Supplementary Information for

Download PDF
0 downloads 0 Views 667KB Size Report
Comment
This PDF file includes: Supplementary text ..... cup-5(ar465);ppk-3(n2688);ppk-3(n2835);. O. O. O. O. O. O. O. O ..... from (Paquin, N et al , 2017) vps-50 *. 62-cnu.
Supplementary Information for Genetic dissection of neuropeptide cell biology at high and low activity in a defined sensory neuron Patrick Laurent, QueeLim Ch’ng, Maelle Jospin, Changchun Chen, Juan Ramiro Lorenzo and Mario de Bono. Corresponding Authors: Patrick Laurent and Mario de Bono Email: [email protected]; [email protected] This PDF file includes: Supplementary text Figs. S1 to S4 Table S1 References for SI reference citations Other supplementary materials for this manuscript include the following: Dataset S1

1 www.pnas.org/cgi/doi/10.1073/pnas.1714610115

Supplementary Information Text Supplementary methods. Strains. The mutant strains used for crossings are listed in Supplementary Table 1 and below. We used DNA bombardment to generate two independent strains harboring an integrated pgcy-32::ins-1(genomic)-VENUS::unc-54 3’UTR transgene. Microparticle bombardment produces single- and low-copy chromosomal insertions and reduces the variation in expression observed from non-integrated transgenes1. The transgenic insertions were mapped and outcrossed 8x to generate strains OQ50 II and OQ51 V. Transgenic males from these strains were crossed with the mutants tested, and F2 progeny genotyped by PCR. A further integrated strain, OQ3, was generated that harbored a pgcy-32::ida-1(genomic)-mCherry::unc-54 3’UTR transgene. Other transgenes were expressed from multi-copy extrachromosomal DNA arrays. Transgenes from such arrays may be overexpressed or misexpressed. To control for this, we injected all constructs at a low DNA concentration (10–30ng/ul of the transgene of interest together with punc-122::mCherry at 30ng/ul), and checked at least 3 strains per transgene to confirm there was no major differences in marker expression and distribution between strains. All transgenes were generated using the three-fragment Gateway system (Invitrogen®). They include: pgcy-32::ins-1(genomic DNA)-VENUS::unc-54 3’UTR pgcy-32::ida-1(genomic)-mCherry::unc-54 3’UTR pgcy-32::ida-1(genomic)-mRFP::unc-54 3’UTR pmec-4::ins-1(genomic DNA)-VENUS::unc-54 3’UTR pmec-4::ins-1(genomic DNA)-mCherry::unc-54 3’UTR pgcy-32::ins-1(genomic DNA)-pHluorin::unc-54 3’UTR pgcy-32::hNPY(cDNA)-mCherry::unc-54 3’UTR 2

pgcy-32::elks-1-mRFP::unc-54 3’UTR pgcy-32::GFP-elks-1::unc-54 3’UTR pgcy-32::mKate2::unc-54 3’UTR pgcy-32::sad-1-GFP::unc-54 3’UTR pgcy-32::YC3.60::unc-54 3’UTR pgcy-32::syx-6(genomic)-mRFP::unc-54 3’UTR pgcy-32::unc-108(cDNA)-mCherry::unc-54 3’UTR pgcy-32::rab-5(cDNA)-mCherry::unc-54 3’UTR pgcy-32::pamn-1(genomic)-mRFP::unc-54 3’UTR For the last construct, we updated the Wormbase (www.wormbase.org) splicing prediction

for

pamn-1.

The

12th

and

13th

exons

are:

GTTCAAAGAGAAGAGGGCATGACGATCACGTCATCATCAGTTTCATTAGGAT GGCCATCTTTGGCACAGACCGATGCAAAATACAATTCATTTTTTGCTTTAATT GCTATTGCAATCCTCGTTTTGGGAGTGTATTGTGTTAGGAGAAGATGCAGAA ATCTGGAAAATGGTGGAGCTATTTTTGATAAGAGGGTGAGTGACAG and GGCTTCAAGCCACTTCGAACAGAAGAAACTGTTGGATTTAT CAGCGATGGATCAGAAAGTGA. Quantitative analysis. 1) Cultivation: We synchronized animals by allowing 20–50 gravid hermaphrodites to lay eggs for 4 – 6 h at 22°C on 2 NGM plates seeded with E. coli OP50. The resulting plates had a population of ~100–200 worms, which were grown to adulthood under standard conditions in air (21% O2). The adults on these plates were then maintained at 21% O2 (Plate 1) or 7% O2 (Plate 2) for 1 hour prior to imaging. A hypoxia chamber (Coy) was used to keep animals at 7% O2. Young adult hermaphrodites were immobilized using cold 25 mM sodium azide, and mounted on 2% agarose pads for imaging. 2) Imaging: The images for Figure 2B were acquired on a swept field confocal microscope (Prairie Technologies) using a 40x water objective (NA1.1). For the standard 3

quantification procedure, epifluorescence images were acquired on a Zeiss Axiovert 100 microscope using a 60× objective (NA 1.4) and an EMCCD camera (Photometrics) controlled using Metamorph software (Molecular Devices). In each experiment we assayed 4 – 12 strains simultaneously. Each strain was assayed 2-3 times independently to acquire 60–120 dorsally oriented animals per genotype. The axon was traced from the axon bend near the PQR cell body to the limits of the field of view using the linescan function in Metamorph 4.5. The local background was subtracted from the signal by measuring autofluorescence along but outside the axon. Traces were the analyzed further, as described below. We quantified the cell body fluorescence using the circle function in Metamorph 4.5. We imaged coelomocytes by finding 20–60 laterally oriented animals where the posterior coelomocyte was not obscured by other tissues. The mean posterior coelomocyte fluorescence was quantified for each genotype as previously described2. All fluorescence values in this study were normalized to the fluorescence of 0.5 µm FluoSphere beads (Molecular Probes) captured during each imaging session to provide a standard for comparing absolute fluorescence levels between animals from different sessions. 3) Puncta extraction: Fluorescence intensity along the axon was analyzed using custom software written in Igor Pro (Wavemetrics), as described previously3,4. Briefly, puncta were detected if 2x brighter than the median plus 20% standard deviation, and 0.3–10 µm long. These puncta corresponded to large clusters of DCVs, and were further analyzed to extract their fluorescence intensity, density per µm and width at half maximum. We also extracted the area under the curve, a measure of total fluorescence in the axon. The puncta-to-median ratio corresponds to the mean puncta fluorescence divided by the median fluorescence. Five mutants were suboptimal for linescan analysis because they lacked axonal fluorescence: unc-104, unc-108, hid-1, xbp-1, and ire-1. For these mutants the t-statistical differences are underestimated for the axonal parameters. 4) Clustering Analysis: The Student's t-statistic (𝑡 =

!! ! !! !! ! !! ! ! !! !!

) was used as a numerical

score to represent the statistical difference between wild type and mutant animals for each parameter: cell body fluorescence, puncta fluorescence, puncta density, width at half maximum, and area under the curve. This created a numerical profile of phenotypes for 4

further analysis. Correlation analysis was performed in Igor Pro (Wavemetrics). Hierarchical clustering was performed with Cluster 3.05; the 24 clustering methods used were all combinations of 6 distance measures (uncentered correlation, centered correlation, Spearman's Rank, Kendall's Tau, City-Block and Euclidean distance) and 4 linkage methods (maximum, minimum, centroid and average) (Supplementary Figure 2). We identified several robust clusters based on stringent criteria, that required clusters be detected by ≥10 of the 24 different clustering strategies used. The phenotypic profiles in these clusters also had to be significantly correlated (p3 consecutive frames. The % Time in each category was extracted for all particles. The start and end of each Run event was defined by pauses or reversals of particle movement, allowing run velocity to be extracted. The mean anterograde and retrograde velocity were calculated independently. The net velocity is calculated for all events together. Coelomocyte assay. To measure activity-induced release of INS-1-Venus, worms were synchronized as described above and raised to adulthood at 21% O2. At adulthood, the worms were maintained for 2 hrs either at 7% O2, or at 21% O2 (Fig. 2 and 7). Coelomocyte fluorescence was quantified as described above. Electrophysiology. Microdissection of C. elegans and electrophysiological methods were as described previously7. Membrane currents were recorded in the whole-cell configuration using an RK-400 patch-clamp amplifier (Bio-Logic, Claix, France). Acquisition and command voltage were controlled using pCLAMP9 software driving a 1322A Digidata (Molecular Devices, Sunnyvale, CA, USA). Data were analyzed and graphed using Mini Analysis (Synaptosoft, GA) and Origin (OriginLab, Northampton, 6

MA, USA) software. The resistance of recording pipettes was 2.5–3 MΩ. Recordings were performed after 1 min dialysis, and only on cells exhibiting resistances > 800 MΩ. Capacitance and resistance were not compensated. All experiments were performed at room temperature. The bath solution contained 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 10 mM glucose, 15 mM HEPES, 1 mM CaCl2 and sucrose to 340 mOsm (pH 7.35). The pipette solution contained 120 mM KCl, 20 mM KOH, 4 mM MgCl2, 5 mM N[Tris(hydroxymethyl)methyl]-2- aminoethanesulfonic acid, 0.25 mM CaCl2, 4 mM NaATP, 5 mM EGTA and sucrose to 335 mOsm (pH 7.2). All chemicals were obtained from Sigma-Aldrich.

7

100

% Voxels INS-1+ / NPY+

NPY-mCherry/INS-1-VENUS

95 90 Axon Cell Body

Fig. S1. NPY-mCherry and INS-1-VENUS fluorescence almost entirely overlap at 21% O2.

8

C

Distance measure methods 1 Uncentered correlation a 2 Uncentered correlation b 3 Uncentered correlation c 4 Uncentered correlation d 5 Centered correlation a 6 Centered correlation b 7 Centered correlation c 8 Centered correlation d 9 Spearman’s Rank a 10 Spearman’s Rank b 11 Spearman’s Rank c 12 Spearman’s Rank d

13 14 15 16 17 18 19 20 21 22 23 24

Kendall’s Tau a Kendall’s Tau b Kendall’s Tau c Kendall’s Tau d City Block a City Block b City Block c City Block d Euclidean distance a Euclidean distance b Euclidean distance c Euclidean distance d

Clustering methods a Pairwise complete-linkage b Pairwise single-linkage

c d

Pairwise centroid-linkage Pairwise average-linkage

Unique Clusters of alleles

B

Loss vs gain of function alleles; hypomorph vs null alleles Null allele vs other null allele Independent crossings, same allele

% Strain pairs that cluster

A

100 80 60 40 20 0

0 to 9 10 to 24 # Clustering Methods Clustering Methods

Unique_Clust Score size 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 dhc-1(or195);dnc-1(or404);unc-116(e2310); 24 3 O O O O O O O O O O O O O O O O O O O O O O O O ppk-3(n2688);ppk-3(n2835); 24 2 O O O O O O O O O O O O O O O O O O O O O O O O rund-1(tm3622)b;vps-50(ok2627); 24 2 O O O O O O O O O O O O O O O O O O O O O O O O tir-1(ok2859)b;tir-1(qd4)a; 24 2 O O O O O O O O O O O O O O O O O O O O O O O O K02E10.1(ok1871);K02E10.1(tm2564); 24 2 O O O O O O O O O O O O O O O O O O O O O O O O tbc-4(ok3041)a;tbc-4(ok3041)b; 24 2 O O O O O O O O O O O O O O O O O O O O O O O O stam-1(ok406)a;stam-1(ok406)b; 24 2 O O O O O O O O O O O O O O O O O O O O O O O O eat-16(ce71);eat-16(sa609); 23 2 O O O O O O O O O O O O O O O O O O O O O O O rab-3(js49);unc-10(md1117); 21 2 O O O O O O O O O O O O O O O O O O O O O pmk-3(tm745);unc-32(e189); 20 2 O O O O O O O O O O O O O O O O O O O O vps-52(ok853)a;vps-53(ok2864)b;vps-53(ok2864)c; 18 3 O O O O O O O O O O O O O O O O O O N2 V;N2V; 18 2 O O O O O O O O O O O O O O O O O O crml-1(gk3284);ubh-4(tm2310); 18 2 O O O O O O O O O O O O O O O O O O sad-1(ky289)a;sad-1(ky289)b; 17 2 O O O O O O O O O O O O O O O O O dkf-2(tm4076);ncs-1(qa401); 16 2 O O O O O O O O O O O O O O O O apt-9(ok3249);snt-5(ok3287); 16 2 O O O O O O O O O O O O O O O O itr-1(sa73);maco-1(nj21); 16 2 O O O O O O O O O O O O O O O O N2 II;lpd-3(ok2138); 16 2 O O O O O O O O O O O O O O O O arf-1.1(ok1840);arf-1.1(ok1840); 16 2 O O O O O O O O O O O O O O O O nab-1(ok943);strd-1(ok2283); 16 2 O O O O O O O O O O O O O O O O snt-4(ok503)b;syx-16(tm1330); 16 2 O O O O O O O O O O O O O O O O rei-1(tm6561);unc-16(js146); 16 2 O O O O O O O O O O O O O O O O amph-1(tm1060);tax-6(ok2065); 16 2 O O O O O O O O O O O O O O O O vps-52(ok853)a;vps-53(ok2864)b; 16 2 O O O O O O O O O O O O O O O O glsn-1(ok2979);unc-43(e498); 16 2 O O O O O O O O O O O O O O O O nhx-5(ok609);stn-1(ok406); 16 2 O O O O O O O O O O O O O O O O syd-2(ok217)a;unc-68(e540); 15 2 O O O O O O O O O O O O O O O ire-1(ok799);xbp-1(tm2482); 15 2 O O O O O O O O O O O O O O O cpx-1(tm3697);egl-30(ep271); 15 2 O O O O O O O O O O O O O O O lin-10(e1439);sek-1(ag1); 15 2 O O O O O O O O O O O O O O O apt-9(ok3249);apt-9(tm3776);snt-5(ok3287); 14 3 O O O O O O O O O O O O O O cup-5(ar465);ppk-3(n2688);ppk-3(n2835); 14 3 O O O O O O O O O O O O O O tom-1(ok188)a;tom-1(rb1887); 14 2 O O O O O O O O O O O O O O ric-19(ok833);unc-108(n501); 14 2 O O O O O O O O O O O O O O tom-1(ok188)b;tom-1(ok285); 14 2 O O O O O O O O O O O O O O ncs-1(tm437);sand-1(ok1963)b; 14 2 O O O O O O O O O O O O O O tom-1(ok188)a;tom-1(ok188)b;tom-1(ok285);tom-1(rb1887); 13 4 O O O O O O O O O O O O O ire-1(ok799);unc-104(1265);xbp-1(tm2482); 13 3 O O O O O O O O O O O O O tir-1(ok2859)a;tir-1(qd4)b; 13 2 O O O O O O O O O O O O O rap-1(pk2082);unc-14(e57); 12 2 O O O O O O O O O O O O dhc-1(or195);dnc-1(or404); 12 2 O O O O O O O O O O O O egl-3(n589);pmk-1(km25); 12 2 O O O O O O O O O O O O nhx-5(ok661);stn-1(ok292); 12 2 O O O O O O O O O O O O arl-5(oq7);elks-1(b) N2; 12 2 O O O O O O O O O O O O aex-6(sa699);rbf-1(js232); 12 2 O O O O O O O O O O O O pitp-1(tm1500);stn-2(ok2417)a; 12 2 O O O O O O O O O O O O dhc-1(or195);unc-116(e2310); 12 2 O O O O O O O O O O O O ric-19(ok833);unc-108(n501);vps-52(ok853)a;vps-52(ok853)b;vps-53(ok2864)b;vps-53(ok2864)c 11 6 O O O O O O O O O O O nhx-5(ok609);pitp-1(tm1500);stn-1(ok406);stn-2(ok2417)a; 11 4 O O O O O O O O O O O aex-6(sa699);egl-3(ok979);rbf-1(js232); 11 3 O O O O O O O O O O O pmk-3(tm745);rab-8(tm2526);unc-32(e189); 11 3 O O O O O O O O O O O aex-6(sa24)a;pkc-1(ik175); 11 2 O O O O O O O O O O O K02E10.1(ok1871);K02E10.1(tm2564);hid-1(jt722);wdfy-3(ok912) 10 4 O O O O O O O O O O act-2;act-3;lin-10(e1439);sek-1(ag1); 10 4 O O O O O O O O O O ric-4(md1088);unc-13(s69);unc-64(e246); 10 3 O O O O O O O O O O prab-3::xbp-1s(uthIs270);rabn-5(tm1555); 10 2 O O O O O O O O O O dkf-2(ok1704)a;prab-3::ppk-1(gqIs25); 10 2 O O O O O O O O O O N2 II;arf-1.2(ok796); 10 2 O O O O O O O O O O unc-13(s69);unc-64(e246); 10 2 O O O O O O O O O O dhc-1(or195);dnc-1(or404);egl-50;jnk-1(gk7);unc-116(e2310); 10 5 O O O O O O O O O O N2 V;N2V;rap-1(pk2082);unc-14(e57); 10 4 O O O O O O O O O O pkc-1(kp2342);unc-31(e928); 10 2 O O O O O O O O O O

Fig. S2. Clustering validation. A. The 24 unsupervised clustering methods used. B. Probing clustering using pairs of independently generated strains carrying the same or different null and non-null alleles. Shown is the % of strain pairs detected by ≤ 9 or ≥10 of the 24 unsupervised clustering methods. C. Details of the clustering results for each robust cluster of mutants detected by ≥10 methods. Shown is the size of each cluster, the identity of the genes, and the methods detecting the cluster. The methods # are as in A. 9

egl-3; egl-21

egl-21; ida-1

100 egl-3

80

ida-1

60

N2

40 20

egl-3; egl-21; ida-1

egl-21

TGN block

egl-3; ida-1

90

110

130

150

170

egl-3, egl-21, ida-1 regulated secretion

Coelomocyte fluorescence (A.U.)

120

5000

N2 egl-21 egl-3 ida-1 egl-3; ida-1

4500 4000 3500 3000 2500

190

7% O2

Cell body fluorescence (A.U.)

egl-3; unc-108 syx-6 14 rab-14 5 vps-52

40 20

hid-1

0 100

egl-3 g egl-3; syx-6 egl-3; hid-1 N2

unc-101

syd-2

arf-1.1 unc-11 unc-11 unc-108

120

egl-3;vps-52 egl-3; vps-52

140

160

egl-3; syd-2

180

5000

***

***

*** ***

4500 4000 3500 3000 2500

200

2

60

Secretory phenotype

7% O2 21% O 2

egl-33 egl-

egl-3; unc-101 egl-3; ; unc-11 ; arf-1.1 egl-3; egl-3; rab-14

80

D

eg

l-3

N

Cell body fluorescence (A.U.)

un l-3 c; u 108 nc -1 08 vp eg s l-3 -52 ;v ps -5 2 s eg yx l-3 -6 ;s yx -6 hi d eg l-3 -1 ;h id -1

DCV maturation cluster mutants +/- egl-3

21% O2

eg

C Puncta fluorescence (A.U.)

B

egl-3, egl-21, ida-1 phenotypes

Coelomocyte fluorescence (A.U.)

Puncta fluorescence (A.U.)

A

Maturation cluster mutants +/- mutations disrupting endolysosomal traffic 140

sand-1

120 stam-1

100 80

unc-108; sand-1

60

N2

40

vps-39

hid-1; stam-1

20 0

cup-5 unc-108; vps-39

hid-1 hid-1 unc-108 unc-108

90

110

130

150

170

190

210

Cell body fluorescence (A.U.)

230

F Axonal fluorescence (A.U.)

Puncta fluorescence (A.U.)

E

Maturation cluster mutants: axonal fluorescence 25

N2

20 vps-54

15 10 5 0 110

syx-6 vps-52

vps-51 vps-50

vps-50;unc-108 syx-6;unc-108 unc-108

120

130

140

150

160

Cell body fluorescence (A.U.)

Fig. S3. A. INS-1-Venus distribution in egl-3, egl-21 and ida-1 mutants at 21% O2. These genes encode candidate sorting receptors for neuropeptides in the TGN. Single, double and triple mutants do not show peptide retention in the TGN, i.e. high fluorescence in the cell body and low fluorescence in the axon (shading). B. Secretion at 7% O2 and 21% O2 is not altered by mutations in egl-3/PC2 or egl-21/CPE, and reduced secretion in ida-1 mutants is not improved in ida-1; egl-3 doubles. C. The distribution of INS-1-Venus fluorescence in mutants of the maturation cluster (green shading) is modified by an additional mutation in egl-3 (grey shading) at 21% O2. In comparison the syd-2 phenotype is not modified (magenta shading). D. The secretory phenotype of mutants of the maturation clusters is independent of neuronal activity level (7% and 21% O2) and is improved by disrupting egl-3/PC2. E. INS-1-Venus fluorescence levels in N2 and in unc-108/Rab2 animals increase in mutants with defects in endolysosomal trafficking (grey shading) at 21% O2. F. The distribution of INS-1-Venus fluorescence in mutants of the maturation cluster (green shading) and double mutants, including the total fluorescence in the axon. Bar graphs and scatter-plots represent mean ± SEM. 10

C. elegans orthologs of the top 20 specific interactors captured by the indicated Drosophila Rab-GTP (from Gillingham et al 2014). Orthologs were identified by BLAST. Dm RAB2 Dm RAB4 Dm RAB14 C.e Rab2/ unc-108 * C.e rab-14 * vps-15 vps-15 vps-15 rga-1 rga-1 rga-1 rabn-5 * rabn-5 * vps-50 * vps-50 * vps-52 * vps-52 * vps-53 * vps-53 * vps-51 * vps-51 * ubh-4 ubh-4 sar-1 sar-1 sel-2, wdfy-3 * sel-2, wdfy-3 * eipr-1 eipr-1 gcc-2 gcc-2 tbc-9 tbc-9 golg-4/F41H10.4 * golg-4/F41H10.4 * tbc-16

unc-26

vps-13 cccp-1 from (Ailion, M. et al) R12B2.2 gcc-1 C18C4.5 F13E9.1

vps-35 frm-3 * vps-54

tbc-11 lyst-1 vps-11 vps-33 vps-39 tbc-17

Protein complexes from the C. elegans literature Cell body fluorescence strongly reduced from (Ailion, M. et al, 2014) Cell body fluorescence strongly increased unc-108 * Cell body fluorescence not modified tbc-8 Not tested rund-1 * * fluorescence accumulation in the dendrite ric-19 * cccp-1 * GARP from (Luo, L. et al 2001) vps-54 vps-52 * vps-53 * vps-51 * from (Tapalidou, I. et al, 2016) eipr-1 from (Paquin, N et al , 2017) vps-50 * Protein complexes from Y2H literature HOPS complex vps-11 vps-33 vps-39 Without any known interactors in C. elegans hid-1 * syx-6 * K02E10.1 *

Fig. S4. Effectors of Drosophila RAB2, RAB4 and RAB141 include orthologs of genes found in maturation clusters (vps-51/52/53, vps-50, F41H10.4, unc-108) or sharing phenotypes with them (rab-14, vps-13, eipr-1, cccp-1). Some effectors show the opposite phenotype (rabn-5, lyst-1, vps-39), a few have no DCV phenotype (grey shade). Two complexes were previously shown to interact with C.e. RAB2 (cccp-1, rund-1, ric-19, tbc-8)2 and H.s. RAB4 vesicles (vps-50, vps-51/52/53)3,4. D.m. RAB2 also interacts with members of the HOPS complex (including vps-39).

11

Table S1. t-stat comparison of the OQ50 and OQ51 wild type strain phenotypes. 7% O2

CB

Punc

AUC

FWHM

Dens

Dend

Ax

t–stat

0.57

-1.39

1.24

-1.99

-0.05

0

0

21% O2

CB

Punc

AUC

FWHM

Dens

Dendr

Ax

Coel

t–stat

-0.51 -0.01

-0.40

-0.05

-0.94

0

0

-0.61

12

References 1. Praitis, V., Casey, E., Collar, D. & Austin, J. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157, 1217-1226 (2001). 2. Busch, K. E. et al. Tonic signaling from O(2) sensors sets neural circuit activity and behavioral state. Nat Neurosci 15, 581-591 (2012). 3. Ch’ng, Q., Sieburth, D. & Kaplan, J. M. Profiling synaptic proteins identifies regulators of insulin secretion and lifespan. PLoS Genet 4, e1000283 (2008). 4. Dittman, J. S. & Kaplan, J. M. Factors regulating the abundance and localization of synaptobrevin in the plasma membrane. Proc Natl Acad Sci U S A 103, 11399-11404 (2006). 5. Eisen, M. B., Spellman, P. T., Brown, P. O. & Botstein, D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95, 14863-14868 (1998). 6. Saldanha, A. J. Java Treeview--extensible visualization of microarray data. Bioinformatics 20, 3246-3248 (2004). 7. Lainé, V., Frøkjær-Jensen, C., Couchoux, H. & Jospin, M. The alpha1 subunit EGL-19, the alpha2/delta subunit UNC-36, and the beta subunit CCB-1 underlie voltage-dependent calcium currents in Caenorhabditis elegans striated muscle. J Biol Chem 286, 36180-36187 (2011).

Other supplementary materials for this manuscript include the following: Dataset S1 A. Genes, mutant strains, and alleles characterized in this work, organized in functional groups. B. The number of mutants of each class of gene included in this study.

13