.75), which is similar to RIN values from fresh duodenal biopsies in our laboratory (data not shown). No DNA contamination could be detected in any sample. Reverse transcription was performed using a total RNA concentration of 400 ng per reaction with the iScript cDNA synthesis kit (Bio-Rad, Hemel Hampstead, UK), which uses a mixture of oligo-dT and random nonamer primers. To obtain positive controls suitable for subsequent quantitative polymerase chain reaction (qPCR) analysis, parts of the canine sequences for the genes of interest and three reference genes were cloned as described previously [31]. These plasmids were used in a 10-fold dilution (107 molecules ll1–101 molecules ll1) to create a standard curve for each gene and run and to assess assay efficiency. Each qPCR was performed in 20 ll, contained 200 nM of each primer and 1 ll of cDNA in addition to SsoFast Evagreen Supermix (Bio-Rad). Characteristics of the primers used can be found in Table 1. Cycling conditions consisted of an enzyme activation step at 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s, annealing temperature (see Table 2) for 10 s and elongation at 65 °C for 10 s. An additional 5 s melting step was included before each plate reading depending on the melting curve analysis of the respective PCR products (to melt primer dimers). Each reaction was carried out in triplicate. Melting curves were generated for each run to ensure a single amplicon had been produced. In all ex vivo stimulated duodenal samples, the expression of the following genes was quantified: TLR2, TLR4, TLR5, TLR9, IL-17A, IL-22, IL-4, IL-10, TGFb and PPARy [9, 32]. Reference genes used were GAPDH, TBP and SDHA, as described recently [33]. Gene expression was quantified by averaging the triplicate absolute gene copy number for each biological sample, following normalization of the expression of each target gene to the geometric mean of the three reference genes. Detection of cytokine protein concentrations via enzyme-linked immunosorbant assay in culture supernatants. Cytokine concentrations were measured in tissue culture supernatants using commercially available canine-specific ELISAs. In detail, detection of canine TNFa, IL-10, IFNy (Quantikine canine Immunoassay, R&D systems, Abingdon, UK) and

88 Culture of Canine IBD Tissues with TLR Ligands S. Schmitz et al. .................................................................................................................................................................. Table 2 Characteristics of primers used in conventional and quantitative polymerase chain reaction (PCR).

Gene

Forward primer (50 –30 )

Reverse primer (50 –30 )

Annealing temperature (°C)

PCR product size

NCBI accession number

GAPDH SDHA TBP TLR2 TLR4 TLR5 TLR9 IL-17A IL-22 IFN~a TNFa IL-4 IL-10 TGF^a PPARy

GGAGAAAGCTGCCAAATATG GGACAGAGCCTCAAGTTTGG GGGACCGCAGCAGATTACTA AGTGGCCAGAAAAGCTGAAA ATTCCTTTCCGGACAACTCC TGGGCGAGCTCTATGACTCT GCCTGGAGTACCTGCTCTTG CACTCCTTCCGGCTAGAGAA TCCAGCAGCCCTATATCACC TTCAGCTTTGCGTGATTTTG TCATCTTCTCGAACCCCAAG CTCACCTCCCAACTGATTCC TCTGTTGCTGCCTGGTCCT GCATGTGGAGCTGTACCAGA GGATTTCTCCAGCATTTCCA

ACCAGGAAATGAGCTTGACA GGCATCCTTCCGTAATGA GCCATAAGGCATCATTGGAC ATCCAGTTGCTCCTTCGAGA CTGGAGGGAGAGGAGAGGTT CTGAACGTCTGGTCCTGGAT AGGCTTTGGTTTTGGTGATG CACATGGCGAACAATAGGG TTGGCTTAGCTTGTTGCTGA CTGCAGATCGTTCACAGGAA CTGGTTGTCTGTCAGCTCCA TGCTGCTGAGGTTCCTGTAG TGATGTCTGGGTCGTGGTT TAGTACACGATGGGCAGTGG TATGAGACATCCCCACAGCA

55 56.3 60 54.3 54.3 55 55 60 60.2 54.3 53.6 56.4 54.3 55 59

194 412 267 263 200 100 327 166 254 353 135 289 300 609 413

NM_001003142.1 XM_535807.3 XM_849432.2 NM_001005264.2 NM_001002950. .2 NM_001197176.1 NM_001002998.1 NM_001165878.1 XM_538274.2 NM_001003174.1 NM_001003244.4 NM_001003159.1 NM_001003077.1 NM_001003309.1 NM_001024632.2

IL-17A (Canine IL-17A Duoset, R&D systems) was performed according to the manufacturer’s instructions. In supernatants from WB stimulation, IL-10 and TNFa protein induction were assessed as well. All reactions were carried out in duplicates, results of which were averaged. A standard curve and negative and positive control samples were included in all plates. Statistical analysis. Data were tested for normal distribution by inspection of histograms and Shapiro–Wilks test. Linear mixed effect models (IBM SPSS statistics, v19.0) were used to assess the effects of disease status, treatment group and their interaction on gene expression, and to account for the repeated measurements from the same dog. The model can be expressed as: gene expression = disease status + treatment + disease 9 treatment + dog + residual. If the effect of disease by treatment interaction or the treatment effect was significant, Fisher’s least significant difference (LSD) test was performed as post hoc test. A similar approach was chosen to analyse protein concentrations from WB data. As LPS stimulation of biopsies was only performed in FRE dogs, a separate linear mixed model was performed only on gene expression data from FRE biopsies to assess differences between LPS and other stimulants. If a significant difference was identified, Fisher’s LSD test was performed as post hoc test. Significance was set as P < 0.05.

Results Stimulation with TLR ligands (but not probiotic EF) induces differential gene expression changes depending on health status

In general, gene expression levels from biopsies were low, but amplification of reference genes was sufficient (data not shown). Overall, linear mixed effect models showed

significant differences for the expression of the following genes across both groups and all treatments: TLR2 (P < 0.001), TLR4 (P = 0.005), TLR9 (P < 0.001), TNFa (P < 0.001), IL-10 (P = 0.004) and IL-22 (P = 0.016) (see Fig. 1–4). In addition, even though overall mixed modelling did not show a significant difference for TLR5 expression (P = 0.397), there was a significant difference when comparing disease groups separately (P = 0.024, Fig. 1C) with TLR5 being decreased in dogs with FRE. An interaction between disease status and treatment of the biopsies was detected for TLR2 (Fig. 1A) and TLR9 (Fig. 1D) expression. For TLR4 (Fig. 1B) expression, a treatment effect was observed: TLR4 expression increased upon stimulation (independent of disease status; Fig. 1B), especially with Pam3CSK4 and LPS when compared to EF (P = 0.024). For TLR5 (Fig. 1C) expression, a group effect (but not treatment effect) was seen (with expression significantly lower in CE samples compared with control samples (P = 0.014). When assessing the expression of further cytokines, there was no significant difference in IFNy levels as representative cytokine for Th1 responses (P = 0.132; Fig. 2A). However, TNFa expression (which can be both a key cytokine of Th1 responses as well as innate immune cells like macrophages) was overall significantly higher in unstimulated samples from healthy dogs than in samples from FRE dogs (P = 0.014); EF treatment led to a significant reduction in TNFa gene expression in both groups (P = 0.001; Fig. 2B). For IL-4 (Fig. 2C), overall no significant differences were detected (P = 0.378), but when comparing disease groups, expression was significantly higher in FRE samples than in control samples (P < 0.001) without a significant effect of treatment. IL-10 and TGFb were investigated as representatives of regulatory T cell cytokines. Levels of IL-10 mRNA significantly increased upon stimulation with LPS and


S. Schmitz et al. Culture of Canine IBD Tissues with TLR Ligands 89 .................................................................................................................................................................. A

TLR2

B Copies/geo mean

0.2 0.1

0.4

0.2

C

Fl ag Pa C m C PB S FR EF E Fl FRE ag Pa FRE m LP FRE S FR E

S

C

C

PB

S

EF

PB

TLR5

C

Fl C ag Pa C m C PB S FR EF E Fl FRE ag Pa FRE m LP FRE S FR E

0.0

EF

Copies/geo mean

0.3

0.0

TLR9

D Copies/geo mean

0.20 0.15 0.10 0.05 0.00

0.4 0.3 0.2 0.1

PB

Fl C ag Pa C m C PB S FR EF E Fl FRE ag Pa FRE m LP FRE S FR E

S

C

C

Fl ag Pa C m C PB S FR EF E Fl FRE ag Pa FRE m LP FRE S FR E

S PB

EF

C

0.0

EF

Copies/geo mean

Figure 1 TLR mRNA expression from exvivo stimulated canine duodenal biopsies. Expression of TLR mRNA (relative quantification) by duodenal biopsies from healthy control dogs (C) and dogs with foodresponsive chronic enteropathy (FRE) when stimulated with Enterococcus faecium (EF), flagellin (Flag), Pam3CSK4 (Pam) or lipopolysaccharides (LPS) compared with phosphate-buffered saline (PBS) as negative control. Data are presented as box and whisker plots with the whiskers representing percentiles 10–90. *P < 0.05, ***P < 0.001.

TLR4 0.6

0.4

TNFa IFNy

A

B Copies/geo mean

0.4

0.2

0.2

S C EF C Fl ag Pa C m C PB S FR EF E Fl FR ag E Pa FR m E F LP RE S FR E

S C EF Fl C ag Pa C m C PB S FR EF E Fl FR ag E Pa FR m E F LP RE S FR E

PB

IL-4

C

0.10

0.05

S C EF Fl C ag Pa C m C PB S FR EF E Fl FR ag E Pa FR m E F LP RE S FR E

0.00

PB

Copies/geo mean

0.15

Pam3CSK4 when compared to unstimulated samples and EF (control vs. LPS P = 0.003; control vs. Pam P = 0.01; EF vs. LPS P = 0.003; EF vs. Pam P = 0.009; Fig. 3A), whereas no significant difference could be detected for mRNA expression levels of TGFb (P = 0.08; Fig 3B). PPARy is a nuclear receptor stimulated by bacterial


0.4

0.0

0.0

Figure 2 Th1 and Th2 cytokine mRNA expression from ex-vivo stimulated canine duodenal biopsies. Expression of cytokine mRNA (relative quantification) by duodenal biopsies from healthy control dogs (C) and dogs with food-responsive chronic enteropathy (FRE) when stimulated with Enterococcus faecium (EF), flagellin (Flag), Pam3CSK4 (Pam) or lipopolysaccharides (LPS) compared with phosphate-buffered saline (PBS) as negative control. Data are presented as box and whisker plots with the whiskers representing percentiles 10–90. *P < 0.05, **P < 0.01, ***P < 0.001.

0.6

PB

Copies/geo mean

0.6

products to downregulate inflammatory signals via NFΚB. Interestingly, neither ‘disease group’ nor ‘treatment’ had a significant effect on its expression (P = 0.091; Fig. 3C). Finally, the Th17-related cytokines IL-17 and IL-22 were investigated. No significant difference could be detected for

90 Culture of Canine IBD Tissues with TLR Ligands S. Schmitz et al. .................................................................................................................................................................. IL-10

A 0.20

1.5

Copies/geo mean

Copies/geo mean

TGFb

B

0.15 0.10 0.05 0.00

1.0

0.5

PB

PB

S C EF C Fl ag C Pa m C PB S FR EF E Fl FR ag E Pa FR m E LP F R E S FR E

S C EF Fl C ag C Pa m C PB S FR EF E Fl FR ag E Pa FR m E LP F R E S FR E

0.0

PPARy

C Copies/geo mean

15

10

5

PB

S C EF Fl C ag C Pa m C PB S FR EF E Fl FR ag E Pa FR m E LP FRE S FR E

0

IL-17

A

Figure 3 mRNA expression of “antiinflammatory” genes from ex-vivo stimulated canine duodenal biopsies. Expression of mRNA (relative quantification) of IL-10 (A), TGFb (B) and PPARz (C) by duodenal biopsies from healthy control dogs (C) and dogs with food-responsive chronic enteropathy (FRE) when stimulated with live Enterococcus faecium (EF), flagellin (Flag), Pam3CSK4 (Pam) or lipopolysaccharides (LPS) compared with phosphate-buffered saline (PBS) as negative control. Data are presented as box and whisker plots with the whiskers representing percentiles 10–90. **P < 0.01.

IL-22

B

0.01

PB

S C EF Fl C ag Pa C m C PB S FR EF E Fl FRE ag Pa FR m E F LP RE S FR E

0.00

*

**

0.4

0.2

0.0

S C EF C Fl ag Pa C m C PB S FR EF E Fl FRE ag Pa FR m E F LP RE S FR E

0.02

Copies/geo mean

0.03

0.6

PB

Copies/geo mean

0.04

Figure 4 Th17-related mRNA expression from ex-vivo stimulated canine duodenal biopsies. Expression of cytokine mRNA (relative quantification) of IL17A (A) and IL-22 (B) by duodenal biopsies from healthy control dogs (C) and dogs with food-responsive chronic enteropathy (FRE) when stimulated with live Enterococcus faecium (EF), flagellin (Flag), Pam3CSK4 (Pam) or lipopolysaccharides (LPS) compared with phosphate-buffered saline (PBS) as negative control. Data are presented as box and whisker plots with the whiskers representing percentiles 10–90. *P < 0.05, **P < 0.01.

mRNA expression levels of IL-17A (P = 0.144; Fig. 4A). However, LPS significantly increased IL-22 expression in FRE samples compared with PBS (P = 0.002) and EF (P = 0.008; Fig. 4B).

whereas TNFa protein production from WB was different across groups (P < 0.001). Its expression increased significantly with EF stimulation (P < 0.001), which was independent of disease status (Fig. 5).

EF stimulation increases TNFa protein production from whole blood

Discussion

In supernatants from ex vivo stimulated biopsies, no TNFa, IFNy, IL-17A or IL-10 protein could be detected by ELISA. When assessing protein production from WB stimulation, it was found that IL-10 production did not differ significantly across ‘disease groups’ or ‘treatments’,

Few studies have investigated the effects of probiotic bacteria in dogs [22, 24, 25], and to our knowledge, the present study is the first to use EF in a canine ex vivo biopsy model. EF seems to be an unusual choice of probiotic considering that in humans, mostly lactobacilli and bifidobacteria are used. However, EF is the only probiotic


S. Schmitz et al. Culture of Canine IBD Tissues with TLR Ligands 91 .................................................................................................................................................................. TNFa

A

PB

S C EF Fl C ag Pa C m LP C PB S C S F EF RE Fl FR ag E Pa FR m E LP F R S E FR E

0

100 50 0 S C EF C Fl ag Pa C m LP C PB S C S F EF RE Fl FR ag E Pa FR m E LP F R S E FR E

2000

IL-10 pg/ml

4000

150

PB

TNF alpha pg/ml

200

8000 6000

IL-10

B

10 000

Figure 5 Protein expression from canine whole blood. TNFa (A) and IL-10 (B) protein content of supernatants from whole blood stimulation in healthy control dogs (C) and dogs with food-responsive chronic enteropathy (FRE) as assessed via ELISA. Whole blood was stimulated with live Enterococcus faecium (EF), flagellin (Flag), Pam3CSK4 (Pam) or lipopolysaccharides (LPS) and compared with phosphate-buffered saline (PBS) as negative control. Data are presented as mean and standard deviation. ***P < 0.001 significance level compared to all other values.

product licensed for the administration to dogs and cats in Europe. It has been tested in several studies for its properties, and it has been found to have good survival capabilities in acidic or bile acid-enriched environments [34]. EF also belongs to the lactic acid-producing bacteria, and as lactic acid is proposed to mediate some of probiotics beneficial effects, EF could provide some of these. Additionally, several enterococci have been shown to produce antibacterial substances [35]. Probiotic strains have been shown to have strain-specific and host species-specific actions [36]. Hence, it is likely that every probiotic strain or combination of strains has to be tested separately in the target species and target disease and that effects seen in one strain cannot be inferred to similar bacteria. With regard to findings related to the dogs’ chronic gastrointestinal inflammation in the work presented here, it seems as if unstimulated duodenal tissue from FRE dogs does not have a striking ‘cytokine bias’ towards a specific T helper cell lineages. Hence, it is not comparable to human IBD, where either a strong Th1/Th17 response (Crohn’s disease) or IL-5 and IL-13 expression by natural killer T cells (ulcerative colitis) is observed [37]. Our data are consistent with previous studies that have assessed transcriptional levels of cytokines in FRE dogs compared with controls [38, 39]. Here, the general level of gene expression was found to be low, which we believe reflects truly low transcription levels of those cytokines investigated, as amplification of reference genes was good in all samples. Even though transcription levels were low, some significant differences could be detected in our study. In unstimulated duodenal biopsies from FRE dogs, expression of IL-4 mRNA was higher than in controls (see Fig. 2). Potentially, this could point towards a Th2 cell bias, but as other Th2-related cytokines (IL-5, IL-13) were not investigated, final conclusions about a potential Th2 predominance cannot be drawn at the current stage. Th17 cell cytokine gene expression (IL-17 and IL-22, see Fig. 2 and 4) was not significantly different between groups at baseline, which is consistent with previous findings from


our laboratory [31], making it unlikely that Th17 cells play a predominant role in canine CE. Th1 cell cytokines in unstimulated samples were either not different between groups (IFNy) or were lower in FRE samples (TNFa; see Fig. 2B). This differs from findings in human IBD, where TNFa expression is increased [40–42], making anti-TNFa biologicals one of the mainstays of treatment [43]. Our finding also highlights the fact that the pathogenesis and molecular mechanisms in canine FRE and other forms of CE are likely distinct from that seen in the human intestinal inflammation. Baseline expression of TLR9, which recognizes bacterial DNA, was lower in diseased dogs compared with healthy dogs (see Fig. 1D). In contrast, mRNA expression levels for TLRs recognizing bacterial surface expressed molecules, such as TLR2 and TLR4, were either higher in untreated FRE samples (see Fig. 1A) or not different between groups (see Fig. 1B). These findings are mostly contrary to other studies in dogs [16, 17, 44], which could be due to the fact that only food-responsive dogs were included into the present investigations, whereas prior studies have usually assessed gene expression in tissues from dogs with idiopathic (steroid-responsive) IBD. Similar to previous findings, baseline mRNA expression levels for TLR5 were significantly lower in dogs with FRE compared with healthy controls [44] (Fig. 1C). Stimulation with TLR ligands and EF introduced a wide variety of changes in the expression of different genes, similar to what has been described for the response of human colonic mucosa to lactic acid-producing bacteria [1]. Most changes were seen in biopsies from healthy dogs, with the exception of TLR4. The highest induction of TLR2 and TLR4 expression was seen upon incubation with Pam3CSK4 (a TLR1/2 ligand; see Fig 1A and B), an effect that was also seen with regard to TNFa mRNA, which showed higher levels in healthy dogs after Pam3CSK4 stimulation. In contrast, TNFa gene expression was suppressed with EF treatment, and this effect was pronounced in healthy biopsies compared with FRE

92 Culture of Canine IBD Tissues with TLR Ligands S. Schmitz et al. .................................................................................................................................................................. samples (see Fig. 2B). IL-17, IFNy and IL-4 expressions were not affected by stimulation, but IL-22 mRNA levels had a tendency to increase in FRE dogs, especially with LPS stimulation (see Fig. 4). Even though IL-22 is considered a Th17 cytokine, it can have an anti-inflammatory effect in the gut [45] and has been shown to protect mice from experimental colitis [46]. No significant differences in expression of PPARy were observed in stimulated duodenal samples, which was slightly unexpected, as Enterococci and other probiotic bacteria have been shown to regulate PPARy expression [32, 47–49]. However, the mechanisms of action of different probiotics are likely strain specific [9]. Thus, the exact properties of EF NCIMB 10415 as a probiotic remain to be investigated. Stimulation of biopsies with Pam3CSK4 and LPS induced an increase in production of IL-10. No change was seen in TGFb expression. Pam3CSK4 can induce IL-10 expression in human monocytes, where it was shown to activate the alternative NFΚB pathway, resulting in increased recruitment of the p52 subunit to the IL-10 promoter [50]. Whether the same mechanism led to the production of IL-10 in the biopsies used in the present study remains unclear, but is an attractive target for further investigations. Even though TGFb and IL-10 are typically considered to be cytokines related to regulatory T cells [51–53], they can be produced by a wide variety of cells [54]. Especially TGFb has been identified as an important factor for the development of several T helper cell subsets [54, 55]. Thus, these results do not allow definitive conclusions about the presence or absence of regulatory T cells in canine CE. It is interesting to note that the transcriptional changes induced in duodenal biopsies could not be mirrored by protein changes in the biopsy culture supernatants or in whole blood. We strongly suspect that the lack of detectable protein in biopsy culture supernatants is due to the large volume of medium used for culture (1 ml), which resulted in protein concentrations below the detection limit of the ELISAs. Unfortunately, experiments could not be repeated with smaller volumes of medium, as only a limited number of duodenal biopsies were available. TNFa and IL-10 could be detected in supernatants from whole blood, however: EF stimulation induced significantly higher concentrations of TNFa than other stimulants, while there was no difference detected for IL-10 production. Our findings support the notion that responses to bacterial stimuli differ by location. The intestinal tract has to remain tolerogenic to a vast number of commensal bacteria, while it makes sense that the presence of bacterial products or whole bacteria in the blood produces a prominent inflammatory response. Unfortunately, this limits the usefulness of WB assays as a diagnostic tool in canine CE, and further studies are required to see whether any parameter or WB response could be used as diagnostic marker.

The present study shows that stimulation of canine duodenal biopsies with TLR ligands can potentially induce an anti-inflammatory gene expression profile (downregulation of most TLRs and TNFa, upregulation of IL-10 and IL-22). Some of the responses seen were dependent on disease status and most of them were not consistently found with all stimulants. The effects of EF were limited to a reduction in TNFa and TLR2 in healthy dog biopsies, but not in biopsies from FRE dogs. Even though cytokine protein could not be detected in supernatants from ex vivo stimulated biopsies, we found protein responses in blood to be opposite of the transcriptional responses seen in the biopsies; that is, EF stimulation increased pro-inflammatory output (TNFa) from WB. The results of our study could point towards potential therapeutic targets for naturally occurring canine FRE. TLR ligands or EF might induce a more anti-inflammatory gene expression profile in vivo in dogs. However, the exact compounds needed to exert the maximum beneficial effect and their mechanisms of action still need to be defined. Further research is necessary to determine whether TLR ligands or EF are useful in a clinical situation.

Acknowledgment The authors would like to thank Dr Ruby Chang from the RVC for her help with the statistical analysis, as well as Nina Engelmann, Resident in Small Animal Medicine at the Small Animal Clinic in Giessen for her help in acquiring the biopsies from the healthy dogs. This study is funded through a Biotechnology and Biological Sciences Research Council (BBSRC) CASE Studentship with Protexin Veterinary Ltd. (Somerset, UK). The RVC manuscript approval number is VCS_569.

Author contributions SS was involved in performing the majority of the laboratory-based work (part of PhD) and writing of the manuscript. MH helped with laboratory work concerning control tissues and was involved in the writing of manuscript. RN contributed to intellectual input, provided healthy control dogs and workspace and performed corrections on the manuscript. DW was involved in creating the concept of presented work, troubleshooting, intellectual input and corrections on manuscript. KA was involved in conceptualising and planning of the presented work, provided the main work space and performed corrections on the manuscript.

Conflict of interests The authors declare no financial/commercial interest(s) associated with the product used in this study.


S. Schmitz et al. Culture of Canine IBD Tissues with TLR Ligands 93 ..................................................................................................................................................................

References 1 Bauerl C, Llopis M, Antolin M et al. Lactobacillus paracasei and Lactobacillus plantarum strains downregulate proinflammatory genes in an ex vivo system of cultured human colonic mucosa. Genes Nutr 2013;8:165–80. 2 Girard-Misguich F, Delgado-Ortega M, Berthon P et al. Porcine colon explants in the study of innate immune response to Entamoeba histolytica. Vet Immunol Immunopathol 2012;145:611–7. 3 Tsilingiri K, Barbosa T, Penna G et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut 2012;61:1007–15. 4 Sartor RB. Mechanisms of disease: pathogenesis of Crohn’s disease and ulcerative colitis. Nat Clin Pract Gastroenterol Hepatol 2006;3:390– 407. 5 Gustafsson JK, Ermund A, Johansson ME, Schutte A, Hansson GC, Sjovall H. An ex vivo method for studying mucus formation, properties, and thickness in human colonic biopsies and mouse small and large intestinal explants. Am J Physiol Gastrointest Liver Physiol 2012;302:G430–8. 6 Bell AJG, Nicholls RJ, Forbes A, Ellis HJ, Ciclitira PJ. Human lymphocyte stimulation with pouchitis flora is greater than with flora from a healthy pouch but is suppressed by metronidazole. Gut 2004;53:1801–5. 7 Cary VA, Boullata J. What is the evidence for the use of probiotics in the treatment of inflammatory bowel disease? J Clin Nurs 2010;19:904–16. 8 Claes IJ, De Keersmaecker SC, Vanderleyden J, Lebeer S. Lessons from probiotic-host interaction studies in murine models of experimental colitis. Mol Nutr Food Res 2011;55:1441–53. 9 Thomas CM, Versalovic J. Probiotics-host communication: modulation of signaling pathways in the intestine. Gut Microbes 2010;1:148– 63. 10 Bai AP, Ouyang Q, Xiao XR, Li SF. Probiotics modulate inflammatory cytokine secretion from inflamed mucosa in active ulcerative colitis. Int J Clin Pract 2006;60:284–8. 11 Abreu MT. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 2010;10:131–44. 12 Hart AL, Lammers K, Brigidi P et al. Modulation of human dendritic cell phenotype and function by probiotic bacteria. Gut 2004;53:1602–9. 13 Stagg AJ, Hart AL, Knight SC, Kamm MA. Interactions between dendritic cells and bacteria in the regulation of intestinal immunity. Best Pract Res Clin Gastroenterol 2004;18:255–70. 14 Manuzak J, Dillon S, Wilson C. Differential interleukin-10 (IL-10) and IL-23 production by human blood monocytes and dendritic cells in response to commensal enteric bacteria. Clin Vaccine Immunol 2012;19:1207–17. 15 Lammers KM, Brigidi P, Vitali B et al. Immunomodulatory effects of probiotic bacteria DNA: IL-1 and IL-10 response in human peripheral blood mononuclear cells. FEMS Immunol Med Microbiol 2003;38:165– 72. 16 Burgener IA, Konig A, Allenspach K et al. Upregulation of toll-like receptors in chronic enteropathies in dogs. J Vet Intern Med 2008;22:553–60. 17 McMahon LA, House AK, Catchpole B et al. Expression of Toll-like receptor 2 in duodenal biopsies from dogs with inflammatory bowel disease is associated with severity of disease. Vet Immunol Immunopathol 2010;135:158–63. 18 Ogura Y, Bonen DK, Inohara N et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 2001;411:603–6. 19 Kathrani A, Holder A, Catchpole B et al. TLR5 risk-associated haplotype for canine inflammatory bowel disease confers hyperresponsiveness to flagellin. PLoS One 2012;7:e30117.


20 Kathrani A, House A, Catchpole B et al. Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs. PLoS One 2010;5: e15740. 21 Kathrani A, House A, Catchpole B, Murphy A, Werling D, Allenspach K. Breed-independent toll-like receptor 5 polymorphisms show association with canine inflammatory bowel disease. Tissue Antigens 2011;78:94–101. 22 Benyacoub J, Czarnecki-Maulden GL, Cavadini C et al. Supplementation of food with Enterococcus faecium (SF68) stimulates immune functions in young dogs. J Nutr 2003;133:1158–62. 23 Herstad HK, Nesheim BB, L’Abee-Lund T, Larsen S, Skancke E. Effects of a probiotic intervention in acute canine gastroenteritis–a controlled clinical trial. J Small Anim Pract 2010;51:34–8. 24 Simpson KW, Rishniw M, Bellosa M et al. Influence of Enterococcus faecium SF68 probiotic on giardiasis in dogs. J Vet Intern Med 2009;23:476–81. 25 Bybee SN, Scorza AV, Lappin MR. Effect of the probiotic Enterococcus faecium SF68 on presence of diarrhea in cats and dogs housed in an animal shelter. J Vet Intern Med 2011;25:856–60. 26 Schuller S, Lucas M, Kaper JB, Giron JA, Phillips AD. The ex vivo response of human intestinal mucosa to enteropathogenic Escherichia coli infection. Cell Microbiol 2009;11:521–30. 27 Borruel N, Carol M, Casellas F et al. Increased mucosal tumour necrosis factor alpha production in Crohn’s disease can be downregulated ex vivo by probiotic bacteria. Gut 2002;51:659–64. 28 Sauter SN, Allenspach K, Gaschen F, Grone A, Ontsouka E, Blum JW. Cytokine expression in an ex vivo culture system of duodenal samples from dogs with chronic enteropathies: modulation by probiotic bacteria. Domest Anim Endocrinol 2005;29:605–22. 29 Schmitz S, Henrich M, Neiger R, Werling D, Allenspach K. Comparison of TNFalpha responses induced by Toll-like receptor ligands and probiotic Enterococcus faecium in whole blood and peripheral blood mononuclear cells of healthy dogs. Vet Immunol Immunopathol 2013;153:170–4. 30 Deitschel SJ, Kerl ME, Chang CH, DeClue AE. Age-associated changes to pathogen-associated molecular pattern-induced inflammatory mediator production in dogs. J Vet Emerg Crit Care (San Antonio) 2010;20:494–502. 31 Schmitz S, Garden OA, Werling D, Allenspach K. Gene expression of selected signature cytokines of T cell subsets in duodenal tissues of dogs with and without inflammatory bowel disease. Vet Immunol Immunopathol 2012;146:87–91. 32 Are A, Aronsson L, Wang S et al. Enterococcus faecalis from newborn babies regulate endogenous PPARgamma activity and IL-10 levels in colonic epithelial cells. Proc Natl Acad Sci USA 2008;105:1943–8. 33 Vandesompele J, De Preter K, Pattyn F et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3:RESEARCH0034. 34 Laukova A, Marcinakova M, Strompfova V, Ouwehand AC. Probiotic potential of enterococci isolated from canine feed. Folia Microbiol 2008;53:5. 35 Bayoub K, Mardad I, Ammar E, Serrano A, Soukri A. Isolation and purification of two bacteriocins 3D produced by Enterococcus faecium with inhibitory activity against Listeria monocytogenes. Curr Microbiol 2011;62:7. 36 Shida K, Nanno M, Nagata S. Flexible cytokine production by macrophages and T cells in response to probiotic bacteria: a possible mechanism by which probiotics exert multifactional immune regulatory activities. Gut Microbes 2011;2:6. 37 Strober W, Fuss IJ. Proinflammatory cytokines in the pathogenesis of inflammatory bowel diseases. Gastroenterology 2011;140:1756–67. 38 German AJ, Helps CR, Hall EJ, Day MJ. Cytokine mRNA expression in mucosal biopsies from German shepherd dogs with small intestinal enteropathies. Dig Dis Sci 2000;45:7–17.

94 Culture of Canine IBD Tissues with TLR Ligands S. Schmitz et al. .................................................................................................................................................................. 39 De Majo M, Pugliese M, Galia S, Mazzullo G, La Camera E, Fera MT. Cytokine mRNA quantification in gastro-intestinal biopsies of dogs with idiopathic chronic enteropathies by Real Time RT-PCR: preliminary results. Vet Res Commun 2008;32 (Suppl. 1):S275–7. 40 Noguchi Y, Yoshikawa T, Marat D et al. Insulin resistance in cancer patients is associated with enhanced tumor necrosis factor-alpha expression in skeletal muscle. Biochem Biophys Res Commun 1998;253:887–92. 41 Murch SH, Braegger CP, Walker-Smith JA, MacDonald TT. Location of tumour necrosis factor alpha by immunohistochemistry in chronic inflammatory bowel disease. Gut 1993;34:1705–9. 42 MacDermott RP, Sanderson IR, Reinecker HC. The central role of chemokines (chemotactic cytokines) in the immunopathogenesis of ulcerative colitis and Crohn’s disease. Inflamm Bowel Dis 1998;4:54–67. 43 Ford AC, Sandborn WJ, Khan KJ, Hanauer SB, Talley NJ, Moayyedi P. Efficacy of biological therapies in inflammatory bowel disease: systematic review and meta-analysis. Am J Gastroenterol 2011;106: 644–59, quiz 60. 44 Allenspach K, House A, Smith K et al. Evaluation of mucosal bacteria and histopathology, clinical disease activity and expression of Tolllike receptors in German shepherd dogs with chronic enteropathies. Vet Microbiol 2010;146:326–35. 45 Monteleone I, Rizzo A, Sarra M et al. Aryl hydrocarbon receptorinduced signals up-regulate IL-22 production and inhibit inflammation in the gastrointestinal tract. Gastroenterology 2011;141:237–48, 48 e1. 46 Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Stevens S, Flavell RA. Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. Immunity 2008;29:947–57.

47 Eun CS, Han DS, Lee SH et al. [Probiotics may reduce inflammation by enhancing peroxisome proliferator activated receptor gamma activation in HT-29 cells]. Korean J Gastroenterol 2007;49:139–46. 48 Ewaschuk JB, Walker JW, Diaz H, Madsen KL. Bioproduction of conjugated linoleic acid by probiotic bacteria occurs in vitro and in vivo in mice. J Nutr 2006;136:1483–7. 49 Kelly D, Campbell JI, King TP et al. Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-gamma and RelA. Nat Immunol 2004;5:104–12. 50 Funderburg NT, Jadlowsky JK, Lederman MM, Feng Z, Weinberg A, Sieg SF. The Toll-like receptor 1/2 agonists Pam(3) CSK(4) and human beta-defensin-3 differentially induce interleukin-10 and nuclear factor-kappaB signalling patterns in human monocytes. Immunology 2011;134:151–60. 51 Lochner M, Peduto L, Cherrier M et al. In vivo equilibrium of proinflammatory IL-17+ and regulatory IL-10+ Foxp3+ RORgamma t+ T cells. J Exp Med 2008;205:1381–93. 52 Li MO, Wan YY, Flavell RA. T cell-produced transforming growth factor-beta1 controls T cell tolerance and regulates Th1- and Th17cell differentiation. Immunity 2007;26:579–91. 53 Shull MM, Ormsby I, Kier AB et al. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 1992;359:693–9. 54 Hirota K, Martin B, Veldhoen M. Development, regulation and functional capacities of Th17 cells. Semin Immunopathol 2010;32:3–16. 55 Veldhoen M, Uyttenhove C, van Snick J et al. Transforming growth factor-beta ‘reprograms’ the differentiation of T helper 2 cells and promotes an interleukin 9-producing subset. Nat Immunol 2008;9:1341–6.
