Supplementary Materials - MDPI

2 downloads 0 Views 455KB Size Report
CACAATGATGAAGCCCAAAGGG. NM_001077696. 18. LC3-1. Mouse GCGAGTTGGTCAAGATCATCCG. TGGACACACTCACCATGCTGTG. NM_025735. 19.

Supplementary Materials

Figure S1. Metronidazole causes decreased body weight and hind limb muscle weight in germ-free mice. (a) Metronidazole treatment of GF mice resulted in a significant decrease in body weight compared to nontreated controls. N = 5 mice per group. (b) Absolute hind limb muscle weights of tibialis anterior (TA), extensor digitorum longus (EDL), gastrocnemius (GAS), soleus (SOL), and quadriceps (QUAD) muscles of metronidazole-treated GF mice (MET) compared to nontreated controls (CNTL). N = 5 mice per group. Data presented as means ± SEM. Asterisks indicate statistically significant differences (*, p < 0.05; **, p < 0.01; ns, nonsignificant with student’s t test).

Int. J. Mol. Sci.

www.mdpi.com/journal/ijms

Int. J. Mol. Sci.

S2 of S3

Figure S2. Metronidazole-treated SPF mice muscle mass determinants, autophagy markers, circadian metabolic regulators, and RNA epigenetics. Real-time quantitative PCR analysis of gene expression in gastrocnemius muscle of metronidazole-treated and nontreated SPF mice. (a) Neurogenic atrophy markers Hdac5 and Dach2; (b) muscle mass determinants MyoD and myostatin, and autophagy markers Mul1 and LC3-1; (c) circadian metabolic regulators Sirt1, Ampk, Pgc-1α, PPARα, and PPARβ/; (d) clock genes Clock, Per1, Cry1, Ror-α, Ror-γ, Rev-erbα, and Rev-erbβ, and clock effector genes Dbp and Dec2; (e) mRNA demethylase Fto and YTH N6-methyladenosine RNA binding protein 2 gene YTHDF2. N = 5 mice per group. Data presented as means ± SEM (ns, nonsignificant with student’s t test).

Int. J. Mol. Sci.

S3 of S3

Table S1. Serial No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Primer Adiponectin Ampk Atrogin1 Bmal1 Clock Cry1 Cry2 Dach2 Dbp Dec2 E4BP4 FoxO1 FoxO3 Fto Gapdh Hdac4 Hdac5 LC3-1 Mettl3 Mettl14 Mul1 MuRF1 MyoD Myogenin Myostatin Pdk4 Per1 Per2 Pgc-1α Pparα Pparβ/δ Pparγ Rev-erbα Rev-erbβ Ror-α Ror-β Ror-γ Sirt1 Tef YTHDF2

Species Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse

Forward primer (5'→3') TGTTGGAATGACAGGAGCTGAA GCCCTTCCCGCAAGATGTTAT GAGTGGCATCGCCCAAAAGA ACAGTCAGATTGAAAAGAGGCG ACCGTAGCAGGTTTATGGGAATG CAGACTCTCGTCAGCAAGATG GCGTCTGTTTGTAGTCCGGG TCTCCCTCGCAGATGGATCA AAGAAGGCAAGGAAAGTCCA GCGAGACGATACCAAGGATAC ACGGACCAGGGAGCAGAAC ACCAGGAGAAGCTCCCAAGT GCAAGCCGTGTACTGTGGA CTCCTTGAGGAGCTTGAAGACA TGGCCTTCCGTGTTCCTAC CTGGGGCGCCTGACG TGTTGCCACTCAAGAGCACA GCGAGTTGGTCAAGATCATCCG ATCCAGGCCCATAAGAAACAG CTGAGAGTGCGGATAGCATTG AGGGCATTCTTTCAGAAGCA GTGTGAGGTGCCTACTTGCTC GACAGGGAGGAGGGGTAGAG ACTCCCTTACGTCCATCGTG CAGCCTGAATCCAACTTAGG ACCCTACGGATCCTAACCACC GAATTGGAGCATATCACATCCGA AAAGCTGACGCACACAAAGAA AAACTTGCTAGCGGTCCTCA TACTGCCGTTTTCACAAGTGC CGGCAGCCTCAACATGG TGTGGGGATAAAGCATCAGGC CTTCCGTGACCTTTCTCAGA CGCCATGGAGCTGAACG ACCGTGTCCATGGCAGAAC GGCAGACCCACACCTACGA TCTACACGGCCCTGGTTCT CGGCTACCGAGGTCCATATAC GCCGAGCTTCGCAAGGA TAGCCAACTGCGACACATTC

Reverse primer (5'→3') CACACTGAAGCCTGAGCGATAC TCAGCAGGGGTGGACTTTAAT TCTCCATCCGATACACCCACA GCCATCCTTAGCACGGTGAG TGGTGTCCACACAATAGGCAAGA CAAACGTGTAAGTGCCTCAGT TCCCAAAGGGTTCAGAGTCATA TGACTGGGATTTGAGCTGGT TGTACCTCCGGCTCCAGTA TCAGATGTTCGGGCAGTAAA GGACTTCAGCCTCTCATCCATC AATGTAGCCTGCTCACTAACTCTTA CGGGAGCGCGATGTTATCC CCATGCTTATGCAGTGTGAGAA GAGTTGCTGTTGAAGTCGCA CTCACTGGCAGCGTCTTGTA CACAATGATGAAGCCCAAAGGG TGGACACACTCACCATGCTGTG CTATCACTACGGAAGGTTGGG GAGCAGATGTATCATAGGAAGCC GGGGTGGAACTTCTCGTACA GCTCAGTCTTCTGTCCTTGGA TGCTGTCTCAAAGGAGCAGA CAGGACAGCCCCACTTAAAA TCGCAGTCAAGCCCAAAGTC TCACAGGCATTTTCTGAACCAAAG CCCGAAACACATCCCGTTTG ACTCCTCATTAGCCTTCACCT TGGCTGGTGCCAGTAAGAG AGGTCGTGTTCACAGGTAAGA AGATCCGATCGCACTTCTCATAC CCGGCAGTTAAGATCACACCTAT CAGCTCCTCCTCGGTAAGTG GACAAGAGGCAGGGCTGGA TTTCCAGGTGGGATTTGGAT CAGAGCCTCCCTGGACTTG ATGTTCCACTCTCCTCTTCTCTTG ACAATCTGCCACAGCGTCAT ACAGGTTACAAGGGCCCGTACT CACGACCTTGACGTTCCTTT

NCBI reference NM_009605 NM_01310480 NM_026346 NM_001357070 NM_001305222 NM_007771 NM_009963 NM_001142570 NM_016974 NM_001271768 NM_017373 NM_019739 NM_019740 NM_011936 NM_001289726 NM_207225 NM_001077696 NM_025735 NM_019721 NM_201638 NM_026689 NM_001039048 NM_010866 NM_031189 NM_010834 NM_013743 NM_001159367 NM_011066 NM_008904 NM_011144 NM_011145 NM_011146 NM_145434 NM_011584 NM_001289916 NM_001289921 NM_001293734 NM_001159589 NM_153484 NM_145393