2- Estação Agronómica Nacional, Quinta do Marquês, 2780 Oeiras-Portugal ... Plantas, 5000-911 Vila Real-Portugal .... C. Santos, M. Santos, J. Reis, A. Pereira, I. Cortês, O. Sequeira and G. Nolasco (2001) RT-PCR survey of grapevine.
SURVEY OF FILAMENTOUS VIRUSES IN PORTUGUESE VINEYARDS C. Santos1, M.T. Santos2, A.N. Pereira3, I.Cortêz3, O.A. Sequeira2, G. Nolasco1 1- Universidade do Algarve, FERN-Laboratório de Virologia Vegetal, Campus de Gambelas 8005-139 Faro-Portugal 2- Estação Agronómica Nacional, Quinta do Marquês, 2780 Oeiras-Portugal 3- Universidade de Trás-os-Montes e Alto Douro-Dep.Prot.Plantas, 5000-911 Vila Real-Portugal Viral diseases remain one of the main threats to quality and yield of grapevine production in Portugal. In addition to yield loss, high sensitivity to viral infection could lead to the elimination of interesting clones. Diagnosis of viral diseases has been hindered by the lack of suitable ELISA reagents for a significant number of viruses affecting grapevine. The use of methodologies targeting the viral genome, such as RT-PCR, may circumvent this problem. Previous surveys on the sanitary status of budwood material used for grapevine propagation and vineyards in Portugal revealed a significant presence of several Closteroviruses, Vitiviruses and Rupestris stem pitting-associated virus (2, 3, 4). In this work we report the results of an extended survey of vineyards for diverse regions in Portugal. The methods and primers used were previously described (4). The primers LR127 and LR45 are degenerate primers targeting the HSP70 and were designed in such way to be able to detect Grapevine leafroll-associated viruses 1, 2 or 7 and 4 or 5, respectively. Grapevine leafroll-associated virus 3 was specifically detected with primers LR3 (4). Primers RSP48&49 were used to detect RSPaV (provided by Dr. A. Rowani). The primers GVA1:5´ AACACTCTCTTCGGGTACAT 3´ & GVA2:5´ TATATCTCAACAGCCTGCTC 3´, were used to detect GVA and they amplify the coat protein region of Grapevine virus A. Approximately 400 samples from 12 wine regions (DOC) were tested. The results obtained are presented on Table 1. As expected, based on previous results from our lab (2, 3), the prevalence of RSPaV was high in all regions. In contrast with a previous study focused on nursery material (1), the prevalence of leafroll associated viruses found in this work, in the vineyards, is significantly higher. GVA incidence is low (8%). Table 1. Filamentous virus detection in 12 wine regions in Portugal
Region Vinhos Verdes (Minho) Douro/Vinho do Porto Bairrada Dão Oeste Carcavelos Colares Ribatejo Terras do Sado Pegões Alentejo Algarve Total (*) nt - not tested
Grapevine leafroll associated viruses 1,2 or 7 4 or 5 3 Nº Nº Nº Samples % Samples % Samples 0/50 2/71 10/30 3/51 17/28 0/5 1/12 5/20 3/19 1/6 11/48 5/34 58/374
0 2.8 33.3 5.9 60.7 0 8.3 25.0 15.8 16.7 22.9 14.7 15.5
2/50 11/72 9/32 5/51 13/30 0/5 3/14 2/18 4/20 1/6 9/48 5/33 64/379
4 15.3 28.1 9.8 43.3 0 21.4 11.1 20.0 16.7 18.8 15.2 16.9
8/50 36/81 13/32 7/51 15/29 1/5 8/14 13/20 2/20 1/6 3/51 13/34 120/393
GVA
RSPaV
%
Nº Samples
%
Nº Samples
%
16 44.4 40.6 13.7 21.7 20.0 57.1 65.0 10.0 16.7 5.8 38.2 30.5
15/45 70/81 19/32 26/51 20/30 2/4 2/13 14/20 5/6 2/3 26/56 23/37 224/378
33.3 86.4 59.4 51 66.7 50 15.4 70 83.3 66.7 46.4 62.2 59.3
nt* nt 2/32 nt 5/29 1/4 0/10 5/20 1/19 0/6 0/50 3/34 17/204
nt nt 6.25 nt 17.2 25.0 0 25.0 5.3 0 0 8.8 8.3
These samples corresponded to 46 Portuguese varieties. The RSPaV was present in 36 with an incidence of 68.3%. The leafroll associated virus (GLRaV1, 2 and 7; GLRaV4, 5 and GLRaV3) were present in 11, 21 and 28 varieties, with an incidence of 23.5, 28.6 and 44.4%, respectively. Besides the reduced number of samples analysed for GVA, this virus is present in six varieties, with an incidence of 34.3%. The prevalence of these viruses incidence in important Portuguese grape varieties is presented on Table 2.
Table 2. Incidence of some filamentous viruses on six Portuguese grape varieties.
Varieties Aragonez Arinto Baga Malvasia-Fina Tália Touriga-Nacional
Grapevine leafroll associated viruses 1,2,or 7 4 or 5 3 % % % 0 7.1 53.3 12.0 15.4 22.2 41.7 33.3 33.3 10.0 11.1 54.5 30.0 20.0 77.8 15.4 10.0 15.4
RSPaV % 86.7 81.8 41.7 63.6 80.0 92.3
Acknowledgements This work was supported by the research grant POCTI/33447/AGR/2000. References 1. Mansinho A., M.T. Santos, Z. Sequeira, C. Sequeira, P.K.Correia, O.A. Sequeira and G. Nolasco, 1999. Detection of grapevine viruses by RT-PCR of double stranded RNA templates. Petria 9 (1/2), 183-186 2. Nolasco G., A. Mansinho, M.T. Santos, C. Soares, Z. Sequeira, C. Sequeira, P.K. Correia and O.A. Sequeira, 2000. Large scale evaluation of primers for diagnosis of Rupestris Stem Pitting associated virus 1. European Journal of Plant Pathology 106, 311-318 3. Santos, M.T., A. Mansinho, P.K. Correia, O.A. Sequeira and G. Nolasco, 2000. Multiple detection of filamentous viruses in Portugal by RT-PCR from ds-RNA templates. pp 129 in Extended Abstracts of the 13th ICVG Meeting 4. C. Santos, M. Santos, J. Reis, A. Pereira, I. Cortês, O. Sequeira and G. Nolasco (2001) RT-PCR survey of grapevine viruses in Portugal. 11th Congress of the Mediterranean Phytopathgology Union. pp 10-12
