THE EFFECT OF ANTISENSE OLIGONUCLEOTIDE TREATMENT OF ...

CELLULAR & MOLECULAR BIOLOGY LETTERS

Volume 9, (2004) pp 451 – 464 http://www.cmbl.org.pl Received 10 February 2004 Accepted 28 May 2004

THE EFFECT OF ANTISENSE OLIGONUCLEOTIDE TREATMENT OF PLASMA MEMBRANE Ca2+- ATPase IN PC 12 CELLS JANUSZ SZEMRAJ, IWONA KAWECKA, JACEK BARTKOWIAK and LUDMIŁA ŻYLIŃSKA* Neurochemical Laboratory, Department of Biochemistry, Medical University, ul. Mazowiecka 6/8, 92-215 Łódź, Poland Abstract: Plasma membrane Ca2+-ATPase (PMCA), encoded by four separate genes, constitutes a high affinity system extruding Ca2+ outside the cell. The nerve growth factor-treated PC12 cell line possesses all four main PMCA isoforms. To evaluate the potential role of PMCA isoforms in the differentiation process, we transiently suppressed the expression of PMCA2 and 3 using the antisense oligonucleotides. In the transfected PC12 cells, we observed morphological changes, slowed neurite extension and diminished survival of the cells. The apparent transport activity and affinity of the calcium pump to Ca2+ were lower in the cells with suppressed PMCA2 and 3 isoforms than in the control cells. Moreover, in the transfected PC12 plasma membranes, the calcium pump was insensitive to stimulation by calmodulin. These findings suggest that PMCA2 and 3 isoforms may be involved in developmental and differentiation processes. Key Words: Ca2+-ATPase, Isoforms, PC12 Cells, Antisense Oligonucleotides, Ca2+ Uptake INTRODUCTION Ca2+ plays an important role in cellular physiology and the amplitude and frequency of cytosolic calcium waves give its signal specificity. Ca2+ extrusion from the cells by an ATP-driven plasma membrane calcium pump is of crucial importance for maintaining a low resting intracellular Ca2+ concentration. More than 20 variants of the enzyme can exist due to alternative splicing of four separate genes: PMCA1-4 [1, 2]. Their expression is developmentally and celland tissue-specifically regulated; therefore, it could be modified directly in response to a calcium-mediated second messenger pathway [3-6]. The unique function of PMCA isoforms has been studied using several models – the PC12 * Corresponding author: e-mail: [email protected]

452

CELL. MOL. BIOL. LETT.

Vol. 9. No. 3. 2004

rat pheochromocytoma cell line, the PC6 cell line, the IMR32 human neuroblastoma cell line or, recently, the knock out mice [7-12]. Upon a neurotrophin exposure, the PC12 cell, a suitable and frequently used model for the neuronal cell, differentiates into sympathetic-like neurons, becomes electrically excitable, expresses neuronal markers, and extends neurites [13]. Undifferentiated PC12 cells possess all four main PMCA isoforms with several splice variants (1b, 2b, 3a, 3b, 3c, 4b); however, the differentiation process induces specific expression of some other variants (1c, 2a, 2c, 4a) [14]. PMCA4b has been shown to constitute a major calcium pump isoform in PC12 [15]. The role of PMCA1 and 4 in PC12 cell line has been studied by genetic modification of the cells. In PC6 cells, the inhibition of PMCA1 isoform with antisense RNA resulted in a decrease in PMCA protein content (by 37%), and impaired the ability of PC6 cells to extend neurites in response to neurite growth factor (NGF) [11]. On the other hand, the antisense method suppression of endogenous PMCA4 isoform in PC12 cells afforded better protection against Ca2+-mediated cell death in the presence of NGF, but the cells that overexpressed PMCA4 were less protected than the controls [16]. Up till now, no information has become available regarding the physiological significance of neuron-specific isoforms PMCA2 and 3 in PC12 cells. The aim of our study was to explore the role of these isoforms in the survival and differentiation of PC12 cells. Using antisense phosphothioate oligonucleotides, we obtained a PC12 cell culture which expressed only the PMCA1 and 4 isoforms, and then, we studied the physiological consequences of this modification. MATERIALS AND METHODS Cell culture PC12 rat pheochromocytoma cells (ATCC) were routinely grown on collagen (type I from rat tail, Sigma) coated dishes in 85% RPMI 1640 medium (Gibco) supplemented with 25 mM HEPES buffer, 10% heat-inactivated horse serum, 5% heat-inactivated calf serum, 2 mM L-glutamine, 1 mM sodium pyruvate, 2g/l D-(+) glucose, 25 U/ml penicillin, and 25 µg/ml streptomycin, at 37ºC in 5% CO2 in a humidified incubator. The medium was exchanged every 48 hours. Transfection One day before the experiment, cells were plated at a density of 6.3x104 /55 mm2. Transfection in a serum-free medium was conducted for 6 h using 7 µl of oligofectamine (Gibco), following the manufacturer’s suggested protocol. The six phosphothioate oligodeoxynucleotide probes (IDT, USA), antisense to the translated regions of mRNA molecules coding for PMCA2 and 3, were as described by Stahl et al. [17]. PMCA 2-1: 5`-C*CT TGG GCC GTG GCA CAT CCT TCA TTG CT*C-3` PMCA 2-2: 5`-G*GT GAG CTT GCC CTG AAG CAC CGA CTT CT*C-3` PMCA 2-3: 5`-C*CA GCA GGC CAC ACT CTG TCT TGT TGC CC*A-3` PMCA 3-1: 5`-C*TG CCC ATA GAT CTG CCT GCG TTT CTC CAA GT*C-3`


453

PMCA 3-2: 5`-A*CC CGG CCA TCC ACA ACG AAG GTC TCA ATC AC*A-3` PMCA 3-3: 5`-T*TA CCA TGT CAT CCC GGT CCC GAG GAC GAA AT*C-3`. The oligonucleotides were added in equimolar concentrations (4 µM) and the total concentration during transfection was 24 µM. Following transfection, the cells were allowed to recover in a complete medium containing 2.5 S murine nerve growth factor (NGF) (100 ng/ml) (Promega) and 1 mM dibutyryl cAMP (Sigma). Transfection was repeated after 48 h. As a control for antisense nucleotide transfection, the cells were also transfected with a mismatch oligonucleotide sequence (24 µM): 5’- TGT GAA TCT GTT AGC CTT AAC CTT AAG TTC-3’ In all the cells, the media containing oligofectamine, NGF and dibutyryl cAMP were changed at the same time. Morphological changes and neurite outgrowth were monitored and photographed every 24 h using an inverted microscope (Olympus) at x 200 magnification.

Trypan blue staining Cell toxicity was examined by observing cell morphology and the permeability of PC12 to trypan blue [18]. PC12 cells were plated in equal numbers in 6-well plates and treated as described in the previous section. After the second transfection, the cells were removed from the culture dishes every 24 h and centrifuged (1000 x g for 5 min). Cell media were then replaced in equal volume by a trypan blue solution (0.4% trypan blue, 0.81% NaC1, 0.06% K2 HPO4). Viable cells were counted under the microscope using a hemacytometer. RT-PCR analysis For reverse transcriptase-coupled PCR analysis, RNA was isolated according to [19]. Single-stranded cDNA was synthesized from 1 μg of total RNA by Super Script II RNase Transcriptase system (Promega) using oligo (dT) 12-18 primers (IDT, USA). The amplification primers used in the RT-PCR were as described in [20]: PMCA 1-3: 5`-CGG CTC TGA ATC TTC TAT CC-3` PMCA 1-5: 5`-TAG GCA CCT TTG TGG TGC AG-3` PMCA 2-3: 5`-GCT CGA GTT CTG CTT GAG CGC-3` PMCA 2-5: 5`-AAG ATC CAC GGC GAG CGT AAC-3` PMCA 3-3: 5`-CGT TGT TGT TCT GGT TAG GG-3` PMCA 3-5: 5`-GTC CAA TTT GGA GGG AAG CC-3` PMCA 4-3: 5`-CAG CAT CCG ACA GGC GCT TG-3` PMCA 4-5: 5`-ATG CCG AGA TGG AGC TTC GC-3 The reaction mixture was subjected to an initial denaturing step at 94ºC for 5 min, followed by 1 cycle at 90ºC for 1 min, 94ºC for 1 min, 60ºC for 1 min, and 72ºC for 1 min, and 34 cycles at 94ºC for 30 sec, 60ºC for 30 sec, and 72ºC for 30 sec, with a final extension at 72ºC for 10 min. The PCR products were separated on 6% acrylamide gel. In the same samples, β-actin mRNA was amplified with primers: 5’GTGGGGCGCCCCAGGCACCA3’, and

454


Vol. 9. No. 3. 2004

5’CTCCTTAATGTCACGCACGATTTC3’ and used as an intrinsic control of mRNA quantity PCR amplification. Plasma membrane preparations Membranes from PC12 cells were obtained as described in [15], with some modification. In brief, cell cultures were washed twice with cold PBS and lysed with ice-cold buffer (10 mM Tris-HCl, pH = 7.4, 1 mM EGTA, 1 mM EDTA and proteases coctail inhibitors – 1 mM PMSF, 1 µM pepstatin, and 10 µM leupeptin (Calbiochem)) for 30 min. Then, homogenization was performed in a Dounce homogenizer (20 strokes), and cell lysates were centrifuged at 4ºC at 4000 x g for 15 min. The supernatant was then centrifuged at 100 000 x g for 30 min. The membrane preparations were finally resuspended in 10 mM Tris-HCl, pH = 7.4 and stored at -80ºC until use. The concentration of protein was measured using a Protein Assay kit. 45

Ca uptake assay The transport activity of plasma membrane calcium pump was assayed according to the procedure described in [15], with some modification. In brief, for the time-dependence assay, Ca2+ transport was measured at 30ºC in a mixture containing: 3 µg of the membrane proteins, 50 mM Tris-HCl, pH = 7.2, 100 mM KCl, 20 mM KH2PO4/K2HPO4 pH = 7.2, 7 mM MgCl2, 0.5 mM ouabain, 100 µM 45CaCl2 (9.74 µM Ca2+ free), 60 µM EGTA, 5 mM NaN3, 4 µg/ml oligomycin, 400 nM thapsigargin in a total volume of 50 µl. The reaction was started by the addition of 6 mM ATP, and terminated after the time indicated under the figure by rapid filtration through a 0.45 µm filter (Millipore). For the Ca2+ dependence, the samples were incubated at 30ºC for 15 min, and free calcium concentration was obtained by adding different 45CaCl2 amounts (Amersham), enough to reach the Ca2+ concentration needed. The radioactivity of the control samples, incubated in parallel without ATP, was subtracted. The radioactivity was counted by liquid scintillation and the uptake activities are expressed per mg of membrane protein. Calmodulin (Sigma), when present, was 60 nM. Immunodetection of Ca2+-ATPase For Western-blotting, the membranes were separated by 7.5% SDS-PAGE and transferred to Immobilon PVDF membrane (Millipore) in a buffer containing 20 mM Tris, 192 mM glycine and 20% methanol at 30V overnight. Non-specific binding was blocked by 5% nonfat dry milk for 2 h at room temperature, and then the membrane was incubated for 1 h with monoclonal antibody - 5F10 (Sigma) diluted 1:100 in TBS with 1% nonfat dry milk. For staining, the goat anti-mouse (1:3000) or mouse anti-rabbit (1:80000) IgG-coupled alkaline phosphatase conjugates were used. The reaction was developed with NBT and BCIP (Sigma), according to the manufacturer’s procedure. The quantification of


455

PMCA content was performed after densitometric scanning of immunoblots using Image Master VDS system (Pharmacia LKB) Statistics Data presented in the figures are the means ± S.E. of duplicate determinations from 3 to 5 independent preparations. Student's T-test was used where applicable, and P values less than 0.05 were considered to indicate statistically significant differences. RESULTS Microscopic characteristics of PC12 cells To examine the involvement of PMCA2 and 3 isoforms in the differentiation process of PC12 cells, we suppressed these isoforms using phosphothioate antisense oligonucleotides. The total concentration of oligonucleotides during transfection was 24 µM. A similar concentration was used to knock down Ca2+ATPase isoform 1 in vascular endothelial cells [21]. Moreover, a concentration of oligonucleotides up to 50 µM was reported not to exert a cytotoxic effect in cell cultures [22].

Fig. 1. Differentiation of PC12 cells after antisense oligonucleotides treatment. Cells were transfected with antisense phosphotioate oligonucleotides, which were designed to PMCA2 and PMCA3 isoforms. Transfection was repeated after 48 h. In the control cells, the medium containing NGF and db cAMP was changed at the same time. After the second transfection, the cells were photographed every 24 h using an inverted microscope (Olympus) at x 200 magnification. The viability of the transfected PC12 cells in relation to the parallel controls determined using trypan blue test was 100 ± 5%, 84 ± 8% and 78 ± 10% after 24 h, 48 h and 72 h, respectively (n=4). C – control cells, T – transfected cells.

456


Vol. 9. No. 3. 2004

The transfection was performed using oligofectamine, and was repeated after 48 h. The control and transfected cells were then cultured in the presence of NGF and db cAMP, which have been described to intensify growth and differentiation processes. The treatment with mismatch oligonucleotide affected neither the morphology nor the survival of PC12 cells. Also, the total protein content was unchanged (data not shown). Under the conditions used, almost all the control cells displayed prominent neurite outgrowth at 24, 48 and 72 h (Fig. 1). Exposure of PC12 cells to the mixture of PMCA2 and 3 antisense oligonucleotides significantly altered cell morphology. In microscopic comparison, in 70% of the cells, we observed a disruption in neuritogenesis (the neurites were very short and unbranched), and a reduction in the amount of synaptic connections. Moreover, the transfection resulted in an increased level of cell death. After 72 h, the cell survival rate was diminished by 20-30% compared with the parallel control culture, as was verified using the trypan blue test. Subsequent RT-PCR analysis confirmed the estimated 70% efficiency of transfection. RT-PCR analysis The efficacy of PMCA2 and 3 mRNAs suppression was checked by RT-PCR analysis. Fig. 2 shows the presence of isoform-specific mRNAs of the calcium pump in PC12 cells transfected with antisense oligonucleotides, and in the control cells. PCR analysis yielded the main products: 430 bp for PMCA1, 560 bp for PMCA2, 579 bp and 646 bp for PMCA3, and 260 bp for PMCA4 in the control cells, which could corespond to 1b, 2b, 3a, 3c, and 4b variants, respectively.

Fig. 2. RT-PCR characteristics of PC12 cell. The oligonucleotide primers used in the RT-PCR were as described under Materials and Methods. Single-stranded cDNA was used directly in the PCR amplification reaction. The PCR products were separated on 6% acrylamide gel. β-Actin PCR product was used as an intrinsic control. The figure is representative of 6 independent analyses.


457

These results were consistent with those of Hammes et al., who studied the presence of PMCA isoforms and variants in both differentiated and undifferentiated PC12 cells [14]. In the transiently transfected PC12 cells, only PMCA1 and PMCA4 products (which respond to 1b and 4b variants) were detected. These results showed that the used antisense oligonucleotides specifically and efficiently blocked the PMCA2 and 3 isoforms. Immunocharacteristics of PMCA in PC12 membranes To evaluate the total amount of calcium pump in the modified and control PC12 cells, the membranes were separated by 7.5% SDS-PAGE and electrotransferred onto Immobilon PVDF membrane. After incubation with the monoclonal antibody 5F10, which recognizes all PMCA isoforms, the amount of calcium pump protein was estimated by densitometry scanning (Fig. 3A). The difference in calcium pump presence was expressed in arbitrary units (OD/µg of protein). The amount of calcium pump in the transfected PC12 cells was approximately two times lower than that in the unmodified ones.

Fig. 3. Immunocharacteristics of calcium pump in the membranes. A. Western blot after 5F10 antibody staining. Samples (10 µg) were separated on 7.5% SDS-PAGE and electroblotted on Millipore PVDF membrane. B. Quantification of the PMCA presence was done by densitometry scanning of the blot using VDS Image Master (Pharmacia) and is expressed as optical density per µg of protein. PC12/C – control PC12 cells, PC12/T – transfected PC12 cells.

Kinetics of Ca2+-ATPase in PC12 membranes To determine whether the modification of PMCA isoforms composition in PC12 membranes alters the kinetics of Ca2+-ATPase, we tested the apparent maximum activity of calcium transport, Ca2+ uptake as a function of Ca2+ concentration, and stimulation by calmodulin (Tab. 1).

458


Vol. 9. No. 3. 2004

Tab. 1. The kinetic parameters of PC12 membranes with different PMCA composition. The dependence of Ca2+-ATPase transport activity on calcium concentration was examined with Ca2+ free concentrations ranging from 0.1 nM to 100 µM. The results were then plotted by Eaddie-Hofstee analysis and Km(Ca) was calculated. The data presented are the mean values determined from 3-5 independent preparations of the membranes in duplicate. Calmodulin stimulation was examined in the presence of 60 nM CaM and 9.74 µM Ca2+ free (n = 4). PC12/C – control PC12 cells, PC12/T – transfected PC12 cells.

PC12/C Vmax (µmoles Ca2+/mg) Km(Ca) (µM) CaM stimulation

PC12/T

1.72 ± 0.14 1.07 ± 0.11 1.64 ± 0.17 5.88 ± 0.62 x 1.43 x 1.06

The apparent calcium transport in PC12 cells containing PMCA1 and 4 isoforms decreased by about 40%, and the enzyme affinity to Ca2+ was 3.5 times lower than in the cells with the full set of PMCA isoforms. Surprisingly, the time course of 45 Ca uptake measured at a fixed Ca2+ concentration (9.74 µM free) showed that the transport activity elevated more rapidly in membranes with suppressed PMCA2 and 3 isoforms, although it reached a significantly lower Vmax than in the control PC12 cells (Fig. 4 and Tab. 1).

Fig. 4. The time course of Ca2+ uptake by the PC12 membranes. Calcium transport was measured in the absence of calmodulin at a fixed Ca2+ concentration (9.74 µM). The rate of Ca2+ uptake after 20 min of incubation measured for control or transfected PC12 membranes was taken as 100%. The results are the averages of 3-4 separate experiments performed in duplicate, using different membrane preparations. PC12/C – control PC12 cells, PC12/T – transfected PC12 cells.


459

The most important mechanism of Ca2+-ATPase activation is its interaction with calmodulin. Whether the transfection of PC12 cells with antisense oligonucleotides affects the CaM-stimulation of calcium pump was examined in the presence of 9.74 µM Ca2+ (free) and 60 nM CaM. Under the conditions used, calmodulin presence did not influence the transport activity of Ca2+-ATPase in transfected PC12 cells at all (Tab. 1). In some cases, to avoid the contamination with endogenous calmodulin, the PC12 membranes were additionally washed out with EGTA before the Ca2+ uptake experiments; however, we obtained the same results with and without this step. DISCUSSION In the nervous system, large fluctuations in extracellular calcium level are a part of normal cellular activities, including outgrowth, differentiation, intra- and interneuronal signalling. A body of evidence indicates that diversified compositions of PMCA isoforms could determine a final response of the cell to a physiological stimulation [for rev. 23, 24]. Although the neuron-specific isoforms PMCA2 and 3 are generally less abundant, their specific distribution in specialized cells (i.e. cochlear tissues or granule cells) could have functional consequences for proper calcium signalling. During the neuronal differentiation, up-regulation of these isoforms appears to be a general phenomenon, whereas the changes in PMCA1 and PMCA4 are less pronounced [24]. It has been shown that the differentiation of neuroblastoma cell line IMR32 in the presence of cyclic AMP up-regulated PMCA2 and PMCA3 [10]. Moreover, the elevation of intracellular Ca2+ altered the N-terminal splicing pattern of PMCA2 isoform [4]. Up-regulation of PMCA2 and PMCA3 has been also reported in rat cerebellar granule cells [3, 5]. PC12, the rat adrenergic neural tumor pheochromocytoma cell line, is a suitable and frequently used model for studies on neurotransmission, including Ca2+ signalling. PC12 cells, when treated with NGF, exhibit the properties of sympathetic neurons, but neuritogenesis can be partly mimicked by the treatment with dibutyryl cAMP [25, 26]. These activators act synergistically, and NGFstimulated neurite outgrowth in PC12 cells involves tyrosine kinase activation and Raf-MEK-MAP-mediated signalling pathway, whereas cAMP acts via a MAP-protein kinase cascade [27, 28]. Both undifferentiated and differentiated PC12 cells possess all four main isoforms, and isoforms 1b and 4b are thought to be the housekeeping forms [11, 14, 15]. Keller and Grover [26] have shown that NGF treatment increased the PMCA pump expression of PC12 cells, but simultaneously decreased the level of sarco/endoplasmic Ca2+-ATPase. This could be essential to neurons because the cycle of entry of Ca2+ and its removal are pivotal to their communication. In addition, NGF induces specific PMCA variants and it suggests a unique role of each PMCA isoform during the differentiation process. Up to the present, only partial data have been published on the regulation of the calcium pump by

460


Vol. 9. No. 3. 2004

antisense oligonucleotide treatment in excitable cells. Recently, after blocking the PMCA1 isoform with antisense oligonucleotides, an increase in the resting Ca2+ concentration in vascular smooth muscle was observed, whereas the knock down of PMCA1 in human aortic endothelial cells did not affect the resting Ca2+ [21, 29]. These data indicate that the regulation of PMCA expression may be critical to cellular survival when cells are exposed to a pathological increase in Ca2+ and changes in Ca2+ homeostasis. The work presented here investigated the effect of inhibiting the PMCA2 and 3 isoforms expression in differentiated PC12 cells using a specific set of antisense oligonucleotides. The absence of mRNA for PMCA2 and 3 isoforms in PCR analysis implicates the absence of PMCA at a protein level. We observed a decreased ability of modified PC12 cells to survive and an altered morfological differentiation relative to the untransfected control cells. The study performed by Brandt et al. [11] on undifferentiated PC cells with a suppressed PMCA1 isoform revealed no morphological and growth rate changes in the absence of NGF, whereas the cells displayed a decreased ability to extend normal neurites in response to NGF. Our results showed that the absence of PMCA2 and 3 isoforms disturbed neurite extension in PC12 cells, which may suggest the involvement of the PMCA2 and 3 isoforms in this process. The activity of calcium pump in the examined membranes was consistent with the amount of protein detected with 5F10 antibody. Both the amount of calcium pump and Ca2+ uptake were reduced in the PC12 cells transfected with antisense oligonucleotides. It could indicate that after PMCA2 and 3 supression, neither the Ca2+ pumping activity nor the protein amount can be compensated by the PMCA1 and/or PMCA4 isoforms. Our results support the finding from the PMCA1 and 4 expression analyses, where the loss of one isoform did not lead to compensatory changes in the remaining isoforms [11, 15]. Recently, the targeting of PMCAs to subcellular membrane compartments, known as caveolae or signalosomes, was demonstrated [30, 31]. The colocalization of calcium pump with calmodulin, 1,4,5-trisphosphate receptors and nitric oxide synthase strongly suggests that caveolae are important sites of calcium-induced signalling system [32, 33]. Other important reports revealed the presence of PDZ-binding domains in the "b" variants of PMCA2 and 4 isoforms that could enable the specific, spatial and temporary interaction with a number of membrane proteins [34-36]. Thus, the suppression of PMCA2 and 3 isoforms could not only decrease the Ca2+extrusion, but also disrupt the formation of a proper membrane environment during the PC12 differentiation. These results may underline the exclusive role of each isoform during cell development. PMCA2 possesses the highest affinity for Ca2+ and calmodulin, and it also has the highest basal activity in the absence of CaM [37]. Moreover, PMCA4 has been suggested to be responsible for the delayed recovery of resting Ca2+ [38, 39]. Recently, it was demonstrated that PMCA1 and PMCA4 were less effective in controlling Ca2+ homeostasis than the two neuron-specific isoforms: PMCA2 and PMCA3 [7]. Thus, the higher calcium affinity in the PC12 membranes


461

containing all four PMCAs in relation to the membranes with PMCA1 and 4 isoforms appears to be directly correlated with the presence of PMCA2 and 3. Accordingly, the transfected PC12 cells with the weakened Ca2+ extrusion could become Ca2+ overloaded and the prolonged calcium signal may disturb both the differentiation process and cell survival. Under the in vitro assay, calmodulin had a small effect on the transport activity of control PC12 cells, but no CaM effect was detected in the transfected PC12 membranes. Low stimulation of the calcium pump by CaM in PC12 cells has also been reported by others [15]. Among all the isoforms, PMCA2 revealed the highest CaM affinity, although it was also shown that the binding of calmodulin to the calcium pump does not always correlate with the subsequent activation of the enzyme [for rev. 24, 25]. PMCA activity may be altered by the membrane arrangement, the protein-lipid ratio, the presence of phospholipids or the phosphorylation state of calcium pump [23, 32, 40, 41]. It is plausible that in the absence of PMCA2 and 3 isoforms, some other factors could replace the stimulatory effect of CaM. It is well known that the elevated Ca2+ concentration directly and/or indirectly activates several protein kinases. PMCA has been shown to be a target for protein kinase A and C; however, the phosphorylation of calcium pump does not always directly modify the activity of enzyme, but eliminates the calmodulin stimulation [24, 40]. Thus, the effects of phosphorylation and calmodulin stimulation of the phosphorylated calcium pump appear to be more complex and depend on the PMCA isoform. Taken together, the transiently suppressed expression of PMCA2 and 3 isoforms with the antisense oligonucleotides in PC12 cells resulted in a decreased potency for extruding Ca2+. Our results also suggest a significant role for PMCA2 and 3 isoforms in the proper differentiation process. Moreover, the presented model of PC12 transfected cells could be useful for further studies on relationships between calcium signalling and neuronal development and function. Acknowledgements. We are grateful to Mrs. Krystyna Marciniak and Bozena Ferenc, MSc. for their excellent technical assistance. This study was supported by grants No. 6P04A 06119 from the State Committee for Scientific Research, Poland, No. 502-16-197 and No 503 from the Medical University of Łódź, Poland. REFERENCES 1. Guerini, D. The significance of the isoforms of plasma membrane calcium ATPase. Cell Tissue Res. 292 (1998) 191-197. 2. Garcia, M.L. and Strehler, E.E. Plasma membrane calcium ATPases as critical regulators of calcium homeostasis during neuronal cell function. Front. Biosci. 4 (1999) D869-882. 3. Guerini, D., Garcia-Martin, E., Gerber, A., Volbracht, C., Leist, M., Gutierrez-Merino, C. and Carafoli, E. The expression of plasma membrane

462

4.

5.

6.

7.

8.

9.

10.

11.

12. 13. 14.

15.


Vol. 9. No. 3. 2004

Ca2+ pump isoforms in cerebellar granule neurons is modulated by Ca2+. J. Biol. Chem. 274 (1999)1667-1676. Zacharias, D.A. and Strehler, E.E. Change in plasma membrane Ca2+ATPase splice-variant expression in response to a rise in intracellular Ca2+. Curr. Biol. 6 (1996) 1642-1652. Guerini, D., Garcia-Martin, E., Zecca, A., Guidi, F. and Carafoli, E. The calcium pump of the plasma membrane: membrane targeting, calcium binding sites, tissue-specific isoform expression. Acta. Physiol. Scand. Suppl. 643 (1998) 265-273. Carafoli, E., Genazzani, A. and Guerini, D. Calcium controls the transcription of its own transporters and channels in developing neurons. Biochem. Biophys. Res. Commun. 266 (1999) 624-632. Brini, M., Coletto, L., Pierobon, N., Kraev, N., Guerini, D. and Carafoli, E. A comparative functional analysis of plasma membrane Ca2+ pump isoforms in intact cells. J. Biol. Chem. 278 (2003) 24500-24508. Kozel, P.J., Friedman, R.A.. Erway, L.C., Yamoah, E.N., Liu, L.H., Riddle, T. Duffy, J.J., Doetschman, T., Miller, M.L., Cardell, E.L. and Shull, G.E. Balance and hearing deficits in mice with a null mutation in the gene encoding plasma membrane Ca2+ -ATPase isoform. J. Biol. Chem. 273 (1998) 18693-18696. Street, V.A., McKee-Johnson, J.W., Fonseca, R..C., Tempel, B.L. and Noben-Trauth, K. Mutations in a plasma membrane Ca2+-ATPase gene cause deafness in deafwaddler mice. Nat. Genet. 19 (1998) 390-394. Usachev, Y.M., Toutenhoofd, S.L., Goellner, G.M., Strehler, E.E. and Thayer, S.A. Differentiation induces up-regulation of plasma membrane Ca2+-ATPase and concomitant increase in Ca2+ efflux in human neuroblastoma cell line IMR-32. J. Neurochem. 76 (2001) 1756-1765. Brandt, P.C., Sisken, J.E., Neve, R.L. and Vanaman, T.C. Blockade of plasma membrane calcium pumping ATPase isoform I impairs nerve growth factor-induced neurite extension in pheochromocytoma cells. Proc. Natl. Acad. Sci. USA 93 (1996) 13843-13848. Shull, G.E. Gene knockout studies of Ca2+-transporting ATPases. Eur. J. Biochem. 267 (2000) 5284-5290. Greene, L.A. and Kaplan, D.R. Early events in neurotrophin signalling via Trk and p75 receptors. Curr. Opin. Neurobiol. 5 (1995) 579-587. Hammes, A., Oberdorf, S., Strehler, E.E., Stauffer, T., Carafoli, E., Vetter, H. and Neyses, L. Differentiation-specific isoform mRNA expression of the calmodulin-dependent plasma membrane Ca2+-ATPase. FASEB J. 8 (1994) 428-435. Garcia, M.L., Usachev, Y.M., Thayer, S.A., Strehler, E.E. and Windebank, A.J. Plasma membrane calcium ATPase plays a role in reducing Ca2+mediated cytotoxicity in PC12 cells. J. Neurosci. Res. 64 (2001) 661-669.


463

16. Garcia, M.L., Strehler, E.E. and Windebank, A.J. The plasma membrane calcium ATPase is an important determinant of survival for PC 12 cells incubated with A23187. Soc. Neurosci. 25 (1999) 238. 17. Stahl, W.L., Eakin, T.J., Owens, Jr., J.W.M., Breininger, J.F., Filuk, P.E., and Anderson, W.R. Plasma membrane Ca2+-ATPase isoforms: distribution of mRNAs in rat brain by in situ hybridization. Mol. Brain Res. 16 (1992) 223-231. 18. Mesner, P.W., Winters, T.R. and Green, S.H. Nerve growth factor withdrawal-induced cell death in neuronal PC12 cells resembles that in sympathetic neurons. J. Cell Biol. 119 (1992) 1669-1680. 19. Chomczyński, P. and Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162 (1987) 156-159. 20. Reinhardt, T.A. and Horst, R.L. Ca2+-ATPases and their expression in the mammary gland of pregnant and lactating rats. Am. J. Physiol. (Cell Physiol. 45) 276 (1999) C796-C802. 21. Nakao, M., Furukawa, K., Satoh, E., Ono, K. and Iijima, T. Inhibition by antisense oligonucleotides of plasma membrane Ca2+-ATPase in vascular endothelial cells. Eur. J. Pharmacol. 387 (2000) 273-277. 22. Leoni, C., Menegon, A., Benfenati, F., Toniolo, D., Pennuto, M. and Valtorta, F. Neurite extension occurs in the absence of regulated exocytosis in PC12 subclones. Mol. Biol. Cell 10 (1999) 2919-2931. 23. Strehler, E.E. and Treiman, M. Calcium pumps of plasma membrane and cell interior. Curr. Mol. Med. 4 (2004) 323-335. 24. Strehler, E.E. and Zacharias, D.A. Role of alternative splicing in generating isoform diversity among plasma membrane calcium pumps. Physiol. Rev. 81 (2001) 21-50. 25. Lambeng, N., Michel, P.P., Agid, Y. and Ruberg, M. The relationship between differentiation and survival in PC12 cells treated with cyclic adenosine monophosphate in the presence of epidermal growth factor or nerve growth factor. Neurosci. Lett. 297 (2001) 133-136. 26. Keller, D. and Grover, A.K. Nerve growth factor treatment alters Ca2+ pump levels in PC12 cells. NeuroReport 11 (2000) 65-68. 27. Rumora, L., Shaver, A., Grubisic, Z., and Maysinge, D. MKP-1 as a target for pharmacological manipulations in PC12 cell survival. Neurochem. Int. 39 (2001) 25-32. 28. Kaplan, D.R., Hempstead, B., Martin-Zanca, D., Chao, M. and Parada, L.F. The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 252 (1991) 554-558. 29. Sasamura, S., Furukawa, K., Shiratori, M., Motomura, S., and Ohizumi, Y. Antisense-inhibition of plasma membrane Ca2+ pump induces apoptosis in vascular smooth muscle cells. Jpn. J. Pharmacol. 90 (2002) 164-172.

464


Vol. 9. No. 3. 2004

30. Sowa, G., Pypaert, M. and Sessa, W. C. Distinction between signaling mechanisms in lipid rafts vs. caveolae. Proc. Natl. Acad. Sci. USA 98 (2001) 14072-14077 31. Shaul, P.W. and Anderson, R.G.W. Role of plasmalemmal caveolae in signal transduction. Am. J. Physiol. 275 (1998) L843-851 32. Schuh, K., Uldrijan, S., Telkamp, M., Rothlein, N. and Neyses, L. The plasma membrane calmodulin-dependent calcium pump: a major regulator of nitric oxide synthase I. J. Cell Biol. 155 (2001) 201-205 33. Schnitzer, J. E., Oh, P., Jacobson, B. S. and Dvorak, A. M. Caveolae from luminal plasmalemma of rat lung endothelium: microdomains enriched in caveolin, Ca2+-ATPase, and inositol trisphosphate receptor. Proc. Natl. Acad. Sci. USA 92 (1995) 1759-1763 34. Kim, E., DeMarco, S. J., Marfatia, S. M., Chishti, A. H., Sheng, M. and Strehler, E. E. Plasma membrane Ca2+-ATPase isoform 4b binds to membrane-associated guanylate kinase (MAGUK) proteins via their PDZ (Psd-95/Dlg/Zo-1) domains. J. Biol. Chem. 273 (1998) 1591-1595 35. DeMarco, S.J. and Strehler, E.E. Plasma membrane Ca2+-ATPase isoforms 2b and 4b interact promiscuoisly and selectively with members of the membrane-associated guanylate kinase family of PDZ (Psd-95/Dlg/Zo-1) domain-containing proteins. J. Biol. Chem. 276 (2001) 21594-21600 36. DeMarco, S.J., Chicka, M.C. and Strehler, E.E. Plasma membrane Ca2+ATPase isoform 2b interacts preferentially with Na+/H+ exchanger regulatory factor 2 in apical plasma membranes. J. Biol. Chem. 277 (2002) 10506-10511 37. Elwess, N. L., Filoteo, A. G., Enyedi, A. and Penniston, J.T. Plasma membrane Ca2+ pump isoforms 2a and 2b are unusually responsive to calmodulin and Ca2+. J. Biol. Chem. 272 (1997) 17981-17986 38. Caride, A. J., Filoteo, A. G., Penheiter, A. R., Paszty, K., Enyedi, A. and Penniston, J. T. Delayed activation of the plasma membrane calcium pump by a sudden increase in Ca2+: fast pumps reside in fast cells. Cell Calcium 30 (2001) 49-57 39. Caride, A. J., Elwess, N. L., Verma, A.K, Filoteo, A. G., Enyedi, A., Bajzer, Z. and Penniston, J. T. The rate of activation by calmodulin of isoform 4 of the plasma membrane Ca2+ pump is slow and is changed by alternative splicing. J. Biol. Chem. 274 (1999) 35227 - 35232 40. Gromadzinska, E., Lachowicz, L., Walkowiak, B. and Zylinska, L.. Calmodulin effect on purified rat cortical plasma membrane Ca2+-ATPase in different phosphorylation states. Biochim. Biophys. Acta 1549 (2001) 1931 41. Usachev, Y. M., DeMarco, S. J., Campbell, C., Strehler, E. E. and Thayer, S. A. Bradykinin and ATP accelerate Ca2+ efflux from rat sensory neurons via protein kinase C and the plasma membrane Ca2+ pump isoform 4. Neuron 33 (2002) 113-122