Surveillance of enteric viruses and coliphages in a ...

Download PDF
1 downloads 0 Views 721KB Size Report
Comment
Apr 3, 2014 - Target enteric viruses in this study were noroviruses, adenoviruses, astroviruses and ro- taviruses. In total, 65 water samples were collected ...
w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

Available online at www.sciencedirect.com

ScienceDirect journal homepage: www.elsevier.com/locate/watres

Surveillance of enteric viruses and coliphages in a tropical urban catchment S. Rezaeinejad a, G.G.R.V. Vergara a, C.H. Woo b, T.T. Lim b, M.D. Sobsey c, K.Y.H. Gin a,* a

Department of Civil and Environmental Engineering, Faculty of Engineering, National University of Singapore, Blk E1A-07-03, 1 Engineering Drive 2, Singapore 117576, Singapore b Technology and Water Quality Office, Public Utilities Board, Singapore c Department of Environmental Sciences and Engineering, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

article info

abstract

Article history:

An assessment of the occurrence and concentration of enteric viruses and coliphages was

Received 26 September 2013

carried out in highly urbanized catchment waters in the tropical city-state of Singapore.

Received in revised form

Target enteric viruses in this study were noroviruses, adenoviruses, astroviruses and ro-

28 February 2014

taviruses. In total, 65 water samples were collected from canals and the reservoir of the

Accepted 18 March 2014

Marina catchment on a monthly basis over a period of a year. Quantitative PCR (qPCR) and

Available online 3 April 2014

single agar layer plaque assay (SAL) were used to enumerate target enteric viruses and coliphages in water samples, respectively. The most prevalent pathogen were noroviruses,

Keywords:

detected in 37 samples (57%), particularly norovirus genogroup II (48%), with a mean

Enteric viruses

concentration of 3.7  102 gene copies per liter. Rotavirus was the second most prevalent

Coliphages

virus (40%) with a mean concentration of 2.5  102 GC/L. The mean concentrations of so-

Recreational water quality

matic and male-specific coliphages were 2.2  102 and 1.1  102 PFU/100 ml, respectively.

Urban catchment

The occurrence and concentration of each target virus and the ratio of somatic to male-

Quantitative PCR

specific coliphages varied at different sampling sites in the catchment. For sampling sites with higher frequency of occurrence and concentration of viruses, the ratio of somatic to male-specific coliphages was generally much lower than other sampling sites with lower incidences of enteric viruses. Overall, higher statistical correlation was observed between target enteric viruses than between enteric viruses and coliphages. However, male-specific coliphages were positively correlated with norovirus concentrations. A multi-level integrated surveillance system, which comprises the monitoring of bacterial indicators, coliphages and selected enteric viruses, could help to meet recreational and surface water quality criteria in a complex urbanized catchment. ª 2014 Elsevier Ltd. All rights reserved.

1.

Introduction

Enteric viruses are the main etiological agents of endemic waterborne diseases in nearly all communities, regardless of * Corresponding author. Tel.: þ65 6516 8104. E-mail address: [email protected] (K.Y.H. Gin). http://dx.doi.org/10.1016/j.watres.2014.03.051 0043-1354/ª 2014 Elsevier Ltd. All rights reserved.

their level of social and economical developments. They are also potentially the most hazardous waterborne pathogens that can cause infection and illness at low dose (Griffin et al., 2003). Enteric viruses such as noroviruses, rotaviruses, adenoviruses and astroviruses are among the over 140 enteric

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

viruses that have been identified in human faeces to be the major causes of human viral gastroenteritis. Caliciviruses (e.g., norovirus) are primarily responsible for worldwide outbreaks of gastroenteritis in adults (Eden et al., 2010; Ng et al., 2005), while rotaviruses are more common among infants and children (Tate et al., 2012). Adenoviruses (Shimizu et al., 2007) and astroviruses (Pativada et al., 2012) are also associated with gastroenteritis but have milder symptoms than norovirus and rotavirus in both children and adults. Enteric viruses are persistent through most water and wastewater treatment processes as well as in environmental waters (Kishida et al., 2012; Prado et al., 2011). The origin of waterborne pathogen loads to surface waters can be point and non-point sources, including leaking sewage and septic systems, urban runoff, agricultural runoff and vessel wastewater discharges (Fong and Lipp, 2005; Ahmed et al., 2010; McQuaig et al., 2009). Water quality of urban catchments is associated with the intensity of urban development, rainfall and storm water runoff (Barbosa et al., 2012; Rowny and Stewart, 2012). In addition, infiltration or overflow of enteric viruses to a receiving river or reservoir from leaking sewers and older wastewater treatment plants may occur particularly during rainfall. Human exposures to recreational waters that contain enteric viruses pose health risks of waterborne disease, e.g., viral gastroenteritis (Kishida et al., 2012; Sinclair et al., 2009), mostly in children, the elderly and immune-compromised individuals (Gerba et al., 1996a). Nonetheless, the endemic occurrence and outbreaks of recreational waterborne gastrointestinal disease often remains uncharacterized (Dorevitch et al., 2012). Hence, surveillance of enteric viruses in environmental waters is important in controlling the occurrence and spread of waterborne diseases. In recent years, the surveillance of enteric viruses and indicator bacteriophages in recreational waters has attracted the attention of public health authorities in more developed and urbanized areas in temperate regions (Calgua et al., 2013; Colford et al., 2007; Contreras-Coll et al., 2002; Hamza et al., 2009; Haramoto et al., 2010; Kishida et al., 2012; Poma et al., 2012; Wyn-Jones et al., 2011). However, little is known about the presence of enteric viruses in tropical waters apart from molecular characterization studies conducted in Kenya (Kiulia et al., 2010) and Singapore (Aw and Gin, 2011). Their quantification in the environment and knowledge on seasonal patterns of distribution can improve human health risk assessment and protect public health from waterborne diseases. For the last few decades, there has been a debate among microbiologists, epidemiologists and water quality managers that either surveillance of enteric viruses or monitoring of bacteriophages as surrogates should be considered for microbial water quality management. Even though molecular methods have made direct detection of enteric viruses more practical, the monitoring of numerous enteric viruses is still time-consuming, costly, technically demanding, and requires a large volume of water sample for analysis. Furthermore, interpretation of results from direct molecular detection of viral nucleic acid does not distinguish infectious viruses of health concern from non-infectious viruses or their nucleic acids. Bacteriophages have similar traits to enteric viruses, e.g., morphology, size, structure, physiology and survivability. The detection of infectious bacteriophages is more simple and

123

less costly than enteric viruses and they have been used as indicators of viral contamination in surface waters (Savichtcheva and Okabe, 2006). Coliphages, which are bacteriophages that infect E. coli, are of particular interest since they have been found to correlate with the presence of enteric viruses in surface waters (Ballester et al., 2005; Ibarluzea et al., 2007; Ogorzaly et al., 2009), while others have shown a lack of significant correlation (Choi and Jiang, 2005; Jiang et al., 2007). To date, no consensus has been reached as to whether coliphages should be used as alternative indicators of enteric viruses for monitoring of microbial water quality. To address these gaps, this study aimed to detect the presence of enteric viruses and coliphages in a highly urbanized tropical catchment, to measure their concentrations in the environment and to assess relationships among viral pathogens and indicators.

2.

Materials and methods

2.1.

Study site

The Marina Reservoir is Singapore’s largest reservoir and serves a highly urbanized catchment area of 10,000 ha (about 15% of Singapore’s land area). The reservoir is separated from the sea by a dam (Marina Barrage) which came into operation in 2008. The reservoir not only acts a water supply source for Singapore but is also used for recreational activities, such as boating, water skiing and kayaking. Being located in the southern commercial-residential district of Singapore, the reservoir also serves as a scenic backdrop for numerous lifestyle attractions, including an integrated resort, esplanade activities and open air performances. There are five main tributaries which drain into the Marina Reservoir: Singapore River, Stamford Canal, Rochor Canal, Kallang River and Geylang River. These serve catchments with varied land use, including residential, commercial and light industrial activities. In Singapore, all wastewater from households and industry is channeled through the public sewerage system to water reclamation plants.

2.2.

Water sampling and processing

A total of 65 water samples were collected from 5 sampling locations at monthly intervals between December 2011 and March 2013 (Fig. 1). Wet weather samples were also collected every 10 min using an auto-sampler during storm events from a semi-urban-rural catchment in the north-western part of Singapore and analyzed for the presence of male-specific and somatic coliphages. For enteric virus analysis, 10-liter water samples were pre-filtered using a 142 mm stainless steel holder and 20 mm pore size filter paper. The 10-liter water samples were concentrated using a Tangential Flow Filtration (TFF) system (Sartorius, Germany) with a 30 kDa membrane cassette. Viruses were eluted by backwashing with glycine buffer (0.05 M, pH 7) to a final volume of 200 ml. To test the recovery of this system, 10-liter water samples were seeded with adenovirus, MS2 and phiX174. Recovery rates were 14% for adenoviruses and 8e11% for coliphages. Secondary concentration of viruses was carried out using an Ultra-15

124

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

Fig. 1 e Map of sample collection sites.

centrifugal tube with cut-off levels of 30 kDa (Amicon Merk, Germany) to a final volume of 0.5 ml.

2.3.

Quantification of enteric viruses

The specified region of the genome of each target virus, provided by Aw and Gin (2010), was amplified using the corresponding forward and reverse primers (Table 1) and was cloned to a plasmid using pGEM-T Easy Vector System (Promega, USA) following the manufacturer’s instructions. Viral nucleic acids were extracted using the QIAamp Viral RNA kit (Qiagen, Germany) following the manufacturer’s instructions. Complementary DNA (cDNA) for the extracted viral RNA for each of the RNA viruses was synthesized using ImProm-IITM Reverse Transcription System (Promega, USA) and reverse primer of each target virus, following the manufacturer’s instructions. The detection of enteric viruses in water samples was carried out using FastStart Universal Probe Master (Rox) (Roche, Germany) in a StepOnePlus Real-Time

PCR System (Applied Biosystems, USA). Extracted nucleic acids from pure cultures and purified plasmids were used as positive control and ultrapure water was used as negative reaction control. Samples were tested for possible inhibition using TaqMan Exogenous Internal Positive Control (IPC) by adding 5 ml, 2.5 ml, and 0.5 ml of template into a 20-ml qPCR reaction containing the IPC, and a no template control (NTC). The Ct value for all samples was 27.6  0.2 while the Ct value of the NTC was 27.8  0.1 which indicated little inhibition in samples. In order to quantify viruses, standard curves for each of the target enteric viruses were generated by serial dilution of the corresponding constructed plasmid. Quantitative PCR standard curves for each target virus gave R2 values ranging from 0.98 to 1. Threshold Ct values pertaining to 1 gene copy per reaction for each virus type (3 gene copies for adenovirus) and amplification efficiencies (enclosed in parenthesis) were 38.41  1.59 (90.53  1.98) for adenovirus, 40.44  0.69 (114.33  12.87) for norovirus GI, 38.59  1.59 (105.15  8.02) for norovirus GII, 36.06  0.81 (89.22  2.49) for astrovirus, and 39.88 (93.64) for rotavirus. Equivalent detection limits were 12.9 GC/L for adenovirus, and 8.6 GC/L for norovirus GI and GII, astrovirus, and rotavirus. For detection of human adenoviruses, the assay was performed in 20-ml reaction mixtures containing 5 ml extracted DNA, 10 ml qPCR master mix, 250 nM each of forward and reverse primers, 150 nM of fluorogenic probe and dH20. Realtime PCR was performed for 15 min at 95  C followed by 45 cycles of 10 s at 95  C, 30 s at 55  C and 15 s at 72  C (Jothikumar et al., 2005). For detection of noroviruses (GI and GII), real-time RT-PCR was carried out in 20-ml reaction mixtures containing 5 ml of cDNA, 10 ml qPCR master mix, 400 nM each of forward and reverse primers, 100 nM of fluorogenic probe and dH20. Real-Time PCR was performed for 15 min at 95  C followed by 45 cycles of 10 s at 95  C, 30 s at 55  C and 10 s at 72  C for GI and 45 cycles of 10 s at 95  C, 30 s at 55  C and 15 s at 72  C for GII (Kageyama et al., 2003). For detection of human astroviruses, real-time RT-PCR was carried out in 20-ml reaction mixtures containing 5 ml of cDNA, 10 ml qPCR master mix, 400 nM each of forward and reverse primers, 100 nM of fluorogenic probe and

Table 1 e Oligonucleotide sequences used for quantification of enteric viruses. Viruses Adenovirus

Norovirus GI

Norovirus GII

Astrovirus

Rotavirus

Function

Sequence (50 -30 )

Product length (bp)

Ref

F R Probe Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe Forward Forward Reverse Probe

GGACGCCTCGGAGTACCTGAG ACIGTGGGGTTTCTGAACTTGTT FAM-CTGGTGCAGTTCGCCCGTGCCA-BHQ1 CGYTGGATGCGNTTYCATGA CTTAGACGCCATCATCATTYAC FAM-TGTGGACAGGAGATCGCAATCTC-BHQ1 CAAGAGTCAATGTTTAGGTGGATGAG TCGACGCCATCTTCATTCACA FAM-TGGGAGGGCGATCGCAATCT-BHQ1 CCGAGTAGGATCGAGGGT GCTTCTGATTAAATCAATTTTAA FAM-CTTTTCTGTCTCTGTTTAGATTATTTTAATCACC-BHQ1 ACCATCTACACATGACCCTC ACCATCTTCACGTAACCCTC GGTCACATAACGCCCC FAM- ATGAGCACAATAGTTAAAAGCTAACACTGTCAAe TAMRA

96

Jothikumar et al., 2005

85

Kageyama et al., 2003

88

Kageyama et al., 2003

90

Le Cann et al., 2004

87

Pang et al., 2012

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

dH20. Real-Time PCR was performed for 15 min at 95  C followed by 45 cycles of 10 s at 95  C, 60 s at 55  C and 10 s at 72  C (Le Cann et al., 2004). For detection of rotaviruses (group A), real-time RT-PCR was carried out in 20-ml reaction mixtures containing 5 ml of cDNA, 10 ml qPCR master mix, 400 nM each of forward and reverse primers, 200 nM of fluorogenic probe and dH20. Real-Time PCR was performed for 10 min at 95  C followed by 45 cycles of 20 s at 95  C, 60 s at 60  C and 15 s at 72  C (Pang et al., 2012).

2.4.

Detection and enumeration of coliphages

Single agar layer plaque assay (SAL) was performed following standard protocols of US EPA method for the quantification of male-specific and somatic coliphages (USEPA, 2001). A 100 ml volume of the environmental water sample was assayed by adding log-phase host bacteria (E. coli Famp for male-specific and E. coli CN13 for somatic coliphages), MgCl2 (final concentration 0.01 M), and double strength molten tryptic soy agar. Volumes of 15 mg/ml each of streptomycin and ampicillin were added to culture media for male-specific coliphages and 100 mg/ml of nalidixic acid for somatic coliphages. The quantity of coliphages was expressed as plaque forming units (PFU)/100 ml after overnight incubation at 37  C.

2.5.

Statistical analysis of data

Statistical analyses were performed using Minitab 17 and NADA for MTB macro collection version 3.2 (Helsel, 2011). Default censoring indicators for detected observations (1) and nondetects (0) were applied. Virus concentrations at each station were compared using the CensKW NADA macro which computes the nonparametric KruskaleWallis test for comparing distributions of three or more groups of censored data, using tied ranks for all observations below the highest reporting limit (Helsel, 2011). The alpha 0.05 subcommand was used to further analyze the data by Dunn’s multiple comparison test (Bonferroni individual alpha was 0.005). Kendall’s Tau-b was calculated using the Ckend macro to measure the strength of association between concentrations of enteric viruses and coliphages in water samples when censored observations and multiple detection limits are present (Helsel, 2011). Correlation coefficients (s) are shown in Table 2. Somatic to male-specific coliphage ratios were calculated for each sample using measured concentrations. Analysis of variance on calculated ratios of somatic and male-specific coliphages were also performed using the KruskaleWallis test followed by Dunn’s multiple comparison test.

3.

125

positive for at least one of the target enteric viruses. Noroviruses were detected in 37 out of 65 (57%) samples with norovirus GII (48% positive samples) as the most prevalent virus in surface waters. Among samples positive for target viruses, the mean concentration of norovirus GII was also the highest (3.7  102 GC/L). Rotavirus was the second most prevalent virus with 26 positive samples out of 65 samples (40%) and a mean concentration of 2.5  102 GC/L. The mean concentrations of astrovirus and adenovirus were 2.9  102 GC/L (32% positive samples) and 9.4  101 GC/L (32% positive samples) respectively. Norovirus GI was the least prevalent type (25% positive samples) with a mean concentration of 9.5  101 GC/L. A significant difference in concentration was observed between types of viruses (KruskaleWallis, P < 0.05). Post hoc analysis showed that concentrations of norovirus GII and GI were significantly different from each other (Dunn, P ¼ 0.0006). Since nondetects were not excluded in the statistical analysis, i.e. there was no loss of data on presence-absence during transformation, it can be said that norovirus GII was high in both occurrence and numbers, while norovirus GI was low in both, which supports earlier statements. The occurrence and mean concentrations of each target virus at different sampling sites were not necessarily correlated. In other words, the higher prevalence of a virus at a specific site was not usually accompanied by a higher mean concentration for the same virus. However, this was not the case for Station 1, where the highest occurrence of target enteric viruses was also observed (46e77%). Here, higher mean concentrations were also observed for norovirus GII, rotavirus and astrovirus (7.0  102, 4.2  102 and 3.2  102 GC/ L). In the samples from Station 2, astrovirus and norovirus GII were the most prevalent with 46% positive samples. The highest mean concentration of rotavirus (5.3  102 GC/L) was also detected in samples from Station 2. There were lower

Results

3.1. Quantitative detection of enteric viruses and coliphages in surface water samples The occurrence and concentrations of enteric viruses (adenovirus, astrovirus, norovirus GI, norovirus GII and rotavirus) in water samples collected from the catchment is shown in Fig. 2. In general, 51 out of 65 samples (78%) were

Fig. 2 e Boxplot of concentrations of enteric viruses (n [ 65), astrovirus (AstV), norovirus GI (NoV GI), norovirus GII (NoV GII), rotavirus (RoV), adenovirus (HAdV), somatic (Som), male-specific (FD). The median value is represented by a line inside the box, geometric mean (B), 95% confidence intervals (bars). The percentage of occurrence is given in parenthesis.

126

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

occurrences for all target viruses (15e25% positive samples) in water samples from Station 3. At Station 4, despite lower incidences of other target viruses (less than 15%), rotavirus and norovirus GII were dominant (54% and 38% of positive samples) at this sampling site. However, in general, samples from Stations 3 and 4 had lower mean concentrations of target viruses (between 4.0  101 and 2.3  102 GC/L). The occurrence of viruses in Station 5 ranged from 30% to 46% positive samples for the target viruses. Although samples from the reservoir (Station 5) had slightly lower viral concentrations than the catchment waters (Stations 1e4), they nevertheless, still contained high mean concentrations of astrovirus, norovirus GI and norovirus GII of 5.0  102, 2.3  102 and 3.5  102 GC/L respectively. Overall, the mean concentration of norovirus GII was the highest at most of the sampling sites (between 1.1  102 and 7.0  102 GC/L). Statistical analysis showed a significant difference between sampling locations when viruses were grouped together (KruskaleWallis, P < 0.001). Stations 1 and 3 (Dunn, P ¼ 0.00001) and Stations 1 and 4 (Dunn, P ¼ 0.00002) were significantly different from each other based on virus concentrations, while other stations were considered similar. The lack of significant difference between Stations 1 and 5, and between Stations 2, 3, and 4, may be attributed to their proximity to each other and similar catchment characteristics, including possible sources and sinks. Station 1 drains into 5 while Stations 2, 3, and 4 are nearer each other and drain into the same basin (refer to map Fig. 1). Samples from the catchment were also analyzed for somatic and male-specific coliphages, which were detected in almost all (98%) of the water samples. The mean concentrations of somatic and male-specific coliphages for all 65 samples were 2.2  102 and 1.1  102 PFU/100 ml, respectively. In Station 1 with higher prevalence of enteric viruses, mean concentrations of somatic and male-specific coliphages were also highest among the five sampling sites (2.9  102 and 3.7  102 PFU/100 ml, respectively). The average ratio of somatic to male-specific coliphages was 1.8 in samples collected from Station 1 (Fig. 3). In samples from Station 5 (reservoir), mean concentrations of somatic and male-specific coliphages were 1.3  102 and 2.3  101 PFU/100 ml respectively, with an average somatic/male-specific ratio of 2.9 (Fig. 3). At Station 2, the mean concentrations of somatic and male-specific coliphages were 3.0  102 and 4.0  101 PFU/100 ml, respectively and a ratio of 10.9 was obtained. Somatic to male-specific coliphage ratios calculated from measured concentrations were grouped according to sampling site. A significant difference in ratio was observed between locations (KruskaleWallis, P < 0.05), in particular, between Stations 1 and 2 (Dunn, P ¼ 0.002) and between Stations 2 and 5 (Dunn, P ¼ 0.0056). Again, there was no significant difference between Stations 1 and 5, and between Stations 2, 3, and 4, which supports earlier findings.

3.2.

Seasonal stability of coliphages

Singapore experiences two monsoon seasons during the year, i.e. the Northeast Monsoon (DecembereMarch) and the Southwest Monsoon (JuneeSeptember). In general, higher

Fig. 3 e Ratios of somatic to male-specific coliphages expressed in log10 units in five sampling stations (ST) in Marina catchment. The median value is represented by a line inside the box, geometric mean (B), 95% confidence intervals (bars).

rainfall occurs during the Northeast Monsoon than the Southwest Monsoon. A higher prevalence of enteric viruses, particularly rotavirus (87%) and adenovirus (53%), was detected during the drier Southwest Monsoon (Fig. 4). Although a significant difference was observed in concentrations of target viruses between seasons (KruskaleWallis, P < 0.0001), no significant difference was observed in concentrations of coliphages (P > 0.05). Wet weather samples were also collected during a storm, as shown in Fig. 5. All samples tested positive for both somatic and male-specific coliphages. In general, concentrations in the catchment decreased by two orders of magnitude within the first hour of rain (from 103 to 101 with a mean value of 7.2  102 PFU/100 ml for somatic and 5.6  102 PFU/100 ml for male-specific coliphages). Although these were higher than dry weather samples (from 102 to 100 with a mean value of 5.8  101 PFU/100 ml for somatic and 3.4  102 PFU/100 ml for male-specific coliphages), differences in concentrations were not statistically significant (P > 0.05). The decline in concentration of both coliphages throughout the duration of the storm followed a similar trend and had a significant positive correlation (r ¼ 0.86, P < 0.0001).

3.3. Relationships between the occurrence of enteric viruses and coliphages in surface waters Concentrations of target viruses and coliphages were analyzed using Kendall’s Tau-b at a level of significance P < 0.05. Correlation coefficients (s) between enteric viruses and coliphages in environmental water samples are shown in Table 2. In general, enteric viruses were better correlated with each other than with coliphages. A weak to moderate statistical correlation (s ¼ 0.207 to 0.437, P < 0.05) was observed between the concentrations of target enteric viruses. Positive correlation existed between male-specific and somatic

127

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

Table 2 e Kendall’s Tau-b (s) correlation coefficients. Astrovirus (AstV), norovirus GI (NoV GI), norovirus GII (NoV GII), rotavirus (RoV), human adenovirus (HAdV), somatic (Som), male-specific (FD). Only significant correlations are presented (P < 0.05). NoV GI NoV GII RoV HAdV Som Fþ

AstV

NoV GI

NoV GII

RoV

0.224 0.437 0.207 0.437

0.216 0.220 0.318

0.321 0.325

0.346

0.233

0.312

HAdV

Som

0.620

coliphages (s ¼ 0.620, P < 0.05). Between enteric viruses and coliphages, male-specific correlated with norovirus GII (s ¼ 0.312, P < 0.05) and norovirus GI (s ¼ 0.233, P < 0.05). Other enteric viruses did not correlate with either of the coliphages.

4.

Fig. 4 e Boxplot concentrations of enteric viruses and coliphages during (A) the Northeast monsoon (n [ 40) and (B) the Southwest monsoon (n [ 15) in Marina catchment, astrovirus (AstV), norovirus GI (NoV GI), norovirus GII (NoV GII), rotavirus (RoV), adenovirus (HAdV), somatic (Som), male-specific (FD). The median value is represented by a line inside the box, geometric mean (B), 95% confidence intervals (bars). The percentage of occurrence is given in parenthesis.

Fig. 5 e Concentrations of somatic (:) and male-specific (3) coliphages during a storm event. The samples were taken every 10 min using an auto-sampler.

Discussion

With the advent of molecular methods such as qPCR, there are increasing reports on the occurrence of enteric viruses in surface and recreational waters over the last decade, with growing public and regulatory awareness of these enteric viruses as emerging pathogens of waterborne disease. Although Singapore is completely sewered and wastewaters are treated to a high degree, the occurrence of enteric viruses has been reported in Singapore surface waters (Aw and Gin, 2011) based on data collected in a study of the Marina catchment from 2006 to 2009 (Aw and Gin, 2011; Aw et al., 2009). In the earlier study, measurements showed a higher prevalence of noroviruses (72%) in the same catchment, and nucleotide similarity to clinical isolates during gastroenteritis outbreaks in 2006 and 2007 (Aw et al., 2009). Similarly, our current results showed the dominance of noroviruses, although the percentage of positive samples tested was less at 57% than previously reported. It is also noted that in both surveys, norovirus GII was the dominant genotype (48% in the current study), with the highest concentration among the target enteric viruses (3.7  102 GC/L). Norovirus GII was also shown to be the most prevalent in environmental, recreational and bathing waters worldwide: 83% of samples in river water, Spain (Calgua et al., 2013), 55% in river water, South Korea (Lee and Kim, 2008) and 63% in river water, Japan (Kishida et al., 2012). It is noted that the earlier study in Singapore showed relatively higher abundance of noroviruses with about two logs higher in average concentration than the current study as well as for other enteric viruses. This reduction in prevalence and concentration of noroviruses and other enteric viruses is likely due to the improvement in overall catchment management of the reservoir (including sewer rehabilitation) by the authorities. Human adenoviruses were detected in 32% of samples in our present study compared to 36% of samples in the earlier study (Aw and Gin, 2011). Human adenovirus were also reported as prevalent enteric viruses worldwide in surface water: 50e60% of samples (Haramoto et al., 2005, 2010) and 44% of samples (Kishida et al., 2012) in Japan, 16% samples in

128

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

river water of Southern California, US (Choi and Jiang, 2005), 97% of river water, Germany (Hamza et al., 2009), 16% of surface water, South Korea (Lee et al., 2005), 13% of river water, South Africa (Van Heerden et al., 2003), 64% of samples in recreational water, Brazil (Rigotto et al., 2010), 36% in recreational water of Europe (Wyn-Jones et al., 2011) and 48% of surface water, US (Chapron et al., 2000). Human adenovirus with a double-stranded DNA genome has higher resistance to wastewater treatment, particularly to UV disinfection (Meng and Gerba, 1996) and greater stability in the environment (Ogorzaly et al., 2010). Other studies have proposed its use as an index microorganism for microbial water quality of surface and recreational waters (Wyer et al., 2012; Wyn-Jones et al., 2011). Despite rotavirus being a waterborne pathogen with high persistence in the environment (Carter, 2005; Gerba et al., 1996b), and widespread reports of rotavirus-associated severe gastroenteritis and mortality (Tate et al., 2012), there has been less information on the occurrence of rotaviruses in the environment in comparison to noroviruses and adenoviruses. In the current study, rotaviruses were present in 40% of catchment samples. Elsewhere, the occurrence of rotaviruses has been reported as 90% in river water, Germany (Hamza et al., 2009), 19% of samples in recreational water, Brazil (Rigotto et al., 2010), 67% in river water, Brazil (Calgua et al., 2013) and 20% in surface water, Benin West Africa (Verheyen et al., 2009). Although most of the rotavirus-related deaths reported are from developing countries (Tate et al., 2012), the relatively high prevalance of rotavirus in surface waters in developed countries also justifies the importance of monitoring rotaviruses in recreational waters as well. In the current study, astroviruses were also detected in 32% of samples and 47% of samples in the earlier study of Singapore surface waters (Aw and Gin, 2011). These percentages are comparable to those found elsewhere, e.g., 35% of river water, South Africa (Taylor et al., 2001) and 52% of surface water, US (Chapron et al., 2000). The analysis of coliphages showed that mean concentrations of somatic coliphages were generally much higher than male-specific coliphages in catchment water samples. The ratio of concentration of somatic to male-specific coliphages varied at different locations, ranging from 1.8 to 10.9 (Fig. 3). In the water samples from Station 1, where most of the target viruses occurred at higher concentration and frequency, the ratio of somatic to male-specific coliphages was the lowest with a mean value of 1.8. Muniesa et al. (2012) suggested that the abundance ratio of somatic coliphages to bacteroides phages could be a useful tool in microbial source-tracking and fecal source discrimination. Male-specific coliphages have generally been reported to be one order of magnitude lower than somatic phages, with the latter typically ranging from 105 to 106 PFU/100 ml in raw sewage (Contreras-Coll et al., 2002; Guzman et al., 2007; Lodder and de Roda Husman, 2005) while somatic phages have been reported at 106 to 107 PFU/ 100 ml in municipal raw sewage (Lucena et al., 2004; Skraber et al., 2002). For Singapore, measurements of mean concentrations of male-specific and somatic coliphages in raw sewage were approximately 104 PFU/100 ml and 104 to 105 PFU/ 100 ml, respectively. With secondary treatment, concentrations of male-specific and somatic coliphages decreased to

approximately 101 to 102 PFU/100 ml and 102 to 103 PFU/100, respectively (Aw and Gin, 2010). This partly explains why higher concentrations of somatic coliphages were observed in catchment waters, compared to male-specific coliphages. Although the replication of somatic coliphages outside the gut in surface waters (particularly in warm tropical climates) is possible, due to the low density of phages and host bacteria, actual viral replication is negligible (Jofre, 2009). Studies have shown that a threshold host density of 106 CFU/100 ml is generally required for the successful replication of coliphages (Woody and Cliver, 1997). Male-specific coliphages are generally more susceptible to warm climates (Chung and Sobsey, 1993; Jofre, 2007), which is the case in Singapore with an average temperature of 30  C. Brion et al. (2002) suggested that male-specific coliphages could be used as an indicator to discriminate sporadic human fecal contamination due to the variation in male-specific concentration over time in the environment as well as the significant increase in coliphages (about 75%) during rainfall in an urban catchment. In our study on wet weather samples, concentrations of somatic and male-specific coliphages increased in the first hour of the storm (Fig. 5). Storm water can affect the water quality of surface water by transporting non-point sources pathogens to receiving surface water (Barbosa et al., 2012; Sidhu et al., 2012). The storm water might eventually carry a higher concentration of somatic coliphages with better survival than malespecific coliphages to receiving surface waters, particularly in warmer climates. In this study, for those rivers and canals with higher ratios of somatic to male-specific coliphages and low occurrence of enteric viruses, the contamination may be due to non-point sources, perhaps flushed from storm water. However, in cases where there is higher occurrence of viruses and lower ratio of somatic to male-specific coliphages, we postulate that this may be associated with more recent fecal contamination events. The higher concentration of coliphages at a specific site in a river may help to predict the potential risk of enteric viruses. However, from our statistical analysis, higher concentrations of coliphages may not necessarily correlate with the occurrence of enteric viruses, except for male-specific coliphages, which showed a correlation but only with noroviruses. We suggest that a better and perhaps more accurate overall prediction for the presence of enteric viruses is when the ratio of somatic to male-specific phages is low, as observed in the case of Station 1 samples with the highest viral loads. In other words, a lower ratio of somatic to malespecific coliphages could indicate recent fecal contamination (with greater occurrence of enteric viruses), while a higher ratio of somatic to male-specific coliphages could indicate contamination from an older source (with lower occurrence of enteric viruses), possibly from soils subject to recent storm runoff, due to the faster die-off of male-specific coliphages in the warm tropical climate of Singapore. The presence of coliphages in the environment is generally associated with fecal contamination and the simultaneous occurrence of enteric viruses. Therefore, coliphages have been suggested as a surrogate measure of enteric viruses in surface waters (Savichtcheva and Okabe, 2006). However, it appears from the literature that there is no clear consensus on the relationships between them. In a study based on a yearly surveillance of noroviruses, adenoviruses and coliphages in a

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

river in Tokyo, a significant statistical correlation was shown between noroviruses (GI and GII) and adenoviruses and the presence of male-specific coliphages (Haramoto et al., 2005; Kishida et al., 2012). Ogorzaly et al. (2009) also reported significant statistical correlation between the concentration of human adenovirus and somatic (r ¼ 0.59) and male-specific coliphages (r ¼ 0.49). In contrast, no correlation was found between somatic and male-specific coliphages and enteric viruses in surface waters in the US (Borchardt et al., 2004) and France (Hot et al., 2003). Similarly, our study revealed a weak statistical correlation between coliphages and the target viruses, implying that coliphages may not be suitable to predict the occurrence of enteric viruses in surface waters of a tropical, urbanized catchment. A notable exception, however, was the correlation of norovirus concentrations with male-specific coliphages. The extent of correlation between enteric viruses and coliphages may be related to differences or similarities in their survival mechanisms and inactivation rates in the environment and different efficiencies, sensitivities and concentration units (GCs from qPCR for enteric viruses versus infectious units for coliphages) of their detection methods. The seasonal analysis of enteric virus occurrence in the catchment also showed higher prevalence of enteric viruses during the Southwest monsoon than Northeast monsoon (Fig. 4). The spatial and temporal variability of enteric viruses and coliphages can be high, even in a relatively small urbanized catchment (10,000 ha) such as the one in this study. While our results for a tropical urban catchment generally showed poor correlations between enteric viruses and coliphages, a reasonable correlation was found between noroviruses and the male-specific coliphages. Furthermore, because noroviruses were the most prevalent and dominant virus in these waters, noroviruses may be suitable indicators for microbial surface water quality assessment. Hence, as a first step, routine monitoring of coliphages could be used to monitor microbial water quality in surface waters, followed by targeted monitoring of noroviruses when coliphage concentrations are higher than a particular threshold value or when the ratio of somatic to male-specific coliphages is low. If however, clinical data indicate the outbreak of specific enteric viruses, then surveillance for those particular viruses should be implemented in surface water monitoring. In practice, it may be best to implement a multi-level monitoring approach whereby coliphages (both somatic and male-specific), and other human-specific fecal indicators (e.g., human polyomavirus (HPyV)) are collectively monitored in surface waters. Molecular detection of specific enteric viruses could be confirmed by cell culture methods to determine viral infectivity, although this was not done in the present study. (Note, however, that noroviruses are unculturable and hence, cannot be assessed for infectivity.)

5.

Conclusion

 Enteric viruses and coliphages displayed high variability in occurrence and concentration at different locations in the catchment, indicating point and non-point sources of contamination.

129

 Overall, detection rates of enteric viruses found in tropical catchment waters were comparable to those found in temperate regions. Noroviruses, which are prevalent in cold climates, were also present in high concentrations during monsoon seasons.  Ratios of somatic to male-specific coliphages were lower when concentrations of enteric viruses were higher, and vice versa. In the absence of more sophisticated methods to detect noroviruses, abundance ratios of coliphages may be useful alternative indicators to predict the presence of enteric viruses in the environment.  The presence of noroviruses correlate with the presence of other enteric viruses (s ¼ 0.216 to 0.437, P < 0.05) and malespecific coliphages (s ¼ 0.312, P < 0.05).

Acknowledgments This project is supported by Public Utilities Board (PUB) under the project title Surveillance And Molecular Characterization of Human Enteric Viruses in Tropical Aquatic EnvironmentsPhase 2 and the Singapore National Research Foundation (NRF) (EWI_PUB_IDD 90301/1/24) under its Environmental & Water Technologies Strategic Research Programme and administered by the Environment & Water Industry Programme Office (EWI) of the PUB, Singapore. We would like to thank Nihar Panda and Arvindakshan Sundaraman for their help in the virus analysis.

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.watres.2014.03.051

references

Ahmed, W., Goonetilleke, A., Gardner, T., 2010. Human and bovine adenoviruses for the detection of source-specific fecal pollution in coastal waters in Australia. Water Res. 44, 4662e4673. Aw, T., Gin, K.H., 2011. Prevalence and genetic diversity of waterborne pathogenic viruses in surface waters of tropical urban catchments. J. Appl. Microbiol. 110, 903e914. Aw, T.G., Gin, K.Y., 2010. Environmental surveillance and molecular characterization of human enteric viruses in tropical urban wastewaters. J. Appl. Microbiol. 109, 716e730. Aw, T.G., Gin, K.Y.-H., Oon, L.L.E., Chen, E.X., Woo, C.H., 2009. Prevalence and genotypes of human noroviruses in tropical urban surface waters and clinical samples in Singapore. Appl. Environ. Microbiol. 75, 4984e4992. Ballester, N.A., Fontaine, J.H., Margolin, A.B., 2005. Occurrence and correlations between coliphages and anthropogenic viruses in the Massachusetts Bay using enrichment and ICCnPCR. J. water health 3, 59e68. Barbosa, A.E., Fernandes, J.N., David, L.M., 2012. Key issues for sustainable urban stormwater management. Water Res. 46, 6787e6798.

130

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

Borchardt, M.A., Haas, N.L., Hunt, R.J., 2004. Vulnerability of drinking-water wells in La Crosse, Wisconsin, to enteric-virus contamination from surface water contributions. Appl. Environ. Microbiol. 70, 5937e5946. Brion, G.M., Meschke, J., Sobsey, M., 2002. F-specific RNA coliphages: occurrence, types, and survival in natural waters. Water Res. 36, 2419e2425. Calgua, B., Fumian, T., Rusinol, M., Rodriguez-Manzano, J., Mbayed, V.A., Bofill-Mas, S., Miagostovich, M., Girones, R., 2013. Detection and quantification of classic and emerging viruses by skimmed-milk flocculation and PCR in river water from two geographical areas. Water Res. 47, 2797e2810. Carter, M.J., 2005. Enterically infecting viruses: pathogenicity, transmission and significance for food and waterborne infection. J. Appl. Microbiol. 98, 1354e1380. Chapron, C.D., Ballester, N.A., Fontaine, J.H., Frades, C.N., Margolin, A.B., 2000. Detection of astroviruses, enteroviruses, and adenovirus types 40 and 41 in surface waters collected and evaluated by the information collection rule and an integrated cell culture-nested PCR procedure. Appl. Environ. Microbiol. 66, 2520e2525. Choi, S., Jiang, S.C., 2005. Real-time PCR quantification of human adenoviruses in urban rivers indicates genome prevalence but low infectivity. Appl. Environ. Microbiol. 71, 7426e7433. Chung, H., Sobsey, M., 1993. Comparative survival of indicator viruses and enteric viruses in seawater and sediment. Water Sci. Technol. 27, 425e428. Colford JR., J.M., Wade, T.J., Schiff, K.C., Wright, C.C., Griffith, J.F., Sandhu, S.K., Burns, S., Sobsey, M., Lovelace, G., WEISBERG, S.B., 2007. Water quality indicators and the risk of illness at beaches with nonpoint sources of fecal contamination. Epidemiology 18, 27e35. Contreras-Coll, N., Lucena, F., Mooijman, K., Havelaar, A., Pierz, V., Boque, M., Gawler, A., Holler, C., Lambiri, M., Mirolo, G., Moreno, B., Niemi, M., Sommer, R., Valentin, B., Wiedenmann, A., Young, V., Jofre, J., 2002. Occurrence and levels of indicator bacteriophages in bathing waters throughout Europe. Water Res. 36, 4963e4974. Dorevitch, S., Dworkin, M.S., Deflorio, S.A., Janda, W.M., Wuellner, J., Hershow, R.C., 2012. Enteric pathogens in stool samples of Chicago-area water recreators with new-onset gastrointestinal symptoms. Water Res. 46, 4961e4972. Eden, J.S., Bull, R.A., Tu, E., Mciver, C.J., Lyon, M.J., Marshall, J.A., Smith, D.W., Musto, J., Rawlinson, W.D., White, P.A., 2010. Norovirus GII.4 variant 2006b caused epidemics of acute gastroenteritis in Australia during 2007 and 2008. J. Clin. Virol. 49, 265e271. Fong, T.T., Lipp, E.K., 2005. Enteric viruses of humans and animals in aquatic environments: health risks, detection, and potential water quality assessment tools. Microbiol. Mol. Biol. Rev. 69, 357e371. Gerba, C.P., Rose, J.B., Haas, C.N., 1996a. Sensitive populations: who is at the greatest risk? Int. J. Food Microbiol. 30, 113e123. Gerba, C.P., Rose, J.B., Haas, C.N., Crabtree, K.D., 1996b. Waterborne rotavirus: a risk assessment. Water Res. 30, 2929e2940. Griffin, D.W., Donaldson, K.A., Paul, J.H., Rose, J.B., 2003. Pathogenic human viruses in coastal waters. Clin. Microbiol. Rev. 16, 129e143. Guzman, C., Jofre, J., Montemayor, M., Lucena, F., 2007. Occurrence and levels of indicators and selected pathogens in different sludges and biosolids. J. Appl. Microbiol. 103, 2420e2429. Hamza, I.A., Jurzik, L., Stang, A., Sure, K., Uberla, K., Wilhelm, M., 2009. Detection of human viruses in rivers of a denslypopulated area in Germany using a virus adsorption elution method optimized for PCR analyses. Water Res. 43, 2657e2668.

Haramoto, E., Katayama, H., Oguma, K., Ohgaki, S., 2005. Application of cation-coated filter method to detection of noroviruses, enteroviruses, adenoviruses, and torque teno viruses in the Tamagawa River in Japan. Appl. Environ. Microbiol. 71, 2403e2411. Haramoto, E., Kitajima, M., Katayama, H., Ohgaki, S., 2010. Realtime PCR detection of adenoviruses, polyomaviruses, and torque teno viruses in river water in Japan. Water Res. 44, 1747e1752. Helsel, D.R., 2011. Statistics for Censored Environmental Data Using Minitab and R. John Wiley & Sons. Hot, D., Legeay, O., Jacques, J., Gantzer, C., Caudrelier, Y., Guyard, K., Lange, M., Andreoletti, L., 2003. Detection of somatic phages, infectious enteroviruses and enterovirus genomes as indicators of human enteric viral pollution in surface water. Water Res. 37, 4703e4710. Ibarluzea, J.M., Santa Marina, L., Moreno, B., Serrano, E., larburu, K., Maiztegi, M.J., Yarzabal, A., 2007. Somatic coliphages and bacterial indicators of bathing water quality in the beaches of Gipuzkoa, Spain. J. water health 5, 417e426. Jiang, S.C., Chu, W., He, J.W., 2007. Seasonal detection of human viruses and coliphage in Newport Bay, California. Appl. Environ. Microbiol. 73, 6468e6474. Jofre, J., 2007. Indicators of waterborne enteric viruses. Perspectives Med. Virol. 17, 227e249. Jofre, J., 2009. Is the replication of somatic coliphages in water environments significant? J. Appl. Microbiol. 106, 1059e1069. Jothikumar, N., Cromeans, T.L., Hill, V.R., Lu, X., Sobsey, M.D., Erdman, D.D., 2005. Quantitative real-time PCR assays for detection of human adenoviruses and identification of serotypes 40 and 41. Appl. Environ. Microbiol. 71, 3131e3136. Kageyama, T., Kojima, S., Shinohara, M., Uchida, K., Fukushi, S., Hoshino, F.B., Takeda, N., Katayama, K., 2003. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J. Clin. Microbiol. 41, 1548e1557. Kishida, N., Morita, H., Haramoto, E., Asami, M., Akiba, M., 2012. One-year weekly survey of noroviruses and enteric adenoviruses in the Tone River water in Tokyo metropolitan area, Japan. Water Res. 46, 2905e2910. Kiulia, N.M., Netshikweta, R., Page, N.A., Van Zyl, W.B., Kiraithe, M.M., Nyachieo, A., Mwenda, J.M., Taylor, M.B., 2010. The detection of enteric viruses in selected urban and rural river water and sewage in Kenya, with special reference to rotaviruses. J. Appl. Microbiol. 109, 818e828. Le Cann, P., Ranarijaona, S., Monpoeho, S., Le Guyader, F., Ferre, V., 2004. Quantification of human astroviruses in sewage using real-time RT-PCR. Res. Microbiol. 155, 11e15. Lee, C., Kim, S.J., 2008. The genetic diversity of human noroviruses detected in river water in Korea. Water Res. 42, 4477e4484. Lee, S.H., Lee, C., Lee, K.W., Cho, H.B., Kim, S.J., 2005. The simultaneous detection of both enteroviruses and adenoviruses in environmental water samples including tap water with an integrated cell culture-multiplex-nested PCR procedure. J. Appl. Microbiol. 98, 1020e1029. Lodder, W.J., de Roda Husman, A.M., 2005. Presence of noroviruses and other enteric viruses in sewage and surface waters in The Netherlands. Appl. Environ. Microbiol. 71, 1453e1461. Lucena, F., Duran, A.E., Moron, A., Calderon, E., Campos, C., Gantzer, C., Skraber, S., Jofre, J., 2004. Reduction of bacterial indicators and bacteriophages infecting faecal bacteria in primary and secondary wastewater treatments. J. Appl. Microbiol. 97, 1069e1076. McQuaig, S.M., Scott, T.M., Lukasik, J.O., Paul, J.H., Harwood, V.J., 2009. Quantification of human polyomaviruses JC Virus and BK Virus by TaqMan quantitative PCR and comparison to

w a t e r r e s e a r c h 5 8 ( 2 0 1 4 ) 1 2 2 e1 3 1

other water quality indicators in water and fecal samples. Appl. Environ. Microbiol. 75, 3379e3388. Meng, Q.S., Gerba, C.P., 1996. Comparative inactivation of enteric adenoviruses, poliovirus and coliphages by ultraviolet irradiation. Water Res. 30, 2665e2668. Muniesa, M., Lucena, F., Blanch, A.R., Payan, A., Jofre, J., 2012. Use of abundance ratios of somatic coliphages and bacteriophages of Bacteroides thetaiotaomicron GA17 for microbial source identification. Water Res. 46, 6410e6418. Ng, T.L., Chan, P.P., Phua, T.H., Loh, J.P., Yip, R., WONG, C., Liaw, C.W., Tan, B.H., Chiew, K.T., Chua, S.B., Lim, S., Ooi, P.L., Chew, S.K., Goh, K.T., 2005. Oyster-associated outbreaks of Norovirus gastroenteritis in Singapore. J. Infect. 51, 413e418. Ogorzaly, L., Bertrand, I., Paris, M., Maul, A., Gantzer, C., 2010. Occurrence, survival, and persistence of human adenoviruses and F-specific RNA phages in raw groundwater. Appl. Environ. Microbiol. 76, 8019e8025. Ogorzaly, L., Tissier, A., Bertrand, I., Maul, A., Gantzer, C., 2009. Relationship between F-specific RNA phage genogroups, faecal pollution indicators and human adenoviruses in river water. Water Res. 43, 1257e1264. Pang, X.L., Lee, B.E., Pabbaraju, K., Gabos, S., Craik, S., Payment, P., Neumann, N., 2012. Pre-analytical and analytical procedures for the detection of enteric viruses and enterovirus in water samples. J. Virol. Methods 184, 77e83. Pativada, M., Nataraju, S.M., Ganesh, B., Rajendran, K., Ramamurthy, T., Ganguly, S., Bhattacharya, M.K., Ghosh, M., Kobayashi, N., Krishnan, T., 2012. Emerging trends in the epidemiology of human astrovirus infection among infants, children and adults hospitalized with acute watery diarrhea in Kolkata, India. Infect. Genet. Evol. 12, 1685e1693. Poma, H.R., Gutierrez Cacciabue, D., Garce, B., Gonzo, E.E., Rajal, V.B., 2012. Towards a rational strategy for monitoring of microbiological quality of ambient waters. Sci. Total Environ. 433, 98e109. Prado, T., Silva, D.M., Guilayn, W.C., Rose, T.L., Gaspar, A.M., Miagostovich, M.P., 2011. Quantification and molecular characterization of enteric viruses detected in effluents from two hospital wastewater treatment plants. Water Res. 45, 1287e1297. Rigotto, C., Victoria, M., Moresco, V., Kolesnikovas, C.K., Correa, A.A., Souza, D.S., Miagostovich, M.P., Simoes, C.M., Barardi, C.R., 2010. Assessment of adenovirus, hepatitis A virus and rotavirus presence in environmental samples in Florianopolis, South Brazil. J. Appl. Microbiol. 109, 1979e1987. Rowny, J.G., Stewart, J.R., 2012. Characterization of nonpoint source microbial contamination in an urbanizing watershed serving as a municipal water supply. Water Res. 46, 6143e6153. Savichtcheva, O., Okabe, S., 2006. Alternative indicators of fecal pollution: relations with pathogens and conventional

131

indicators, current methodologies for direct pathogen monitoring and future application perspectives. Water Res. 40, 2463e2476. Shimizu, H., Phan, T.G., Nishimura, S., Okitsu, S., Maneekarn, N., Ushijima, H., 2007. An outbreak of adenovirus serotype 41 infection in infants and children with acute gastroenteritis in Maizuru City, Japan. Infect. Genet. Evol. 7, 279e284. Sidhu, J.P., Hodgers, L., Ahmed, W., Chong, M.N., Toze, S., 2012. Prevalence of human pathogens and indicators in stormwater runoff in Brisbane, Australia. Water Res. 46, 6652e6660. Sinclair, R.G., Jones, E.L., Gerba, C.P., 2009. Viruses in recreational water-borne disease outbreaks: a review. J. Appl. Microbiol. 107, 1769e1780. Skraber, S., Gantzer, C., Maul, A., Schwartzbrod, L., 2002. Fates of bacteriophages and bacterial indicators in the Moselle river (France). Water Res. 36, 3629e3637. Tate, J.E., Burton, A.H., Boschi-Pinto, C., Steele, A.D., Duque, J., Parashar, U.D., 2012. 2008 estimate of worldwide rotavirusassociated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: a systematic review and meta-analysis. Lancet Infect. Dis. 12, 136e141. Taylor, M.B., Cox, N., Vrey, M.A., Grabow, W.O., 2001. The occurrence of hepatitis A and astroviruses in selected river and dam waters in South Africa. Water Res. 35, 2653e2660. USEPA, 2001. Method 1602: Male-Specific (Fþ) and Somatic Coliphage in Water by Single Agar Layer (SAL) Procedure. EPA 821-R-01e029. Van Heerden, J., Ehlers, M.M., Van Zyl, W.B., Grabow, W.O., 2003. Incidence of adenoviruses in raw and treated water. Water Res. 37, 3704e3708. Verheyen, J., Timmen-Wego, M., Laudien, R., Boussaad, I., Sen, S., Koc, A., Uesbeck, A., Mazou, F., Pfister, H., 2009. Detection of adenoviruses and rotaviruses in drinking water sources used in rural areas of Benin, West Africa. Appl. Environ. Microbiol. 75, 2798e2801. Woody, M.A., Cliver, D.O., 1997. Replication of coliphage Q beta as affected by host cell number, nutrition, competition from insusceptible cells and non-FRNA coliphages. J. Appl. Microbiol. 82, 431e440. Wyer, M.D., Wyn-Jones, A.P., Kay, D., Au-Yeung, H.K., Girones, R., Lopez-Pila, J., De Roda Husman, A.M., Rutjes, S., Schneider, O., 2012. Relationships between human adenoviruses and faecal indicator organisms in European recreational waters. Water Res. 46, 4130e4141. Wyn-Jones, A.P., Carducci, A., Cook, N., D’Agostino, M., Divizia, M., Fleischer, J., Gantzer, C., Gawler, A., Girones, R., Ho¨ller, C., 2011. Surveillance of adenoviruses and noroviruses in European recreational waters. Water Res. 45, 1025e1038.