OLIGONUCLEOTIDES 16:58–67 (2006) © Mary Ann Liebert, Inc.
Stimulation of Innate Immune Responses by CpG Oligodeoxynucleotide in Newborn Lambs Can Reduce Bovine Herpesvirus-1 Shedding ANIL K. NICHANI,1,2 ANGELO MENA,1 RADHEY S. KAUSHIK,1,3 GEORGE K. MUTWIRI,1 HUGH G.G. TOWNSEND,1 ROLF HECKER,4 ARTHUR M. KRIEG,5 LORNE A. BABIUK,1 and PHILIP J. GRIEBEL1
ABSTRACT Stimulation of the innate immune system is potentially very important in neonates who have an immature adaptive immune system and vaccination cannot be used to reduce the risk of infection. CpG oligodeoxynucleotide (ODN) can stimulate innate immune responses in newborn chickens and mice, but similar studies are lacking in other mammalian species. We have shown previously that CpG ODN can both stimulate an acute-phase immune response and induce the antiviral effector molecule, 25-A synthetase, in adult sheep. Therefore, the immunostimulatory activity of A class and B class CpG ODN was evaluated in newborn lambs, and the capacity of CpG ODN-induced responses to reduce viral shedding was evaluated following aerosol challenge with the respiratory pathogen, bovine herpesvirus-1 (BHV-1). In vitro CpG ODN stimulation of peripheral blood mononuclear cells (PBMC) isolated from newborn lambs (3–5 days old) and adult sheep induced equivalent CpG-specific proliferative responses and interferon- (IFN-) secretion. CpG ODN-induced IFN- secretion by neonatal PBMCs was, however, significantly (p 0.01) enhanced 6 days after subcutaneous (s.c.) injection of 100 g/kg CpG ODN 2007. Newborn lambs injected s.c. with B class CpG ODN 2007 or the inverted GpC control ODN formulated in 30% Emulsigen (MVP Laboratories, Ralston, NE) displayed CpG ODN-specific increases in body temperature (p 0.0001), serum 25-A synthetase activity (p 0.0015), and serum haptoglobin (p 0.07). CpG ODN-treated lambs also displayed a transient reduction in viral shedding on day 2 postinfection (p 0.05), which correlated (p 0.03) with serum 25-A synthetase levels on the day of viral challenge. These observations confirmed that CpG ODNs effectively activate innate immune responses in newborn lambs and CpG ODN-induced antiviral responses correlated with a reduction in viral shedding. cific and is characterized by activation and recruitment of effector cells or molecules that can rapidly control potential pathogens. The vertebrate immune system has evolved to recognize unmethylated deoxycytidylatephosphate-deoxyguanylate (CpG) dinucleotides flanked by specific bases in bacterial DNA as a danger signal that
INTRODUCTION
I
NDUCTION OF INNATE IMMUNE RESPONSES enables the host to limit the spread of infectious organisms and directs the development of antigen-specific (adaptive) immunity. Innate immunity is not antigen or pathogen spe-
1
Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, S7N 5E3 Canada. Present address: Canadian Food Inspection Agency, Moose Jaw, SK, Canada S6H 7T2. 3 Department of Biology and Microbiology and Veterinary Sciences, South Dakota State University, Brookings, SD 57007. 4 QIAGEN GmbH, 40724 Hilden, Germany. 5 Coley Pharmaceutical Group, Wellesley, MA 02481. 2
58
59
CpG ODN PROTECT LAMBS
leads to the stimulation of innate defenses (Krieg et al., 1995). CpG motifs are relatively common (approximately 1 in 16 bases) in bacterial DNA, compared with suppression (approximately 1 in 60 bases) and selective methylation in the vertebrate DNA (Krieg and Wagner, 2000). The biologic activity of immunostimulatory CpG DNA sequences can be mimicked by synthetic oligodeoxynucleotides (ODN), which have been found to be potent in vivo immunostimulatory agents in chickens, rodents, and some nonhuman primates (Gomis et al., 2004; Krieg, 2002; Mutwiri et al., 2003). These studies indicated that CpG DNA could have significant therapeutic promise in the prevention and treatment of a variety of disorders, including infectious diseases, allergy, and cancer (Krieg, 2002; Mason et al., 2005). Studies on mouse and human cells have shown that CpG DNA directly stimulates specific subsets of leukocytes that express toll-like receptor 9 (TLR-9). B cells proliferate and secrete immunoglobulins and cytokines in response to CpG ODN (Krieg et al., 1995). In contrast, murine macrophages, monocytes, and dendritic cells (DC) respond to CpG ODN stimulation by secreting interleukin-6 (IL-6), IL-12, tumor necrosis factor- (TNF), interferon- (IFN-), and IFN- and increasing the expression of B7-1 and B7-2 costimulatory molecules and MHC class II (Ballas et al., 1996; Stacey et al., 1996; Sparwasser et al., 1997; Jakob et al., 1998), which improves the antigen presentation potential of these cells. These cytokines secondarily enhance the cytotoxic activity of natural killer (NK) cells and IFN- secretion (Ballas et al., 1996; Cowdery et al., 1996), and cytokines, such as IL-1 and IL-6, can induce an acute-phase response (Baumann and Gauldie, 1994). IFN- and IFN- activate a variety of antiviral effector mechanisms, including the intracellular enzyme 25-oligoadenylate (25-A) synthetase (Shindo et al., 1988). Furthermore, CpG ODNs with different nucleotide backbones and sequence motifs induce different profiles and kinetics of immune activation. A class CpG ODNs activate NK cells to produce IFN- and induce plasmacytoid dendritic cells (pDC) to produce IFN- following in vitro stimulation (Ballas et al., 1996; Kadowaki et al., 2001; Krug et al., 2001). B class CpG ODNs show enhanced B cell stimulatory properties but reduced NK stimulation compared with the A class ODNs (Boggs et al., 1997; Krieg, 2001).Thus, CpG ODN can directly and indirectly induce a broad array of innate immune responses. In vitro studies determined that the B class CpG ODN 2007 has immunostimulatory effects on peripheral blood mononuclear cells (PBMC) of many veterinary species, including sheep and cattle (Rankin et al., 2001; Mena et al., 2003a, b). This ODN also has potent adjuvant effects and induced a Th1-dependent immune response (Ioannou et al., 2002). We recently reported that CpG ODN 2007 also stimulated innate immune responses that included a
variety of acute-phase responses and the antiviral effector molecule 25-A synthetase in adult sheep (Nichani et al., 2004a). Stimulation of these responses is potentially of great importance in neonates, who are immunologically immature and consequently highly susceptible to infections (Bot, 2000). Immaturity of the neonatal immune system may limit its ability to recognize pathogenassociated molecular patterns (PAMPs) and mount a protective Th1 type immune response. In vitro stimulation of human cord blood leukocytes with CpG ODN induced substantially less IFN- secretion than in cells from adults (De Wit et al., 2004), but CpG ODN treatment protected newly hatched chicks from lethal Escherichia coli infection (Gomis et al., 2004). It has also been shown recently that CpG ODN treatment can protect neonatal mice against Listeria infection (Ito et al., 2005). However, CpG ODN-induced immune stimulation and immune protection have not been studied in neonates of other mammalian species. Thus, the present experiments were conducted to evaluate the immunostimulatory effects of CpG ODN in newborn lambs and to determine if these responses might protect against a respiratory viral infection.
MATERIALS AND METHODS Oligodeoxynucleotides Both B class CpG ODN (Rankin et al., 2001; Nichani et al., 2004a) and A class CpG ODN (Mena et al., 2003a; Nichani et al., 2004a) have been shown to be biologically active in sheep. Therefore, CpG ODN 2007 (B class) and 2336 (A class) and matched 2007GC and 2336GC control ODNs were used for in vitro stimulation of PBMC. The ODNs 2007 and 2336 were provided by Qiagen GmbH (Hilden, Germany). The control ODNs 2007GC and 2336GC were purchased from Operon (Alameda, CA). The ODN sequences are shown in Table 1, with CpG motifs indicated in bold. ODN sequences with phosphodiester nucleotides are shown in upper case, and phosphorothioate nucleotides are shown in lower case.
TABLE 1. ODN SEQUENCES ODN name 2007 2007GC 2336 2336GC
Class
Sequencea
B B A A
tcgtcgttgtcgttttgtcgtt tgctgcttgtgcttttgtgctt ggGGACGACGTCGTGGggggg ggGGAGCAGCTGCTGGggggg
a Bold, CpG motifs; upper case, ODN sequences with phosphodiester nucleotides; lower case, phosphorothioate nucleotides.
60
Isolation of PBMCs Blood was collected from the jugular vein of 10 Suffolk lambs (3–5 days old) and 5 mature Suffolk sheep (4–6 months old) in EDTA-treated vacutainer tubes (BD Biosciences, Mountain View, CA). Immediately after blood collection, half (n 5) of the newborn lambs were injected subcutaneously (s.c.) with ODN 2007 (0.1 mg/kg body weight) formulated in 0.5 mL of 30% Emulsigen (MVP Laboratories, Ralston, NE), and blood was collected from all animals 6 days later. PBMCs were isolated using 60% isotonic Percoll (Pharmacia Biotech AB, Uppsala, Sweden) as described previously (Gerdts et al., 2000). Cells were counted using a cell counter (Dual Diluter III, Coulter Electronics Ltd., Luton, England) and resuspended in Aim-V medium (GIBCO-BRL, Burlington, ON, Canada) containing 2% fetal bovine serum (FBS) (GIBCO-BRL).
Tissue culture conditions PBMCs were cultured in 96-well, round-bottom plates (Nunc, Naperville, IL) using Aim-V medium supplemented with 2% FBS, 100 IU/mL penicillin, 100 g/mL streptomycin sulfate, 0.25 g/mL amphotericin B, 2 mM L-glutamine (Sigma-Aldrich, St. Louis, MO), 50 M 2mercaptoethanol (Sigma-Aldrich), and 10 g/mL polymyxin B sulfate (Sigma-Aldrich). Lymphocyte proliferative response (LPR) assays were performed by incubating triplicate cultures of PBMCs (2 105 cells/well) with various doses (2, 5, and 10 g/mL) of ODNs 2007, 2336, 2007GC, and 2336GC, 5 g/mL concanavalin A (ConA), or medium alone at 37°C with 5% CO2 and 95% humidity for 72 hours. IFN- secretion assays were performed by incubating triplicate cultures of PBMCs (5 105/well) in a final volume of 200 L medium for 48 hours. Culture supernatants were collected and stored at 20°C until assayed for IFN- concentrations.
LPR assay During the final 6 hours of the 72-hour incubation period, PBMCs were pulsed with 0.4 Ci [5-3H]-methyl thymidine (Amersham Pharmacia, Piscataway, NJ) per well. Cells were harvested using standard liquid scintillation protocols, and 3H-methyl thymidine incorporation was quantified with a beta counter (Topcount, Packard Instrument Company, Meriden, CT). The LPR was calculated as the mean counts per minute (cpm) for triplicate cultures and expressed as a stimulation index (SI) (cpm in the presence of stimulus /cpm in the absence of stimulus). Optimal LPR responses were consistently observed with PBMCs isolated from both newborn lambs and mature sheep after stimulation with 2 g/mL CpG ODN 2007, and only these data are reported.
NICHANI ET AL.
Enzyme-linked immunosorbent assay (ELISA) for IFN- The ELISA used in this study was previously shown to detect both ovine and bovine IFN- (Nichani et al., 2004a), and the anti-IFN- antibodies used have been described previously (Hughes et al., 1994). Briefly, polystyrene microtiter plates (Immulon 2, Dynex Technology, Inc., Chantilly, VA) were coated with two mouse antibovine IFN- antibodies (IFN-A2 and IFN-A4) diluted in carbonate coating buffer (15 mM Na2CO3, 35 mM NaHCO3, pH 9.6). Two-fold serial dilutions of recombinant bovine IFN- (rBoIFN-) (Ciba-Giegy, Summit, NJ), starting at 1000 pg/mL, were used as standards. Following incubation of standards and samples in designated wells, the plates were washed before the addition of rabbit anti-BoIFN- antisera (Hughes et al., 1994). Biotinylated goat antirabbit IgG (Zymed, South San Fransisco, CA) and strepavidin-alkaline phosphatase (GIBCO-BRL) were used for detection of bound antibody. The assay was developed using p-nitrophenyl phosphate (Sigma-Aldrich) substrate, and the reaction was stopped by adding 0.3M EDTA. Optical density (OD) of the reaction product was measured at 405 nm using a 490-nm reference on a Benchmark microplate reader (Bio-Rad Laboratories, Hercules, CA). Sample concentrations were calculated using Microplate Manager 5.0.1 software (Bio-Rad). Optimal IFN- secretion was consistently observed with PBMCs after stimulation with 2 g/mL CpG ODN 2336, and only these data are reported.
Animals and experimental design Unmodified phosphodiester ODNs rapidly degrade in vivo, with a half-life of nearly 5 minutes (Sands et al., 1994). In contrast, A class ODNs that are partially protected at each end and especially B class CpG ODNs that have phosphorothioate backbones have increased in vivo stability, with a serum half-life of 30–60 minutes and a whole body elimination time of approximately 2 days (Farman and Kornbrust, 2003). Therefore, the B class ODN 2007 and 2007GC control ODN were used for in vivo studies. Two groups of 3–5-day-old lambs were injected s.c. with either CpG ODN 2007 (n 7) or ODN 2007GC (n 9) in 0.5-mL volume formulated in 30% Emulsigen. The ODN dose was 0.1 mg/kg body weight (0.5 mg per lamb) by s.c. route on experiment days 0 and 6. All lambs were challenged with bovine herpesvirus-1 (BHV-1) isolate 108, propagated in Madin-Darby bovine kidney (MDBK) cells (van Drunen Littel-van den Hurk et al., 1994) on experiment day 9. Aerosol challenge of each lamb with 107 plaque-forming units (PFU) of BHV1 was performed using a model 65 Devilbis Nebulizer (DeVilbis, Barrie, Ontario, Canada) as previously described (Gerdts et al., 2002) All lambs were housed in a
61
CpG ODN PROTECT LAMBS
single isolation room at the Vaccine and Infectious Disease Organization (VIDO) animal facility and were fed cow’s milk twice daily. All experiments were carried out in accordance with the Guide to the Care and Use of Experimental Animals, provided by the Canadian Council on Animal Care.
Clinical observations Rectal temperatures were recorded daily for a period of 2 weeks, and serum samples were collected on alternate days and stored at 20°C until analyzed for serum haptoglobin and serum 25-A synthetase levels. Nasal mucus was collected on alternate days beginning on the day of BHV-1 challenge. Cotton swabs were used to sample nasal mucus, and the swabs were immersed in 1 mL minimum essential medium (MEM) (GIBCO-BRL) prior to storage at 70°C. The BHV-1 titer in nasal secretions was quantified by plaque titration in microtiter plates with a neutralizing antibody overlay, as previously described (Gerdts et al., 2002). Clinical evaluations and laboratory analysis were performed by individuals blinded to individual animal treatment.
Serum haptoglobin assay Serum haptoglobin levels were determined by ELISA, as described previously (Nichani et al., 2004b). Briefly, 96-well microtiter plates (Immulon 2, Dynex Technology, Inc.) were coated with a monoclonal antibody (mAb) (clone 1D1) specific for the -subunit of bovine haptoglobin. After the plates were washed and blocked with Tris-buffered saline (TBS) containing 0.5% gelatin (Sigma-Aldrich), serially diluted serum samples were added to designated wells. After washing, the bound haptoglobin was detected using antihaptoglobin biotin-conjugated mAb (clone 1D1-biotin). The ELISA was developed using strepavidin-alkaline phosphatase (Jackson ImmunoResearch Lab. Inc., West Grove, PA) to detect bound, biotinylated antibody, and p-nitrophenyl phosphate was the substrate. The reaction was stopped by adding 0.3 M EDTA. OD was measured at 405 nm using a 490 nm reference on a Benchmark microplate reader. Sample concentrations were calculated using Microplate Manager 5.0.1 software.
Serum 25-A synthetase assay The activity of 25-A synthetase in serum was measured using a commercial radioimmunoassay kit (Eiken Chemical Company, Tokyo, Japan) as described previously (Nichani et al., 2004a).
Statistical analysis Standard descriptive statistics were calculated for all the data. The data were not normally distributed and
could not be satisfactorily transformed to normal distributions. Therefore, data were ranked, and then differences among treatment groups were examined. One-way analysis of variance (ANOVA) was used to analyze in vitro proliferation and cytokine secretion data using SPSS 12 software (SPSS Inc., Chicago, IL). If the result of the ANOVA were significant (p 0.05), the means of the ranks of the treatment groups were compared using Tukey’s test (p 0.05). Differences among the means of the ranks of the treatment groups in the in vivo experiments were compared using Student’s t-test, assuming unequal variance between groups (Statistix version 7.0, Analytical Software, Tallahassee, FL). Regression analysis was used to examine relationship between serum 25-A synthetase levels and viral shedding in nasal secretions.
RESULTS PBMCs from newborn lambs respond to in vitro CpG ODN stimulation PBMCs isolated from adult sheep have been shown to proliferate in response to B class CpG ODN and secrete IFN- in response to A class CpG ODN stimulation (Mena et al., 2003a; Nichani et al., 2004a). In the present study, PBMCs were isolated from adult sheep and newborn lambs and stimulated with an A class and B class CpG ODN and their respective GpC control ODNs. The control ODNs 2007GC and 2336GC did not induce a significant proliferative response (SI2) or detectable IFN secretion (10 pg/mL) after stimulation with 2, 5, or 10 g/mL ODN. B class CpG ODN 2007, however, induced proliferative responses in PBMCs of both newborn lambs and adult sheep, and maximal responses were observed with 2 g/mL ODN (Fig. 1A). There was no significant difference (p 0.05) in the amplitude of LPR for PBMCs isolated from neonatal and adult sheep, and a single s.c. injection of CpG ODN 2007 did not significantly alter the LPR of PBMC isolated from newborn lambs (Fig. 1A, D.11-Neo CpG). IFN- secretion was not detected after stimulation of PBMCs with 2, 5, or 10 g/mL B class CpG ODN 2007, but 2 g/mL A class ODN 2336 induced maximal IFN- secretion by PBMCs isolated from both newborn and adult sheep (Fig. 1B). There was no significant difference (p 0.05) in CpG ODN-induced IFN- secretion responses of PBMCs isolated from adult and newborn lambs, but 6 days after s.c. injection of CpG ODN 2007, there was significantly (p 0.01) increased IFN- secretion following in vitro stimulation with CpG ODN 2336 (Fig. 1B). These observations confirmed that PBMCs isolated from newborn lambs displayed CpG-specific responses, and when compared within the same assay, these responses were quan-
62
NICHANI ET AL.
FIG. 1. CpG ODN-induced responses of PBMCs before and after CpG ODN injection into newborn lambs. (A) B class CpG ODN 2007 (2 g/mL)-induced proliferative responses are expressed as a stimulation index (SI) relative to cells cultured in medium. (B) A class CpG ODN 2336 (2 g/mL) induced IFN- secretion. CpG ODN-induced responses were assayed at 5 days of age (D.5-Neo, n 10), and following blood collection, half the lambs were injected with saline (D.11-Neo, n 5) and half the lambs were injected s.c. with 0.1 mg CpG ODN 2007 per kg body weight (D.11-Neo CpG, n 5). CpG ODN-induced responses were then assayed with PBMCs isolated 6 days after injecting CpG ODN. PBMCs isolated from five mature sheep (AdultD.5, Adult-D.11) were included in all assays to provide a comparison within and between assays. Data presented are the mean and 1 standard deviation (SD) of values from each group. **p 0.01
titatively and qualitatively similar to those observed with PBMCs isolated from adult sheep.
CpG ODN induces acute-phase responses in newborn lambs Stimulation of murine macrophages, monocytes, and myeloid DCs by CpG ODN in vitro leads to increased expression of costimulatory molecules and proinflammatory cytokines (Ballas et al., 1996; Stacey et al., 1996; Sparwasser et al., 1997; Jakob et al., 1998). CpG ODN stimulation also induces IL-6 secretion by human B cells (Hartmann and Krieg, 2000) and increased IFN secretion by human pDCs (Ballas et al., 1996; Krug et al., 2001). These proinflammatory cytokines can induce hepatocyte production of acute-phase proteins, such as haptoglobin (Godson et al., 1995), and IFN- is a potent inducer of 25-A synthetase, an important antiviral effector molecule (Sen and Ransohoff, 1993). It was not possible to directly measure serum cytokine levels in lambs after CpG ODN injection because these cytokines are short-lived and frequently are below ELISA detection limits. We, therefore, measured responses known to be induced by these cytokines. B class CpG ODN 2007 (100 g/kg body weight) induced an acute-phase response in adult sheep charac-
terized by a transient elevation of rectal temperature, increased serum haptoglobin levels, and increased 25-A synthetase activity in serum (Nichani et al., 2004a). Therefore, the same dose of CpG ODN 2007 was used in the present investigation. Rectal temperatures of newborn lambs did not change after the first injection of CpG or GpC control ODN, but a second ODN injection on day 6 induced significantly increased rectal temperatures (40.3°C vs. 39.0°C, p 0.0001) in the CpG group but not in the ODN 2007GC controls (Fig. 2A). Serum haptoglobin was also elevated in the CpG ODN-treated group compared with the GpC ODN-treated group (Fig. 2B), but the difference between groups was not significant (p 0.07). Serum 25-A synthetase activity (Fig. 2C) was much higher in the CpG ODN-treated than the GpC ODNtreated lambs on day 4 and remained elevated until the end of the experiment (p 0.0015). Thus, analysis of acute-phase responses confirmed that CpG ODN 2007 had immune stimulatory activity in the neonate.
CpG ODN treatment reduces BHV-1 shedding Several reports indicate that CpG ODN can protect mice against infection by a variety of viral pathogens, including herpes simplex virus (HSV) (Ashkar et al., 2003;
63
CpG ODN PROTECT LAMBS
FIG. 2. Responses in newborn lambs after s.c. CpG or GpC ODN injection. (A) Rectal temperature. (B) Serum haptoglobin. (C) Serum 25-A synthetase. Median responses of animals (CpG, n 7; GpC, n 9) are shown. Values bearing different superscripts are significantly different from each other (p 0.05).
Harandi et al., 2003), vaccinia virus (VV) (Rees et al., 2005), and respiratory syncytial virus (RSV) (Cho et al., 2001). Therefore, CpG ODN induction of high serum 25-A synthetase levels in newborn lambs prompted us to investigate the possible antiviral activity of CpG ODN treatment. For this investigation, we used a BHV-1 respiratory challenge model that has been used previously in newborn lambs (Gerdts et al., 2002). Maximum viral shedding occurred 2 days postchallenge (Fig. 3), with a high level of infectious virus in the nasal secretions of all control GpC ODN-treated lambs, but a significantly lower (p 0.05) and more variable level of virus was shed in nasal secretions of CpG ODN 2007-treated lambs (Fig. 3A). No differences in viral shedding were observed between the treatment groups on days 4 and 6 postinfection, but regression analysis (Fig. 3B) revealed a significant correlation (p 0.03) between increased levels of serum 25-A synthetase activity on the day of viral challenge and decreased viral shedding on day 2
postinfection (r2 0.29). There was, however, also a direct relationship (r2 0.23) between the level of viral shedding and IFN- and IFN- secretion in the nasal mucus on day 2 postinfection (data not shown).
DISCUSSION Synthetic CpG ODNs have potent immune stimulatory effects in rodents, chickens, and other vertebrate species, indicating that they might have significant therapeutic value for a variety of disorders, including infectious diseases, allergy, and cancer (Kreig, 2002; Mason et al., 2005). Stimulation of innate immune responses is very important in early neonatal life when the immune system is naive and there is maximum risk of infection. We have shown previously that CpG ODN can stimulate the innate immune system in sheep (Mena et al., 2003a; Nichani et al., 2004a). CpG ODN had Th1-biased adju-
64
NICHANI ET AL.
A
B
FIG. 3. Viral shedding in nasal secretions and the correlation with serum 25-A synthetase levels. Newborn lambs were injected s.c. with either CpG ODN 2007 (CpG, n 7) or control GpC ODN 2007 (GpC, n 9) and then aerosol challenged with BHV-1. (A) Shedding of infectious virus in nasal secretions. Data presented are values for individual lambs, and the bar represents the median value for each group. Significant differences (p 0.05) in viral shedding are indicated. (B) Regression analysis of the ranked values for serum 25A-synthetase levels on the day of BHV-1 challenge and the level of viral shedding in nasal secretion on day 2 postinfection. Values from both the CpG ODN 2007-treated (n 7) and the control GpC ODN-treated (n 9) groups were included in the analysis (r2 0.29, p 0.03).
vant activity in neonatal mice (Brazolot Millan et al., 1998), and CpG ODN treatment enhanced disease protection in newborn mice and chickens (Gomis et al., 2004; Ito et al., 2005). Therefore, we evaluated the innate immune stimulatory effects of CpG ODN in newborn lambs and report for the first time that a B class CpG ODN induced immune stimulatory effects in neonates of a mammalian species other than mouse. Furthermore, induction of such responses also led to a moderate reduction in viral shedding on the second day after a respiratory herpesvirus infection. These observations support the conclusion that CpG ODN might be a useful therapy for enhancing neonatal immune protection and decreasing the severity of viral respiratory infections. We have shown previously that in vitro stimulation of adult sheep PBMCs with A class CpG ODN induced IFN- production (Mena et al., 2003a; Nichani et al., 2004a) and B class CpG ODN induced proliferation of ovine PBMCs (Mena et al., 2003a). In the present experiment, a direct comparison of PBMCs isolated from newborn lambs and adult sheep revealed a similar pattern and amplitude of CpG-specific responses to both A class and B class CpG ODN (Fig. 1). This limited analysis of CpGspecific responses supports the conclusion that PBMCs from neonates were responsive to CpG ODN stimulation in a manner similar to PBMCs from adult sheep. These observations are consistent with a previous report by Tasker and Marshall-Clarke (2003) that B cells isolated from newborn infants and adults displayed similar CpG ODN-induced proliferative responses. The observed A
class CpG ODN-induced secretion of IFN- by neonatal sheep PBMCs, however, differed markedly from the response reported by De Wit et al. (2004) for human cord blood. This difference between neonatal human and sheep blood leukocytes may reflect an interspecies difference in pDC function or may be attributed to a difference in the A class CpG ODN used in these two studies. A more detailed analysis of CpG-specific responses may reveal qualitative differences in the responses of ovine neonatal and adult leukocytes, as the blood of newborn lambs is characterized by a lymphopenia (Bassett and Alexander, 1971). The observation that prior in vivo exposure to CpG ODN enhanced in vitro IFN- secretion responses does suggest, however, that repeated treatment with CpG ODN may be an effective strategy to enhance CpG ODN stimulation of innate immune responses. Sustained induction of innate immune responses by CpG ODN may be particularly beneficial in early neonatal life, when the immune system is still naive and there is an increased risk of acquiring infections (Butts et al., 1998; Gerdts et al., 2002). The acute-phase response is an integral part of innate immune responses and is observed after either injury or infection (Baumann and Gauldie, 1994). We have shown that s.c. injection of a B class CpG ODN in adult sheep induced an acute-phase response characterized by transiently elevated rectal temperatures, a mild neutrophilia, increased serum haptoglobin, and increased serum 25A synthetase levels (Nichani et al., 2004b). In contrast to mice and humans, CpG ODN exerted strong innate im-
65
CpG ODN PROTECT LAMBS
munostimulatory effects in cattle and sheep only when the CpG ODN was formulated in Emulsigen, a lipidbased carrier (Nichani et al., 2004a,b). Therefore, ODN were formulated in Emulsigen for the present investigation, and the dose of ODN (0.1 mg/kg) was similar to that previously shown to induce optimal innate immune responses in adult sheep. The first CpG ODN injection did not induce an increase in neonatal rectal temperature but did induce increased levels of serum haptoglobin and 25-A synthetase levels (Fig. 2). The presence of a fever response after the second but not the first CpG ODN injection may be consistent with a previous observation that newborn lambs were less able to mount a fever response (Cooper et al., 1979), or as suggested by the data in Figure 1, the first CpG ODN injection may have enhanced responsiveness to the second CpG ODN injection. Thus, with the exception of the fever response, CpG ODN effectively enhanced innate immune responses in the newborn lamb. Of particular note was the increased level of serum 25-A synthetase, which is an important intracellular antiviral effector molecule induced by IFNs (Sen and Ransohoff, 1993). The increased serum 25-A synthetase activity in neonatal lambs was consistent with the observed capacity of PBMCs to secrete IFN- following in vitro CpG ODN stimulation. It should be noted, however, that the B class ODN 2007 did not induce detectable levels of IFN- secretion in vitro, but in vivo this CpG ODN induced an increased level of serum 25-A synthetase, an IFN-inducible factor. Thus, in vitro responses may not always be predictive of in vivo responses to CpG ODN. Newborn ruminants are susceptible to a variety of viral respiratory pathogens, and we selected BHV-1 as a challenge model because this virus has been shown to infect newborn lambs following aerosol challenge (Gerdts et al., 2002). A moderate reduction in viral shedding was observed in CpG ODN-treated lambs, and the decrease in viral shedding was significant only on day 2 postinfection (Fig. 3A) but there was no difference in viral shedding on days 4 and 6 postinfection. The inverse correlation between serum 25-A synthetase levels at the time of viral challenge and viral shedding on day 2 postinfection (Fig. 3B) provided further evidence that CpG ODN 2007 treatment was linked to the reduction in viral shedding. The relatively low level of antiviral activity observed following CpG ODN treatment, however, may be consistent with previous in vivo and in vitro experiments that demonstrated that BHV-1 was relatively resistant to the antiviral effects of recombinant IFN- (Babiuk et al., 1985) and BHV-1 was a potent inducer of IFN-mediated responses, such as 25-A synthetase (Bielefeldt-Ohmann et al., 1989). Thus, a sustained elevation of serum 25-A synthetase activity in the CpG ODN 2007-treated group after BHV-1 infection (Fig. 2C) may be consistent with
known host responses to this viral infection and suggests that CpG ODN-induced antiviral effects may be effective only during the early phase of BHV-1 infection. Alternatively, s.c. injection of CpG ODN may not have been the optimal route of delivery for the induction of antiviral responses in the upper respiratory tract of newborn lambs. Mucosal delivery of CpG ODN was able to protect mice against a mucosal infection by HSV-2 (Ashkar et al., 2003; Harandi et al., 2003), but parenteral delivery of CpG ODN was also able to protect against respiratory infections by RSV and influenza virus (Cho et al., 2001; Dong et al., 2003). Therefore, it remains to be determined if the route of CpG ODN delivery and the immune evasion capacity of individual pathogens are major factors limiting the efficacy of CpG ODN-induced respiratory disease protection in the neonate. We conclude, however, that CpG ODN effectively induced innate immune responses in the newborn lamb, and there was a significant correlation between CpG ODN-specific induction of the antiviral effector molecule, 25-A synthetase, and a reduction in shedding of a viral respiratory pathogen.
ACKNOWLEDGMENTS This work is published with the permission of the director of VIDO as journal series 397. We thank Dr. Kuldip Mirakhur, Dr. Don Wilson, Sherry Tetland, Amanda Giesbrecht, Jan Erickson, and Stacy Miskolczi for assistance with the care and management of animals. We also thank Elaine Van Moorlehem, Donna Dent, Ponn Benjamin, and Yurij Popowych for their excellent technical assistance. Financial support was provided by NIH (UO1 AI057264-01), Qiagen Inc, Merial, Natural Science and Engineering Research Council (NSERC), Canadian Adaptation and Rural Development (CARD), and CBRN Research and Technology Initiative (CRTI, RD0006). L.A.B. is a holder of the Canada Research Chair in Vaccinology.
REFERENCES ASHKAR, A.A., BAUER, S., MITCHELL, W. J., VIEIRA, J., and ROSENTHAL, K.L. (2003). Local delivery of CpG oligodeoxynucleotides induces rapid changes in the genital mucosa and inhibits replication, but not entry, of herpes simplex virus type 2. J. Virol. 77, 8948–8956. BABIUK, L.A, BIELEFELDT OHMANN, H., GIFFORD, G., CZARNIECKI, C.W., SCIALI, V.T., and HAMILTON, E.B. (1985). Effect of bovine I interferon on bovine herpesvirus type 1-induced respiratory disease. J. Gen. Virol. 66, 2383–2394. BALLAS, Z.K., RASMUSSEN, W.L., and KRIEG, A.M. (1996). Induction of NK activity in murine and human cells
66 by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157, 1840–1845. BASSETT, J.M., and ALEXANDER, G. (1971). Insulin, growth hormone and corticosteroids in neonatal lambs. Normal concentrations and the effects of gold. Biol. Neonate 17, 112–125. BAUMANN, H., and GAULDIE, J. (1994). The acute phase response. Immunol. Today 15, 74–80. BIELEFELDT-OHMANN, H., CAMPOS, M., GRIEBEL, P.J., and BABIUK, L.A. (1989). 2-5A oligo-A-synthetase activity in bovine peripheral blood leukocytes following bovine herpesvirus-1-induced respiratory disease: A prognostic indicator? J. Interferon Res. 9, 159–166. BOGGS, R.T., McGRAW, K., CONDON, T., FLOURNOY, S., VILLIET, P., BENNETT, C.F., and MONIA, B.P. (1997). Characterization and modulation of immune stimulation by modified oligonucleotides. Antisense Nucleic Acid Drug Dev. 7, 461–471. BOT, A. (2000). DNA vaccination and the immune responsiveness of neonates. Int. Rev. Immunol. 19, 221–245. BRAZOLOT MILLAN, C.L., WEERATNA, R., KRIEG, A.M., SIEGRIST, C.A., and DAVIS, H.L. (1998). CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice. Proc. Natl. Acad. Sci. USA 95, 15553–15558. BUTTS, C., ZUBKOFF, I., ROBBINS, D.S., CAO, S., and SARZOTTI, M. (1998). DNA immunization of infants: Potential and limitations. Vaccine 16, 1444–1449. CHO, J.Y., MILLER, M., BAEK, K.J., CASTANEDA, D., NAYAR, J., ROMAN, M., RAZ, E., and BROIDE, D.H. (2001). Immunostimulatory DNA sequences inhibit respiratory syncytial viral load, airway inflammation, and mucus secretion. J. Allergy Clin. Immunol. 108, 697–702. COOPER, K.E., VEALE, W.L., KASTING, N., and PITTMAN, Q.J. (1979). Ontogeny of fever. Fed. Proc. 38, 35–38. COWDERY, J.S., CHACE, J.H., YI, A.K., and KRIEG, A.M. (1996). Bacterial DNA induces NK cells to produce IFNgamma in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156, 4570–4575. DE WIT, D., OLISLAGERS, V., GORIELY, S., VERMEULEN, F., WAGNER, H., GOLDMAN, M., and WILLEMS, F. (2004). Blood plasmacytoid dendritic cell responses to CpG oligodeoxynucleotides are impaired in human newborns. Blood 103, 1030–1032. DONG, L., MORI, I., HOSSAIN, M.J., LIU, B., and KIMURA, Y. (2003). An immunostimulatory oligodeoxynucleotide containing a cytidine-guanosine motif protects senescenceaccelerated mice from lethal influenza virus by augmenting the T helper type 1 response. J. Gen. Virol. 84, 1623–1628. FARMAN, C.A., and KORNBRUST, D.J. (2003). Oligodeoxynucleotide studies in primates: Antisense and immune stimulatory indications. Toxicol. Pathol. 31(Suppl), 119–122. GERDTS, V., BABIUK, L.A., VAN DRUNEN LITTEL-VAN DEN, H., and GRIEBEL, P.J. (2000). Fetal immunization by a DNA vaccine delivered into the oral cavity. Nat. Med. 6, 929–932. GERDTS, V., SNIDER, M., BROWNLIE, R., BABIUK, L.A., and GRIEBEL, P.J. (2002). Oral DNA vaccination in utero
NICHANI ET AL. induces mucosal immunity and immune memory in the neonate. J. Immunol. 168, 1877–1885. GODSON, D.L., BACA-ESTRADA, M.E., VAN KESSEL, A.G., HUGHES, H.P., MORSY, M.A., VAN DONKERSGOED, J., HARLAND, R.J., SHUSTER, D.E., DALEY, M.J., and BABIUK, L.A. (1995). Regulation of bovine acute phase responses by recombinant interleukin-1 beta. Can. J. Vet. Res. 59, 249–255. GOMIS, S., BABIUK, L., ALLAN, B., WILLSON, P., WATERS, E., AMBROSE, N., HECKER, R., and POTTER, A. (2004). Protection of neonatal chicks against a lethal challenge of Escherichia coli using DNA containing cytosinephosphodiester-guanine motifs. Avian Dis. 48, 813–822. HARANDI, A.M., ERIKSSON, K., and HOLMGREN, J. (2003). A protective role of locally administered immunostimulatory CpG oligodeoxynucleotide in a mouse model of genital herpes infection. J. Virol. 77, 953–962. HARTMANN, G., and KRIEG, A.M. (2000). Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164, 944–953. HUGHES, H.P., ROSSOW, S., CAMPOS, M., ROSSI-CAMPOS, A., JANSSEN, S., GODSON, D.L., DAFLON, B., VOIROL, M.J., GERBER, C., and BABIUK, L.A. (1994). A slow release formulation for recombinant bovine interferon alpha I-1. Antiviral Res. 23, 33–44. IOANNOU, X.P., GRIEBEL, P., HECKER, R., BABIUK, L.A., and VAN DRUNEN LITTEL-VAN DEN HURK, S. (2002). The immunogenicity and protective efficacy of bovine herpesvirus 1 glycoprotein D plus Emulsigen are increased by formulation with CpG oligodeoxynucleotides. J. Virol. 76, 9002–9010. ITO, S., ISHII, K.J., GURSEL, M., SHIROTRA, H., IHATA, A., and KLINMAN, D.M. (2005). CpG oligodeoxynucleotides enhance neonatal resistance to Listeria infection. J. Immunol. 174, 777–782. JAKOB, T., WALKER, P.S., KRIEG, A.M., UDEY, M.C., and VOGEL, J.C. (1998). Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: A role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161, 3042–3049. KADOWAKI, N., ANTONENKO, S., and LIU, Y.J. (2001). Distinct CpG DNA and polyinosinic-polycytidylic acid double-stranded RNA, respectively, stimulate CD11c-type 2 dendritic cell precursors and CD11c dendritic cells to produce type I IFN. J. Immunol. 166, 2291–2295. KRIEG, A.M. (2001). Now I know my CpGs. Trends Microbiol. 9, 249–252. KRIEG, A.M. (2002). CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20, 709–760. KRIEG, A.M., and WAGNER, H. (2000). Causing a commotion in the blood: Immunotherapy progresses from bacteria to bacterial DNA. Immunol. Today 21, 521–526. KRIEG, A.M., YI, A.K., MATSON, S., WALDSCHMIDT, T.J., BISHOP, G.A., TEASDALE, R., KORETZKY, G.A., and KLINMAN, D.M. (1995). CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374, 546–549. KRUG, A., ROTHENFUSSER, S., HORNUNG, V., JAHRSDORFER, B., BLACKWELL, S., BALLAS, Z.K., ENDRES, S., KRIEG, A.M., and HARTMANN, G. (2001). Identification of CpG oligonucleotide sequences with high
67
CpG ODN PROTECT LAMBS induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur. J. Immunol. 31, 2154–2163. MASON, K.A., ARIGA, H., NEAL, R., VALDECANAS, D., HUNTER, N., KRIEG, A.M., WHISNANT, J.K., and MILAS, L. (2005). Targeting toll-like receptor 9 with CpG oligodeoxynucleotides enhances tumor response to fractionated radiotherapy. Clin. Cancer Res. 11, 361–369. MENA, A., NICHANI, A.K., POPOWYCH, Y., GODSON, D.L., DENT, D., TOWNSEND, H.G., MUTWIRI, G.K., HECKER, R., BABIUK, L.A., and GRIEBEL, P. (2003a). Innate immune responses induced by CpG oligodeoxyribonucleotide stimulation of ovine blood mononuclear cells. Immunology 110, 250–257. MENA, A., NICHANI, A.K., POPOWYCH, Y., IOANNOU, X.P., GODSON, D.L., MUTWIRI, G.K., HECKER, R., BABIUK, L.A., and GRIEBEL, P. (2003b). Bovine and ovine blood mononuclear leukocytes differ markedly in innate immune responses induced by class A and class B CpGoligodeoxynucleotide. Oligonucleotides 13, 245–259. MUTWIRI, G., PONTAROLLO, R., BABIUK, S., GRIEBEL, P., VAN DRUNEN LITTEL-VAN DEN HURK, S., MENA, A., TSANG, C., ALCON, V., NICHANI, A., IOANNOU, X., GOMIS, S., TOWNSEND, H., HECKER, R., POTTER, A., and BABIUK, L.A. (2003). Biological activity of immunostimulatory CpG DNA motifs in domestic animals. Vet. Immunol. Immunopathol. 91, 89–103. NICHANI, A.K., KAUSHIK, R.S., MENA, A., POPOWYCH, Y., DENT, D., TOWNSEND, H.G., MUTWIRI, G., HECKER, R., BABIUK, L.A., and GRIEBEL, P.J. (2004a). CpG oligodeoxynucleotide induction of antiviral effector molecules in sheep. Cell. Immunol. 227, 24–37. NICHANI, A.K., MENA, A., POPOWYCH, Y., DENT, D., TOWNSEND, H.G., MUTWIRI, G.K., HECKER, R., BABIUK, L.A. and GRIEBEL, P.J. (2004b). In vivo immunostimulatory effects of CpG oligodeoxynucleotide in cattle and sheep. Vet. Immunol. Immunopathol. 98, 17–29. RANKIN, R., PONTAROLLO, R., IOANNOU, X., KRIEG, A.M., HECKER, R., BABIUK, L.A., and VAN DRUNEN LITTEL-VAN DEN HURK, S. (2001). CpG motif identification for veterinary and laboratory species demonstrates that sequence recognition is highly conserved. Antisense Nucleic Acid Drug Dev. 11, 333–340. REES, D.G., GATFS, A.J., GREEN, M., EASTAUGH, L., LUKASZEWSKI, R.A., GRIFFEN, K.F., KRIEG, A.M., and TITBALL, R.W. (2005). CpG-DNA protects against a lethal orthopoxvirus infection in a murine model. Antiviral Res. 65, 87–95.
SANDS, H., GOREY-FERET, L.J., COCUZZA, A.J., HOBBS, F.W., CHIDESTER, D., and TRAINOR, G.L. (1994). Biodistribution and metabolism of internally 3H-labeled oligonucleotides. I. Comparison of a phosphodiester and a phosphorothioate. Mol. Pharmacol. 45, 932–943. SEN, G.C., and RANSOHOFF, R.M. (1993). Interferon-induced antiviral actions and their regulation. Adv. Virus Res. 42, 57–102. SHINDO, M., OKUNO, T., MATSUMOTO, M., TAKEDA, M., TAKINO, T., SOKAWA, J., IWATA, A., and SOKAWA, Y. (1988). Serum 2,5-oligoadenylate synthetase activity during interferon treatment of chronic hepatitis B. Hepatology 8, 366–370. SPARWASSER, T., MIETHKE, T., LIPFORD, G., ERDMANN, A., HACKER, H., HEEG, K., and WAGNER, H. (1997). Macrophages sense pathogens via DNA motifs: Induction of tumor necrosis factor-alpha-mediated shock. Eur. J. Immunol. 27, 1671–1679. STACEY, K.J., SWEET, M.J., and HUME, D.A. (1996). Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157, 2116–2122. TASKER, L., and MARSHALL-CLARKE, S. (2003). Functional responses of human neonatal B lymphocytes to antigen receptor cross-linking and CpG DNA. Clin. Exp. Immunol. 134, 409–419. VAN DRUNEN LITTEL-VAN DEN HURK, S., VAN DONKERSGOED, J., KOWALSKI, J., VAN DEN HURK, J.V., HARLAND, R., BABIUK, L.A., and ZAMB, T.J. (1994). A subunit gIV vaccine, produced by transfected mammalian cells in culture, induces mucosal immunity against bovine herpesvirus-1 in cattle. Vaccine 12, 1295–1302.
Address reprint requests to: Dr. Philip J. Griebel Vaccine and Infectious Disease Organization 120 Veterinary Road University of Saskatchewan Saskatoon, Saskatchewan S7N 5E3 Canada E-mail:
[email protected] Received August 15, 2005; accepted in revised form January 10, 2006.
