Supporting Information

1 downloads 0 Views 7MB Size Report
aAustrian Centre of Industrial Biotechnology, c/o. bDepartment of Chemistry ... TFEP, NPS and TClEP. S6. Hydrolytic stability of P-donors AcP, CP and PC. S9.

Supporting Information

Evaluation of Natural and Synthetic Phosphate Donors for the Improved Enzymatic Synthesis of Phosphate Monoesters Gábor Tasnádi,a,b Wolfgang Jud,b Mélanie Hall,b Kai Baldenius,c Klaus Ditrich,c Kurt Faberb,* a

Austrian Centre of Industrial Biotechnology, c/o

b

Department of Chemistry, Organic & Bioorganic Chemistry, University of Graz, Heinrichstrasse

28, 8010 Graz, Austria c

White Biotechnology Research Biocatalysis, BASF SE, Carl-Bosch-Strasse 38, 67056

Ludwigshafen, Germany

Electronic Supporting Information Organic phosphate donors in transphosphorylation reactions (Table S1)

S2

Nucleotide sequence and overexpression of Lw phosphatase from Leptotrichia wadei F0279

S4

Specific activity and concentration of enzymes used in this study (Table S2)

S5

Synthesis of phosphate donors AcP, TFEP, NPS and TClEP

S6

Hydrolytic stability of P-donors AcP, CP and PC

S9

General P-donor screening at pH 4.2

S11

Highest product levels achieved in P-donor screening (Table S3)

S13

Reactivation of enzymes upon transphosphorylation with PEP

S14

pH dependency of enzymes using AcP as donor

S15

Screening of TFEP, TClEP and NPS as P-donors at optimum pH

S18

P-donor, enzyme and substrate concentration study

S20

Substrate screening with crude acetyl phosphate

S23

Preparative-scale transformations

S25

NMR spectra of compounds synthetized in this study

S29

References

S63

*

Corresponding author: phone

+43-316-380-5332;

fax

+43-316-380-9840;

e-mail

Table S1 Organic phosphate donors in transphosphorylation reactions. Substratea

Donor

1,2-propanediol, glycerol,

phenyl phosphate (PP), phosphocreatine (PC),

D,L-glyceraldehyde,

β-glycerophosphate, p-nitrophenyl phosphate

dihydroxyacetone, glucose

(p-NPP)

adenosine, uridine

p-NPP, 3’-UMP, 5’-UMP

glycerol

p-NPP PP, p-NPP, carbamoyl phosphate (CP), acetyl

inosine

phosphate (AcP), ATP, ADP, AMP, Dglucose-6-phosphate, D-glucose 1-phosphate

Enzyme type

Reference

acid phosphatase

[1]

acid phosphatase (class B

[2]

NSAP) acid phosphatase acid phosphatase (class A

[3]

[4]

NSAP)

pyridoxine

PP, p-NPP, AcP

acid phosphatase

[5]

ascorbic acid

p-NPP, AcP, ATP

acid phosphatase

[6]

glucose

AcP, CP

acid phosphatase

[7]

D-glucose

AcP

acetyl phosphate:glucose-

[8]

6-phosphotransferase

S2

Table S1 (cont.) Substratea glucose, fructose, glycerol glucose, fructose, glycerol, 1,2-propanediol, D,Lglyceraldehyde, dihydroxyacetone tris(hydroxymethyl)aminomethane (Tris), glycerol

Donor

Enzyme type

Reference

alkaline phosphatase

[9]

alkaline phosphatase

[10]

p-NPP

alkaline phosphatase

[11]

p-NPP

alkaline phosphatase

[12]

alkaline phosphatase

[13]

alkaline phosphatase

[14]

PC, phosphoenolpyruvate (PEP), Dglucose-1-phosphate PC, phenolphthalein phosphate, PP, 5’AMP, β-glycerophosphate, PEP, hexose diphosphate, p-NPP

Tris, ethanolamine, di- and triethanolamine, dimethylaminoethanol, 3-amino-1-propanol, L-serine, L-serine

methyl ester, glycerol, ethylene glycol glucose

serine, ethanolamine, propanolamine, butanol, glycerol, L-glucose, Tris a

5’-AMP, 5’-CMP, GTP, D-mannose-6phosphate cysteamine-S-phosphate, serine-Ophosphate, aminoethanol-O-phosphate, pNPP

Name of substrates are given as written in the references.

S3

Overexpression of Lw phosphatase from Leptotrichia wadei F0279 >Lw from Leptotrichia wadei F0279 (NdeI/HindIII) CATATGAAAGGAAATGATGTAACAACAAAACCAGATGTCTACTTTTTGAAAAGC TCGCAAGTTGTAAGCAGTTATGACTTATTGCCAGCTCCACCAGCAGTTGACAGTA TCGCTTTTTTAAATGACAAGGCTCAGTATGAAAAGGGAAAATTACTTAGAAATAC TGAAAGAGGAAAACAGGCATACAACGATGCACGTGTAGAAGGAGATGGAGTACC TCGTGCTTTTTCAGAGGCTTTTGGATACACAATCTCAGCACAGACAACACCTGAA ATTTTTAAGTTAGTTACAAAATTACGTGAAGATGCGGGAGATTTAGCAACAAGAT CTGCAAAACAGACATACATGAGAATACGTCCGTTTGCATATTTTAAAGAATCAAC TTGCCGTCCAGAAGATGAAGCGAGCCTTTCAACAAACGGTTCTTATCCATCAGGA CATACTTCAATCGGTTGGGCTACTGCATTAGTTTTAGCTGAAATAAATCCAGCAA GACAAAGTGAAATTATAAAACGTGGTTATGAAATGGGGCAAAGCCGTGTAATCT GTGGTTATCACTGGCAAAGTGACGTCGATGCAGCCCGTGTGGTAGCAAGTACAGT TGTTGCAACACTGCATTCAAACAGCGAATTTAATGCTCAATTAGCTAAGGCAAAA GCAGAATTTCAAAGACTTAGCAGAAAAAAATAAAAGCTT The expression of Lw was performed as follows: An overnight culture of 15 mL LB (lysogeny broth) medium containing 30 µg mL-1 kanamycin was inoculated with E. coli cells harboring Lw subcloned into pET28a (glycerol stock) and shaken overnight at 37 °C and 120 rpm. Then 4 mL of the overnight culture were added to each 400 mL TB (terrific broth) medium in a 1-L baffled shaking flask containing 30 µg mL-1 kanamycin to grow the culture at 37 °C at 120 rpm. When the culture reached an OD between 0.3 and 0.4, the flasks were transferred to 20 °C for 20 min, then the expression was induced by 0.4 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) (OD at induction: 0.5-0.6) followed by shaking at 20 °C and 120 rpm overnight. The cells were harvested by centrifugation at 4000 rpm (1920 g) and 4 °C for 20 min. The wet cells were resuspended in His-tag lysis buffer (50 mM Na-Pi pH 7.5 containing 300 mM NaCl and 10 mM imidazole) aiming at 2 mL g-1 wet cell concentration and were sonicated for 5 min (40 % amplitude, 1 s pulse on, 4 s pulse off). The disrupted cells were pelleted at 15000 rpm and 4 °C for 20 min. The supernatant was purified using a NiNTA column at 4 °C following the protocol of the manufacturer. The fractions containing the desired enzyme were identified by SDS-PAGE analysis (10 µL fraction used for the gel), then combined, dialyzed against 20 mM NaOAc buffer pH 5.0 and finally concentrated yielding 20 mg mL-1 culture purified Lw with Aspec = 56.8 U mg-1. The concentration of the purified enzymes were measured via the Bradford assay and the activity of the enzymes were tested in S4

the p-NPP assay.[15] One unit of phosphatase activity (U) corresponds to the amount of p-NP (µmol) released per minute under assay conditions. Specific activity (Aspec) represents the phosphatase activity (U) of 1 mg protein. Table S2 Specific activity and concentration of enzymes used in this study Aspec Enzyme

(U mg-1)

(µg mL-1)

(µΜ)

PhoN-Sf

56

17.9

0.7

PhoN-Se

36

27.8

1.0

PiACP

94

10.6

0.4

Lw

57

17.5

0.6

PhoC-Mm wt

67

14.9

0.6

PhoC-Mm G92D/I171T

20

50

1.9

NSAP-Eb-11

30

33.3

1.2

AphA-St

87

11.5

0.4

PhoK

1300

0.8

0.013

phytase

150b

6.7

0.131

a

a

Conc. of 1 U in 1 mL reaction

L63Q/A65Q/E66A/N69D/S71A/S72A/G74D/D116E/T135K/E136D/I153T; b at pH 2.5.

Synthesis of phosphate donors Acetyl phosphate (AcP)[16]

Scheme S1 Synthesis of AcP 13.5 mL (0.2 mol) 85% aq. H3PO4 was mixed with 120 mL EtOAc and cooled to 0 °C. 56.4 mL (0.6 mol) cold acetic anhydride was added slowly over 10 min. After stirring for 5.5 h at 0 °C, the mixture was poured into a mixture of 100 mL H2O, 50 g ice and 16.8 g NaHCO3 (0.2 mol) and stirred at 0 °C until bubbling ceased. Then the organic phase was separated, the aqueous phase was washed with 3 × 200 mL EtOAc, neutralized with 10 M NaOH and washed once more with 50 mL EtOAc yielding 150 mL aqueous solution (pH 7.8) of acetyl S5

phosphate containing 1.01 M AcP, 47 mM Ac2P (diacetyl phosphate), 86 mM Pi and 12 mM PPi. The mixture was stored at -20 °C. Fig. S18 shows the 31P-NMR spectrum of the mixture. 2,2,2-Trifluoroethyl hydrogenphosphate monocyclohexylammonium salt (TFEP)[17]

Scheme S2 Synthesis of TFEP 76.7 g (0.5 mol) of POCl3 in Et2O (500 mL) was cooled to 0°C. A mixture of 100 g (0.5 mol) 10 and 50.6 g (0.5.mol) NEt3 was added dropwise with stirring while keeping the temperature at 0 °C. Upon complete addition, the mixture was allowed to warm up to room temperature and then it was refluxed for 3 h. Stirring was continued at room temperature overnight. Precipitated salt was then removed by filtration, the solids were washed with Et2O (2 x 200 mL) and the combined filtrates were concentrated in vacuum (100 mbar, rt). The residue was subjected to a distillation at 31 mbar. Pure ester 11 was collected at a b.p. of 64 – 66°C / 31 mbar. Yield: 71 g (72%) phosphoric acid ester dichloride 11 as a colorless oil. 1

H-NMR (400 MHz, CDCl3): δ= 4.60 (quint, J= 8.3 Hz; 2 H).

67.45 g (0.4 mol) AgNO3 were dissolved in a mixture of water (50.5 mL) and acetonitrile (50.5 mL). The solution was cooled to 0°C and 39 g (0.18 mol) of the ester 11 was added dropwise with stirring while keeping the temperature at 0-5 °C. Upon complete addition, stirring was continued for another hour. The mixture was allowed to stand overnight at 5 °C then precipitated AgCl was removed by filtration. As the filtrate was turbid, it was allowed to stand for another 24 h at 5 °C, followed by removal of precipitated salts. The filtrate was concentrated in vacuum and the remaining oil was dissolved in isopropanol (280 mL). After cooling to 0 °C the solution was treated with 17 g (0.17 mol) cyclohexylamine. The resulting suspension was heated to reflux and water was added dropwise until the salts were dissolved. Upon standing and cooling to room temperature, TFEP as a cyclohexylammonium salt precipitated. Filtration and drying in vacuum yielded 6.9 g (16%) of a white powder, m.p.: 180 °C (decomp.) 1

H NMR (300 MHz, D2O) δ 4.13 (qd, J = 8.7, 7.5 Hz, 2H), 2.99 (m, 1H), 1.90 – 1.76 (m, 2H),

1.72 – 1.57 (m, 2H), 1.50 (m, 1H), 1.29 – 1.10 (m, 4H), 1.10 – 0.93 (m, 1H). S6

13

C NMR (75 MHz, D2O) δ 123.4 (dd, JFC = 277.0, JPOCC = 9.8 Hz), 62.1 (qd, JFCC = 36.1,

JPOC = 4.2 Hz), 50.3, 30.3, 24.2, 23.7. 31

P NMR (121 MHz, D2O) δ -0.47.

2,5-Dioxopyrrolidin-1-yl hydrogen phosphate monocyclohexylammonium salt (NPS)

Scheme S3 Synthesis of NPS 15 g (0.11 mol) N-chlorosuccinimide (NCS) was dissolved in toluene (500 mL) and cooled to 10 °C. 26.2 g (0.1 mol) dibenzyl hydrogenphosphite (12) were added within 5 minutes with stirring. After complete addition the mixture was heated to 40 °C and stirred for 2 h at this temperature. After cooling to room temperature the precipitated succinimide was removed by filtration, the solids were washed with cold toluene (2x100 mL) and the combined filtrates were directly used for the next step. The filtrate was cooled to 0 °C and 13.6 g (0.13 mol) triethylamine was added dropwise followed by the portion-wise addition of 11.5 g (0.1 mol) of N-hydroxysuccinimide (14). The mixture was allowed to warm to room temperature and stirred overnight. Precipitated solids were removed by filtration, the solids were washed with toluene (2x100 mL) and the combined filtrates were concentrated to give 43.4 g of 15 which was purified by column chromatography (silica gel, eluent: cyclohexane:ethyl acetate 1:1; Rf=0.2). Upon standing the fraction containing pure product solidified and was recrystallized from cyclohexane/toluene. Yield: 21 g (56%) of dibenzyl (2,5-dioxopyrrolidin-1-yl) phosphate 15, m.p.: 75 °C.

S7

4 g (10.6 mmol) of the ester 15 was dissolved in dry THF (30 mL). 100 mg of 10% Pd on charcoal was added and the mixture was stirred vigorously in a H2-atmosphere at ambient pressure. After 430 mL the uptake ceased. The catalyst was removed by filtration, washed with THF (20 mL) and the combined filtrates were concentrated to a total volume of 10 mL. Cold isopropanol (30 mL) was added followed by the addition of 0.95 (9.6 mmol) of cyclohexylamine. The mixture was allowed to reach room temperature, the precipitated product was removed by filtration and dried in vacuum (0.1 mbar / 30 °C). Yield: 2.1 g (72%) of (2,5-dioxopyrrolidin-1-yl) hydrogen phosphate cyclohexylammonium salt NPS, which according to

1

H-,

13

C- and

31

P-NMR was contaminated by phosphate and N-

hydroxysuccinimide (14). 1

H NMR (300 MHz, D2O) δ 3.01 (m, 1H), 2.68 (s, 4H), 1.84 (m, 2H), 1.65 (m, 2H), 1.50 (m,

1H), 1.17 (m, 4H), 1.10 – 0.90 (m, 1H). 13

C NMR (75 MHz, D2O) δ 174.2, 50.3, 30.3, 25.2, 24.2, 23.8.

31

P NMR (121 MHz, D2O) δ 0.99.

2,2,2-Trichloroethyl dihydrogen phosphate (TClEP)

The compound was prepared starting from trichloroethanol (16) via the phosphoric acid ester dichloride 17 according to a published procedure in an overall yield of 18%.[18] 1

H NMR (300 MHz, D2O): δ = 4.27 (d, J = 6.3 Hz, 1H).

13

C NMR (75 MHz, D2O): δ = 95.1 (d, JPOCC = 11.3 Hz), 76.0 (d, JPOC = 3.9 Hz).

31

P NMR (121 MHz, D2O): δ = -1.66.

Hydrolytic stability of P-donors The stability of the phosphate donors was tested under reaction conditions in the absence of enzyme using 31P-NMR. In a Sarstedt tube, 5 mL of a stock solution of 500 mM 1a, 100 mM donor and 1% (v/v) DMSO in H2O were prepared, adjusted to a pH of 4.2 and kept on ice. In an NMR tube, 600 µL of the solution were then mixed with 100 µL 350 mM dimethyl methylphosphonate (internal standard) in D2O. Immediately after preparation of the sample, 31

P-NMR spectra were recorded employing inverse gated decoupling (ns 16, d1 = 20 s, pw = S8

11 µs). Total run time was 8 h with four samples per hour for the first 2 h and two samples per hour for the last 6 h. To determine the half-life time of the analyte, the time was plotted against the percent of donor as well as against the percent of Pi in the same graph. The time value at the crossing of the two curves represents the half-life.

Fig. S1 Determination of hydrolytic stability of AcP, CP and PC donors under screening conditions in the absence of enzyme.

S9

Fig. S1 (cont.) Determination of hydrolytic stability of AcP, CP and PC donors under screening conditions in the absence of enzyme.

S10

General P-donor screening at pH 4.2

Fig. S2 Screening of phosphate donors in the phosphorylation of 1a at pH 4.2 PPi: disodium dihydrogenpyrophosphate; AcP: lithium potassium acetyl phosphate; PEP: potassium phosphoenolpyruvate; CP: lithium carbamoylphosphate. Reaction conditions: 1-4 U mL

-1

(0.4-7.4 µM) enzyme in 100 mM AcP at pH 4.2, 500 mM

1a.

S11

Fig. S2 (cont.) Screening of phosphate donors in the phosphorylation of 1a at pH 4.2

S12

Table S3 Highest product levels achieved in P-donor screeninga Enzyme

a

PPi

AcP

t (min) product (mM)

PEP

CP

t (min) product (mM) t (min) product (mM)

t (min)

product (mM)

PhoN-Sf

60

69.0

20

64.3

240

27.2

15

44.1

PhoN-Se

10

58.8

20

58.5

60

56.9

20

24.8

PiACP

30

66.7

60

60.3

240

39.0

20

23.7

Lw

20

67.4

10

65.8

240

37.8

20

38.8

AphA-St

n/a

n/a

20

48.1

30

10.9

10

23.0

PhoC-Mm G92D/I171T

240

60.5

240

38.8

1500

39.0

15

53.4

NSAP-Eb-11

1680

45.4b

300

20.0

1500

11.6

30

54.0

Values taken from Figure S2; b highest product level has not yet been reached. n/a = not applicable

Reaction conditions: 1-4 U mL -1 (0.4-7.4 µM) enzyme in 100 mM P-donor at pH 4.2, 500 mM 1a.

S13

Reactivation of enzymes upon transphosphorylation with PEP

Fig. S3 Reactivation of enzymes via pH adjustment in the phosphorylation of 1a using PEP as P-donor Reaction conditions: 1 U mL -1 (0.4-1.0 µM) enzyme in 100 mM AcP at pH 4.2, 500 mM 1a.

S14

pH dependency of enzymes using AcP as donor

Fig. S4 pH dependency of the phosphorylation of 1a with AcP and various enzymes Reaction conditions: 1 U mL -1 (0.4-1.0 µM) enzyme in 100 mM AcP at various pHs, 500 mM 1a.

S15

Fig. S4 (cont.) pH dependency of the phosphorylation of 1a with AcP and various enzymes

S16

Fig. S4 (cont.) pH dependency of the phosphorylation of 1a with AcP and various enzymes

Fig. S5 Phosphorylation of 1a using PPi at optimum pH. Reaction conditions: 1 U mL

-1

(0.4-1.0 µM) enzyme in 100 mM AcP at pH 3.8 (for PhoN-

Sf), pH 3.5 (for PiACP and Lw) or pH 3.3 (for PhoN-Se), 500 mM 1a.

S17

Screening of TFEP, TClEP and NPS as P-donors at optimum pH TFEP, TClEP and NPS were tested at the optimum pH of each enzyme (synthesis and structure of donors see above). TFEP and TClEP are considered as activated phosphate esters due to the presence of the strong electron-withdrawing halogen atoms rendering the corresponding haloalcohol a good leaving group. Indeed, TFEP proved to be a fairly good Pdonor delivering maximum product concentrations in the same range as in reactions with PPi, however, with significantly better product/Pi ratio (≥1.9 PhoN-Sf, PhoN-Se, PiACP, Lw; 1.4 for AphA-St) (Fig. S6). Interestingly, 2,2,2-chloroethyl dihydrogen phosphate (TClEP) was not accepted by most enzymes at the optimum pH, only at pH 4.2. Only AphA-St and PhoNSf could utilize TClEP as a donor at the optimum pH (Fig. S7), while PhoN-Se, PiACP and Lw remained inactive even at elevated enzyme concentration indicating possible inhibition at reduced pH caused by the donor and/or the released 2,2,2-trichloroethanol. High product level and moderate product hydrolysis was observed with 1 U mL-1 PhoN-Sf, PiACP and Lw employing NPS as donor (Fig. S8). In order to see if inhibition is the reason for the moderate product formation with PhoN-Se and AphA-St, double amount of enzyme was added but only increased reaction rates in both transphosphorylation and hydrolysis mode were observed.

Fig. S6 Phosphorylation of 1a using TFEP at optimum pH Reaction conditions: 1 U mL -1 (0.4-1.0 µM) enzyme in 100 mM TFEP at pH 3.8 (for PhoNSf), pH 3.5 (for PiACP and Lw), pH 3.3 (for PhoN-Se) or pH 2.9 (for AphA-St), 500 mM 1a. S18

Fig. S7 Phosphorylation of 1a using TClEP at optimum pH Reaction conditions: 1 U mL -1 (0.4 µM) AphA-St or 4 U mL -1 (2.8 µM) PhoN-Sf in 100 mM TClEP at pH 3.8 (for PhoN-Sf) or pH 2.9 (for AphA-St), 500 mM 1a.

S19

Fig. S8 Screening of NPS in the phosphorylation of 1a at optimum pH Reaction conditions: 1 U mL -1 (0.4-1.0 µM) or 2 U mL -1 (0.8-2.0 µM) enzyme in 100 mM NPS at pH 3.8 (for PhoN-Sf), pH 3.5 (for PiACP and Lw), pH 3.3 (for PhoN-Se) or pH 2.9 (for AphA-St), 500 mM 1a. P-donor, enzyme and substrate concentration study

S20

Fig. S9 Product formation in the phosphorylation of 1a with AcP using PiACP and Lw Reaction conditions: 1 U mL

-1

enzyme (0.4 µM PiACP; 0.6 µM Lw) in 50-400 mM AcP at

pH 3.4, 500 mM 1a.

Fig. S10 Enzyme concentration study with PiACP and Lw Reaction conditions: 1-10 U mL

-1

enzyme (0.4-4.0 µM PiACP; 0.6-6.0 µM Lw) in 500 mM

AcP at pH 3.4, 500 mM 1a.

S21

Fig. S11 Substrate concentration study with PiACP and Lw Reaction conditions: 10 U mL -1 enzyme (4.0 µM PiACP; 6.0 µM Lw) in 500 mM AcP at pH 3.4, 0.5-1.5 M 1a.

S22

Substrate screening with crude acetyl phosphate

Fig. S12 Substrate screening with crude AcP and PiACP Reaction conditions: 15 U mL -1 (6 µM) PiACP in ~400 mM AcP at pH 3.4, 500 mM 1a, 2a, 9a, 300 mM 3a-5a, 7a, 8a.

Fig. S13 Enzyme concentration study with 4a using Lw Reaction conditions: 15-25 U mL -1 (9-15 µM) Lw in ~400 mM AcP at pH 3.4, 500 mM 4a.

S23

Fig. S14 Enzyme concentration study with 8a using Lw Reaction conditions: 15-25 U mL -1 (9-15 µM) Lw in ~400 mM AcP at pH 3.4, 500 mM 8a.

Fig. S15 Enzyme concentration study with 7a using PhoC-Mm Reaction conditions: 15-25 U mL -1 (9-15 µM) PhoC-Mm wt in ~400 mM AcP at pH 3.4, 500 mM 7a.

S24

Fig. S16 Enzyme concentration study with 6a using PhoC-Mm Reaction conditions: 15-25 U mL -1 (9-15 µM) PhoC-Mm wt in ~400 mM AcP at pH 3.4, 300 mM 6a.

Preparative-scale transformations 4-Hydroxybutyl phosphate barium salt (1b)

Preparative-scale transformations with AcP or PPi as donor resulted in a white powder which was dried at room temperature. The phosphorylation of 1a resulted in ~20% bisphosphorylated 1a, which was precipitated along with barium phosphate. 1

H-NMR,

13

C-NMR and

31

P-NMR spectra of 1b are in good accordance with the reported

spectra.[15]

S25

Methyl α-D-glucopyranoside phosphate barium salt (2b)

Preparative-scale transformations resulted in a white powder which was dried at 80 °C overnight. 1

H NMR (300 MHz, D2O) δ 4.70 (m, 1H, 1-CH), 4.00 – 3.87 (m, 1H, 6-CH2), 3.86 – 3.75 (m,

1H, 6-CH2), 3.60 – 3.43 (m, 4H, 2-5 CH), 3.29 (s, 3H, OCH3). 13

C NMR (75 MHz, D2O) δ 99.4, 72.5, 71.3, 71.1 (d, JPOCC = 7.2 Hz), 68.7, 62.3 (d, JPOC =

4.5 Hz), 55.1. 31

P NMR (121 MHz, D2O) δ 4.43.

D-Glucosamine-6-phosphate

barium salt (3b)

Preparative-scale transformations resulted in a slightly yellowish powder which was dried at 60 °C overnight. 1

H NMR (300 MHz, D2O) δ 5.32 (d, J = 3.6 Hz, 0.6H, 1-CH-α), 4.81 (d, J = 8.5 Hz, 0.4H, 1-

CH-β), 4.00 – 3.68 (m, 3.2H, 6-CH2-α, 6-CH2-β, 5-CH-α, 3-CH-α), 3.62 – 3.38 (m, 1.8H, 4CH-α and 4-CH-β, 5-CH-β, 3-CH-β), 3.17 (dd, J = 10.5, 3.6 Hz, 0.6H, 2-CH-α), 2.89 (dd, J = 10.4, 8.4 Hz, 0.4H, 2-CH-β). 13

C NMR (75 MHz, D2O) δ 92.8, 89.2, 75.3 (d, JPOCC = 7.7 Hz, C-5β), 71.6, 70.9 (d, JPOCC =

7.4 Hz, C-5α), 69.3, 69.2, 69.1, 62.9 (C-6α and C-6β), 56.7, 54.3. 31

P NMR (121 MHz, D2O) δ 2.81 (β-anomer), 2.73 (α-anomer).

S26

N-Acetyl D-glucosamine-6-phosphate barium salt (4b) O -O

P O-

O 6

4

HO HO 3

5

O 1

2

NH

OH

4b O

Ba2+

Preparative-scale transformations resulted in a slightly yellowish powder which was dried at 60 °C overnight. 1

H NMR (300 MHz, D2O) δ 5.16 (d, J = 3.5 Hz, 0.55H, 1-CH-α), 4.68 (d, J = 8.4 Hz, 0.45H,

1-CH-β), 4.09 – 3.80 (m, 3.1H, 6-CH2-α, 6-CH2-β, 5-CH-α, 2-CH-α), 3.80 – 3.40 (m, 2.9, 5CH-β, 4-CH-α, 4-CH-β, 3-CH-α, 3-CH-β, 2-CH-β), 2.00 (s, 3H). 13

C NMR (75 MHz, D2O) δ 174.7, 174.4, 95.0, 90.9, 75.3 (d, JPOCC = 6.9 Hz, C-5β), 73.3,

71.0 (d, JPOCC = 7.1 Hz, C-5α), 70.3, 69.6, 69.3, 62.9, 56.7, 54.1, 22.1, 21.9. 31

P NMR (121 MHz, D2O) δ 4.00 (β-anomer), 3.91 (α-anomer).

Maltotriose-6-phosphate barium salt (5b)

Preparative-scale transformations resulted in a slightly yellowish powder which was dried at room temperature in a drying chamber. 1

H NMR (300 MHz, D2O) δ 5.27 (d, J = 3.8 Hz, 1H, B-1Hα), 5.26 (d, J = 3.9 Hz, 1H, C-

1Hα), 5.11 (d, J = 3.7 Hz, 0.4H, A-1Hα), 4.54 (d, J = 7.9 Hz, 0.6H, A-1Hβ), 3.98 – 3.38 (m, 18.4H), 3.14 (dd, J = 9.4, 7.9 Hz, 0.6H, A-2Hβ). 13

C NMR (75 MHz, D2O) δ 99.8, 99.5, 96.2, 92.1, 77.1, 77.1, 76.9, 76.1, 74.4, 74.2, 73.2,

72.4, 72.2 (d, JPOCC = 7.2 Hz), 71.8, 71.5, 71.4, 71.1, 69.8, 68.8, 62.5 (d, JPOC = 4.3 Hz), 60.6, 60.5, 60.4, 60.3. 31

P NMR (121 MHz, D2O) δ 4.45. S27

Determination of regioselectivity of PiACP and Lw in the phosphorylation of 2a-5a NMR signals of substrates were assigned using 1H-, 13C-NMR and HSQC techniques aided by published data.[19-21] Upon phosphorylation, C6 and C5 carbons couple with phosphorous resulting in splitting of the 13C signal, moreover, 6-CH2 carbon and hydrogen atoms display a significant downfield shift. For comparison, HSQC and

13

C-NMR spectra of substrates and

products were superimposed or stacked (see below).

S28

Fig. S17 31P-NMR (121 MHz, D2O) spectrum of crude acetyl phosphate (AcP). ISTD: internal standard (dimethyl methylphosphonate); Pi: inorganic monophosphate; PPi: pyrophosphate; Ac2P: diacetyl phosphate S29

Fig. S18 1H-NMR (300 MHz, D2O) spectrum of 2,2,2-trifluoroethyl hydrogenphosphate monocyclohexylammonium salt (TFEP)

S30

Fig. S19 13C-NMR (75 MHz, D2O) spectrum of 2,2,2-trifluoroethyl hydrogenphosphate monocyclohexylammonium salt (TFEP)

S31

Fig. S20 31P-NMR (121 MHz, D2O) spectrum of 2,2,2-trifluoroethyl hydrogenphosphate monocyclohexylammonium salt (TFEP)

S32

Fig. S21 HSQC (1H, 13C) spectrum of 2,2,2-trifluoroethyl hydrogenphosphate monocyclohexylammonium salt (TFEP)

S33

Fig. S22 1H-NMR (300 MHz, D2O) spectrum of 2,5-dioxopyrrolidin-1-yl hydrogen phosphate monocyclohexylammonium salt (NPS)

S34

Fig. S23 13C-NMR (75 MHz, D2O) spectrum of 2,5-dioxopyrrolidin-1-yl hydrogen phosphate monocyclohexylammonium salt (NPS)

S35

Fig. S24 31P-NMR (121 MHz, D2O) spectrum of 2,5-dioxopyrrolidin-1-yl hydrogen phosphate monocyclohexylammonium salt (NPS)

S36

Fig. S25 HSQC (1H, 13C) spectrum of 2,5-dioxopyrrolidin-1-yl hydrogen phosphate monocyclohexylammonium salt (NPS)

S37

Fig. S26 1H-NMR (300 MHz, D2O) spectrum of 2,2,2-trichloroethyl dihydrogen phosphate (TClEP)

S38

Fig. S27 13C-NMR (75 MHz, D2O) spectrum of 2,2,2-trichloroethyl dihydrogen phosphate (TClEP)

S39

Fig. S28 31P-NMR (121 MHz, D2O) spectrum of 2,2,2-trichloroethyl dihydrogen phosphate (TClEP)

S40

Fig. S29 1H-NMR (300 MHz, D2O) spectrum of 2b

S41

Fig. S30 13C-NMR (75 MHz, D2O) spectrum of 2b

S42

Fig. S31 31P-NMR (75 MHz, D2O) spectrum of 2b

S43

Fig. S32 HSQC (1H, 13C) spectrum of 2b

S44

Fig. S33 Superimposed HSQC (1H, 13C) spectra of 2a (red-orange) and 2b (blue-green).

S45

Fig. S34 Stacked 13C-NMR spectra of 2a (turquoise) and 2b (maroon).

S46

Fig. S35 1H-NMR (300 MHz, D2O) spectrum of 3b. α and β mark the corresponding anomers.

S47

Fig. S36 13C-NMR (75 MHz, D2O) spectrum of 3b α and β mark the corresponding anomers.

S48

Fig. S37 31P-NMR (121 MHz, D2O) spectrum of 3b

S49

Fig. S38 HSQC (1H, 13C) spectrum of 3b. α and β mark the corresponding anomers.

S50

Fig. S39 Superimposed HSQC (1H, 13C) spectra of 3a (red-orange) and 3b (blue-green). α and β mark the corresponding anomers.

S51

Fig. S40 Stacked 13C-NMR spectra of 3a (turquoise) and 3b (maroon). α and β mark the corresponding anomers.

S52

Fig. S41 1H-NMR (300 MHz, D2O) spectrum of 4b. α and β mark the corresponding anomers.

S53

O -O

P O-

O 6

4

HO HO 3

5

NH

4b O

O 1

2

OH Ba2+

Fig. S42 13C-NMR (75 MHz, D2O) spectrum of 4b. α and β mark the corresponding anomers.

S54

O -O

P O-

O 6

4

HO HO 3

5

NH

4b O

O 1

2

OH Ba2+

Fig. S43 31P-NMR (121 MHz, D2O) spectrum of 4b.

S55

O -O

P O-

O 6

4

HO HO 3

5

NH

4b O

O 1

2

OH Ba2+

Fig. S44 HSQC (1H, 13C) spectrum of 4b. α and β mark the corresponding anomers.

S56

O -O

P O-

O 6

4

HO HO 3

5

NH

4b O

O 1

2

OH Ba2+

Fig. S45 Superimposed HSQC (1H, 13C) spectra of 4a (red-orange) and 4b (blue-green). α and β mark the corresponding anomers.

S57

Fig. S46 Stacked 13C-NMR spectra of 4a (turquoise) and 4b (maroon). α and β mark the corresponding anomers.

S58

Fig. S47 1H-NMR (300 MHz, D2O) spectrum of 5b.Capital letters mark the corresponding ring, α and β mark the corresponding anomers.

S59

Fig. S48 13C-NMR (75 MHz, D2O) spectrum of 5b. Capital letters mark the corresponding ring, α and β mark the corresponding anomers.

S60

Fig. S49 31P-NMR (121 MHz, D2O) spectrum of 5b.

S61

Fig. S50 Superimposed HSQC (1H, 13C) spectra of 5a (red-orange) and 5b (blue-green). Capital letters mark the corresponding ring, α and β mark the corresponding anomers. The spectra were recorded on a Bruker Avance III 700 MHz spectrometer (1H: 700 MHz and 13C: 176 MHz) S62

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]

R. K. Morton, Biochem. J. 1958, 70, 150–155. C. Passariello, C. Forleo, V. Micheli, S. Schippa, R. Leone, S. Mangani, M. C. Thaller, G. M. Rossolini, Biochim. Biophys. Acta - Proteins Proteomics 2006, 1764, 13–19. B. C. Jeong, H. W. Kim, L. E. Macaskie, FEMS Microbiol. Lett. 1997, 147, 103–108. Y. Asano, Y. Mihara, H. Yamada, J. Biosci. Bioeng. 1999, 87, 732–738. Y. Tani, T. Tochikura, H. Yamada, K. Ogata, Biochem. Biophys. Res. Commun. 1967, 28, 769–772. S. Koizumi, A. Maruyama, T. Fujio, Agric. Biol. Chem. 1990, 54, 3235–3239. A. Fujimoto, R. A. Smith, Biochim. Biophys. Acta 1962, 56, 501–511. M. Y. Kamel, R. L. Anderson, J. Biol. Chem. 1964, 239, PC3607-PC3608. O. Meyerhof, H. Green, J. Biol. Chem. 1950, 183, 377–390. R. K. Morton, Biochem. J. 1958, 70, 139–150. P. Gettins, M. Metzler, J. E. Coleman, J. Biol. Chem. 1985, 260, 2875–2883. I. B. Wilson, J. Dayan, K. Cyr, J. Biol. Chem. 1964, 239, 4182–4185. W. B. Anderson, R. C. Nordlie, J. Biol. Chem. 1967, 242, 114–119. H. Neumann, Eur. J. Biochem. 1969, 8, 164–173. G. Tasnádi, M. Lukesch, M. Zechner, W. Jud, M. Hall, K. Ditrich, K. Baldenius, A. F. Hartog, R. Wever, K. Faber, Eur. J. Org. Chem. 2016, 45–50. D. C. Crans, G. M. Whitesides, J. Org. Chem. 1983, 48, 3130–3132. A. M. Modro, T. A. Modro, Org. Prep. Proced. Int. 1992, 24, 57–60. G. R. Owen, C. B. Reese, C. J. Ransom, J. H. van Boom, J. D. H. Herscheid, Synthesis 1974, 704–705. K. Bock, C. Pedersen, J. Chem. Soc., Perkin Trans. 2 1974, 293–297. D. Goffin, P. Bystricky, A. S. Shashkov, M. Lynch, E. Hanon, M. Paquot, A. V. Savage, Bull. Korean Chem. Soc. 2009, 30, 2535–2541. V. L. Y. Yip, J. Thompson, S. G. Withers, Biochemistry 2007, 46, 9840–9852.

S63