The Effect of Growth Temperature on the Pathogenicity ... - Springer Link

Curr Microbiol (2013) 67:333–340 DOI 10.1007/s00284-013-0370-1

The Effect of Growth Temperature on the Pathogenicity of Campylobacter Sree V. Aroori • Tristan A. Cogan Tom J. Humphrey

•

Received: 8 July 2012 / Accepted: 11 March 2013 / Published online: 1 May 2013 Ó Springer Science+Business Media New York 2013

Abstract Control of Campylobacter in the food chain requires a better understanding of the behaviour of the bacteria in relevant environments. Campylobacter species are largely non-pathogenic in poultry, the body temperature of which is 42 °C. However, the bacteria are highly pathogenic in humans whose body temperature is 37 °C. The aim of this study was to examine if switching from commensal to pathogenic behaviour was related to temperature. We examined the growth, motility and invasion of T84 cells by three species of Campylobacter: C. jejuni 81116, C. jejuni M1, C. coli 1669, C. coli RM2228 and C. fetus fetus NC10842 grown at 37 and 42 °C. Our results suggest that C. jejuni isolates grow similarly at both temperatures but some are more motile at 42 °C and some are more invasive at 37 °C, which may account for its rapid spread in poultry flocks and for infection in humans, respectively. C. coli, which are infrequent causes of Campylobacter infections in humans, is less able to grow and move at 37 °C compared to 42 °C but was significantly more invasive at the lower temperature. C. fetus fetus, which is infrequently found in poultry, is less able to grow and invade at 42 °C.

S. V. Aroori (&) T. A. Cogan School of Veterinary Sciences, University of Bristol, Langford, Bristol BS40 5DU, UK e-mail: [email protected] T. J. Humphrey National Consortium for Zoonosis Research, University of Liverpool, Leahurst Campus, Neston, Wirral CH64 7TE, UK

Introduction Thermophilic Campylobacter can be found in many different environments and are exposed to a wide range of temperatures in the food chain. However, thermophilic Campylobacter are fastidious in growth requirements and grow only in the temperature range 30–47 °C [17, 36]. In its cycle of infection, Campylobacter can encounter the chicken intestine at 42 °C, human intestine at 37 °C, refrigerated food at 4 °C and water and fomites at a variety of temperatures [37]. Campylobacter have to regulate its gene expression in response to these different temperatures to be able to adapt and survive. Temperature controls bacterial gene regulatory circuits and temperature-mediated regulation occurs at the level of both transcription and translation [19]. Thermoregulation in bacteria involves three events: DNA supercoiling; changes in mRNA confirmation and in protein conformation with supercoiling being the central factor in many temperature-regulated virulence regulons [9]. Bacterial virulence properties are often temperature-controlled and regulation of bacterial virulence genes is critical to successful invasion or colonisation [19]. Investigators have shown that Campylobacter respond differently to variable temperatures with particular repertoires of genes induced or suppressed [1, 31]. Campylobacter spp. grown at 37 and 42 °C, mimicking human and chicken host body temperatures, have been shown to have a different ability to survive in food and water [10]. Growth rate and chemotactic behaviour of C. jejuni have been shown to be greater at 37 °C than at 42 °C [23], but C. coli is more motile at 42 °C than at 37 °C [1], suggesting species-specific differences, which could contribute to different incidences and behaviours of Campylobacter in different animals. To examine the effect of temperature on

123

334

S. V. Aroori et al.: Effect of Temperature on Campylobacter Pathogenicity

Campylobacter, we studied some key virulence characteristics—growth, motility [24] and invasion [16] of epithelial cells by these bacteria grown at 37 and 42 °C. We also examined the expression of flagella gene flgH and characterised protein expression at 37 and 42 °C. Furthermore, due to the fact that different species of Campylobacter have different reservoirs and different incidences in animals, we studied three different species: C. jejuni, C. coli and C. fetus. In addition, to determine any intra-specific differences, we have used two different C. jejuni and C. coli strains.

Materials and Methods Bacterial Strains The Campylobacter strains used for the experiments were C. jejuni 81116 [29] and M1 (environmental isolate), C. coli 1669 (pig kidney) and RM2228 [13] and C. fetus fetus NCTC10842 [15]. The effect of temperature on the pathogenicity of campylobacter was studied by measuring growth curves, motility and invasion of T84 cells at 37 and 42 °C. All reagents unless otherwise stated were purchased from Sigma-Aldrich (Poole, Dorset, UK) and all the media and agar from Oxoid (Basingstoke, UK). The Cultivation of Campylobacter Strains The strains were obtained from frozen stocks and plated on Columbia blood agar (COLBA) plates and incubated in a microaerobic atmosphere (an environment in which the concentration of oxygen is less than air) [5, 12] at 37 °C for 48 h. From the plate, a single colony was inoculated into Mueller–Hinton (MH) [5, 6] broth and incubated for 48 h in a microaerobic temperature at 37 or 42 °C and used in for further experiments. The microaerobic atmosphere was provided by a MACS-MG 1000 anaerobic cabinet [DW Scientific, Shipley, UK (MAC-Cabinet) with 10 % CO2, 5 % O2, 2 % H2 and 83 % N2] or by Campygen (Oxoid, Basingstoke, UK). Bacterial Growth Curves A single colony of bacteria from COLBA plate was inoculated into MH broth and incubated for 24 h in a microaerobic atmosphere and diluted to 10-3 using MH broth [6]. Growth rate experiments were then performed in a Microbiology Reader Bioscreen C (Labsystems, Helsinki, Finland) in a 100-well sterile covered honeycomb plates. The plates were kept in a microaerobic atmosphere for at least 30 min, sealed, and run in the Bioscreen C at 600 nm for 48 h, at 37 or 42 °C. The optical densities (OD) were

123

then taken using a UV1101 Biotech photometer (Jencons) at 600 nm. The OD values were plotted on a graph and those at stationary phase were compared using an unpaired t test. Motility Test The motility was tested in semisolid motility testing medium containing 0.4 % (w/v) agar (Oxoid), 10 g/l peptone (Oxoid), 5 g/l Nacl (Merck), 3 g/l Beef extract (Oxoid) and 0.05 g/l 2,3,5-triphenyltetrazolium chloride (Sigma). The semisolid agar was poured in petri plates and after it was set, inoculated with Campylobacter by stabbing the centre of the plate. After 48 h incubation at 37 or 42 °C, the bacterial colonies showed a red cloudy pattern, indicating swarming. The diameter of the swarming was measured. The flagellin H (flgH) Gene Expression Analysis by Quantitative Real-Time Reverse TranscriptasePolymerase Chain Reaction (RT-qPCR) To further examine the motility, the expression levels of flgH gene in C. jejuni and C. coli were measured by RTqPCR. The RNA extraction from cultured cells was carried out using QiagenÒ RNeasy Mini Kit (Qiagen, West Sussex, UK) according to manufacturer’s instructions. The RNA was checked for any DNA contamination by electrophoresis on a 2 % (w/v) agarose gel in Tris–acetate–EDTA (TAE) buffer. Absence of any band in the lanes confirmed that the RNA was pure. RNA was quantified using an Experion RNA Standardsens Analysis kit (Biorad, Hercules, CA, USA) according to manufacturer’s instructions. Synthesis of cDNA was carried out using 1 lg of Random primers (Promega, Madison, WI, USA) as per manufacturer’s instructions. RT-qPCR was performed to verify the gene expression levels of flgH at 37 and 42 °C. The primers for 16S rRNA and flgH (Table 1) were designed using Primer 3 software [30] and the formation of secondary structures on the primer binding sites was eliminated by checking the folding properties of the product under specific RT-PCR conditions with m-fold software [38]. The RT-PCR was performed in an iCyclerÒ (BioRad, CA, USA). For each reaction, 12.5 ll Hotstart Taq Master Mix (Qiagen), 1 ll of the forward and reverse primer, 0.5 ll of SYBR green dye, 1.5 ll MgCl2 (50 mM), 3.5 ll nucleasefree water and 5 ll of template DNA were added. The PCR conditions were 95 °C for 10 s and 60 °C for 15 s for 45 cycles and then 60 °C for 40 cycles with 1 °C increment each cycle for temperature melt curve. Quantitative values were obtained by using the comparative threshold cycle (DDCT) method [27]. The CT value corresponds to the PCR cycle at which the first detectable increase in fluorescence


associated with the exponential growth of PCR products occurs. Primer efficiencies in this study were assumed to be 2, as they were between 85 and 90 % [27]. The relative expression of each gene was determined three times in each of the three experimental RNA samples, normalised to the 16S rRNA reference gene and expressed as the fold difference in quantity of cDNA molecules present at 42 °C relative to that present at 37 °C. Invasion of Campylobacter into T84 Cells The gentamicin resistance assay was used to measure the invasion of Campylobacter cells into T84 cells. The gentamicin resistance assay is based on principle that the antibiotic gentamicin has limited ability to penetrate into eukaryotic cells [14]. The T84 human colonic adenocarcinoma cell line was obtained from European collection of cell cultures (ECACC, Health Protection Agency Culture Collection, Salisbury, UK) [8, 28]. The cells grow as monolayers, exhibit tight junctions and desmosomes between adjacent cells to prevent diffusion across the epithelial cell. The cells were grown at 37 °C in 5 % CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10 % foetal calf serum (FCS), penicillin and streptomycin at concentration of 200 U and 0.4 lg/ml, respectively, and L-glutamine [5]. For the experimental assays, T84 cells were grown in 12-well plastic plates (corning). The cells were seeded at 0.6 9 106 cells per well and incubated for 10 days at 37 °C in a 5 % CO2 atmosphere. At 24 h prior to the addition of campylobacter, the monolayers were washed with phosphate-buffered saline (PBS) to remove any antibiotics left and then grown in antibiotic-free DMEM. On the day of assay, monolayers were washed again with PBS and antibiotic-free DMEM added. A single colony of bacteria from COLBA plate was inoculated into MH broth and incubated for 48 h in microaerobic atmosphere at 37 or 42 °C. After 24 h, the ODs were read using a UV1101 Biotech photometer at 600 nm and broths were diluted to an OD of 0.1 with MH broth preTable 1 Primer sequences for quantitative RT-PCR Gene

Name

Primer sequence 50 –30

16S rRNA

A component of ribosomes

Forward 50 CCAGCAGCCGCGGTAAT-30 Reverse 50 GCCTTTACGCCCAGTGAT-30

flgH

Flagellin H

Forward 50 GTTCCAAGTCCATCTTGTCC30 Reverse 50 TCCAGCGGGTCTTCATTC-30

335

warmed to 37 or 42 °C. A 30 ll of the bacterial suspension was added to the T84 cell monolayer to get a multiplicity of infection (MOI) of 25:1 and incubated at 37 °C in a 5 % CO2 incubator. The cultures used to infect the T84 cell monolayers were serially diluted, plated on blood agar and incubated microaerobically for 48 h for calculating the size of the inoculum. For the infection studies, after 20 min incubation, the monolayer was washed with PBS and 2 ml of gentamicin at 100 lg/ml added and incubated at room temperature for 2 h. After 2 h, the monolayer was washed again with PBS and 2 ml of 1 % Triton X-100 added. After 5 min, the monolayer, which by this time was lysed, was mixed well, serially diluted, plated on blood agar and incubated microaerobically for 48 h, after which bacterial colonies were counted. The results of the invasion assay are presented as the percentage of the input number of bacteria that survived the bactericidal action of gentamicin (total colony forming units (CFU) recovered from a well divided by the CFU in the inoculum) 9 100. Statistical Analysis All the statistical tests were carried out using GraphPad Prism analysis software version 5.01 for Windows, GraphPad Software, La Jolla, CA, USA, www.graphpad.com. All experiments were done in triplicates and results were compared by unpaired, one tailed t test using Prism analysis software.

Results and Discussion Campylobacter species are major causative agents of bacterial human food-borne infection and their control in the food chain requires a better understanding of the behaviour of the bacteria in relevant host environments. In the past 40 years, poultry consumption has rapidly increased [18]. With the growth of intensive and controlled housing environments, and fast growing broiler breeds, the production and consumption of chicken have vastly increased, as has the incidence of C. jejuni infections in humans. Poultry is a large risk factor for Campylobacter infection [20, 22, 35]. Interestingly, campylobacter are rarely cause invasive infection in chickens. In humans, they are the main bacterial cause of food-borne gastroenteritis worldwide [3, 7, 34]. The underlying mechanism for the difference in the behaviour of campylobacter in different hosts is not clear. The knowledge and understanding of the underlying mechanisms responsible for the difference in the behaviour of campylobacter might provide answers to how it colonises chickens and produce disease only in humans.

123

336


Several previous studies have shown that the difference in the behaviour of bacteria may be temperature dependent. Campylobacter may use temperature to sense that it has invaded the chicken reservoir (core body temperature of 42 °C) or the human host (core temperature of 37 °C) [31]. It has been suggested that differential gene expression at these two temperatures may allow this organism to colonise its host efficiently, leading to non-pathogenic or pathogenic behaviour. To observe phenotypic differences in growth and virulence characteristics, Campylobacter species were grown at two important physiological temperatures of 37 and 42 °C and three important virulence factors, growth, motility and invasion, were studied in this study. Furthermore, to study the inter-species differences we studied three different species: C. jejuni, C. coli and C. fetus. In addition, to determine any intra-species differences, we have used two different C. jejuni and C. coli strains.

Fig. 1 Growth of C. jejuni 81116 (a), C. jejuni M1 (b), C. coli 1669 (c), C. coli RM2228 (d) and C. fetus fetus (e) in Mueller–Hinton broth at 37 and 42 °C. Optical densities were taken every hour. Results are the mean of three separate experiments, and bars represent standard error. Solid squares are values at 37 °C, open circles 42 °C

123

Bacterial Growth Assays To examine the growth patterns of Campylobacter, the strains were grown in the Bioscreen C for 48 h. C. jejuni 81116 (Fig. 1a) and C. jejuni M1 (Fig. 1b) showed different growth patterns at two temperatures but did not show significant difference in final OD at 37 and 42 °C after 48 h. C. coli 1669 (Fig. 1c) and C. coli RM2228 (Fig. 1d) showed significantly higher OD values at 42 °C compared to 37 °C at 48 h. C. fetus fetus (Fig. 1e) did not show significant growth at 42 °C but grew well at 37 °C. Measurement of Motility To examine the motility, Campylobacter were inoculated on motility agar and, after incubation, the diameter of the swarming was measured. C. jejuni 81116 (Fig. 2a) showed significantly (P = 0.004) higher motility at 42 °C than at


37 °C but there was no difference in the motility of C. jejuni M1 (Fig. 2b) (P = 0.056) between two different temperatures. C. coli 1669 (Fig. 2c) showed significantly (P = 0.001) higher motility at 42 °C than at 37 °C, as did C. coli RM2228 (Fig. 2d; P = 0.03). C. fetus fetus (Fig. 2e) showed significantly (P = 0.006) higher motility at 37 °C compared to 42 °C. The flgH Gene Expression by RT-qPCR Analysis To further examine the motility, the expression levels of flgH gene at 37 and 42 °C were measured by quantitative real-time PCR. We have noted that relative expression of the flgH gene in C. jejuni 81116 at 42 °C was 6.52 times higher (not statistically significant) than at 37 °C (Fig. 3a), and in C. coli 1669 at 42 °C it was 2.69 times (not statistically significant) expression at 37 °C (Fig. 3b). Invasion of Campylobacter into T84 Cells Invasion by Campylobacter was determined by a gentamicin protection assay. C. jejuni 81116 (Fig. 4a) and C.

337

jejuni M1 (Fig. 4b) showed significantly (P = 0.022 and 0.019, respectively) higher invasion at 37 °C than at 42 °C. C. coli (Fig. 4c) also showed significantly (0.032) higher invasion at 37 °C than at 42 °C. C. fetus fetus (Fig. 4d) showed a lower invasion level compared to the above species at 37 °C, and at 42 °C it did not show significant invasion. We have examined the behaviour of C. jejuni at 37 °C (human body temperature) and 42 °C (chicken body temperature) because poultry is considered as the most important risk factor for human C. jejuni infection [20]. It was observed that C. jejuni grows similarly at both 37 and 42 °C; however, some strains were more motile at 42 °C (Figs. 1, 2). Intestinal mucins are a key component of the first line of host defence against intestinal pathogens. They form viscous gels that trap micro-organisms and limit their diffusion to the intestinal epithelium [2]. Colonisation of the epithelium requires the ability to move into the mucus layer. Motility is an important virulence factor for C. jejuni, as it can help in tissue tropism and transport through mucus towards epithelial cells and increases the efficiency

Fig. 2 Motility of C. jejuni 81116 (a), C. jejuni M1 (b), C. coli 1669 (c), C. coli RM2228 (d) and C. fetus fetus (e) at 37 and 42 °C. Size of the motility halo after 48 h at 37 °C (black) and 42 °C (white). Results are the mean of three separate experiments. Star indicates P \ 0.05

123

338


of attachment and invasion of host cells [16, 33]. C. jejuni crosses the mucus layer, adheres to the epithelial cells and a subpopulation subsequently invades the epithelial cells,

a

b

Fig. 3 The flgH gene expression at 37 and 42 °C by C. jejuni 81116 (a), C. jejuni M1 (b) and C. coli 1669 was measured by quantitative real-time PCR analysis. The fold change in the expression of flgH gene levels are shown. Results are the mean of three separate experiments, and bars represent standard error Fig. 4 Invasion of T84 epithelial cells by C. jejuni 81116 (a), C. jejuni M1 (b), C. coli 1669 (c) and C. fetus fetus (d) was determined by gentamicin protection assay. The percentage of invading cells in the inoculum at 37 °C (black) and 42 °C (white) are shown. Results are the mean of three separate experiments, and bars represent standard error. Star indicates P \ 0.05

123

which results in mucosal damage and inflammation [11]. Given that the possession of flagella is an important virulence factor in Campylobacter spp., increased motility may enhance colonisation in chickens and may contribute to spread in poultry flocks. The expression of flagella genes is temperature regulated; in a study by Alm et al. [1], flaB gene expression has been shown to be induced by 2.5-fold at a growth temperature of 42 °C compared to induction at 37 °C. Although the difference is not statistically significant, we have noted that relative expression of the flgH gene was 6.52 and 2.69 times higher at 42 °C in C. jejuni 81116 and C. coli 1669, respectively (Fig. 3). Our results also support the notion that the expression of flagellin gene is temperature regulated. Campylobacter jejuni is more invasive into cultured epithelial cells at 37 °C than at 42 °C (Fig. 3), which may be one of the reasons for the occurrence of disease in humans and a largely non-pathogenic/carrier state in chickens. Similar observations were also made in other studies of C. jejuni, which showed higher growth rate and chemotactic behaviour at 37 °C than at 42 °C [23]. C. coli strains showed significantly better growth and motility at 42 °C (Figs. 1, 2). Previous studies have shown that this bacterium grows best at 42 °C and is more motile at this temperature [1]. In spite of good growth and motility at 42 °C, C. coli 1669 were more invasive at 37 °C (Fig. 4). This may be the reason that C. coli does not cause disease in poultry, further studies looking into expression of various genes to see why invasion was less at 37 °C could be done. C. fetus fetus, which is infrequently found in poultry, was less able to grow, move and invade at 42 °C, showed better growth, motility and invasion at 37 °C (Figs. 1, 2, 4).


This may partially explain why broiler chickens are not reservoirs for C. fetus fetus [21] and have no role in infection of humans with this bacterium. It is possible that the difference in the invasiveness of campylobacter in humans could be due to other factors, such as the difference in the composition of intestinal mucus. Byrne et al. [4] compared the interaction of campylobacter with primary intestinal cells from human and poultry to identify factors responsible for different outcome following exposure to campylobacter. They have noted that chicken mucus significantly reduced invasion of primary human intestinal cells by C. jejuni, in contrast human mucus promoted invasion of intestinal cells by C. jejuni. They have concluded that the difference in the pathogenicity of campylobacter is due to difference in the composition of mucus and not related to difference in the core body temperature. However, this study has several drawbacks. They have mentioned that human mucus promoted the invasiveness of C. jejuni into intestinal cells but it did not reach statistical significance. In addition, microbial flora present in the crude chicken mucus has been shown to reduce colonisation of chicken intestinal cells by the bacteria. Stintzi and Whitworth [32] noted that regulation of certain protein levels was temperature dependent. They have noted up-regulation of heat shock proteins when the temperature was increased from 37 to 42 °C but these were unaffected or down-regulated when temperature was decreased from 42 to 37 °C suggesting that these genes are not required at lower temperatures. Campylobacter spp. grown at 37 and 42 °C have been shown to have a different ability to survive in food and water. C. jejuni from animal sources grown at 37 °C are able to survive longer in water at 4 °C than those grown at 42 °C, representing a potentially greater public health risk [10]. Line et al. [25, 26] have demonstrated phenotypic metabolic changes associated with growth of campylobacter at 37 and 42 °C. They have determined the utilisation of 190 different sole carbon substrates by C. jejuni 11168 [25] and C. coli ATCC 49941 [26] at 37 and 42 °C using phenotypic micro-array technologies. They have found that amino acid utilisation was temperature dependent. The utilisation of certain amino acids, L-serine, L-aspartic acid, L-asparagine and L-glutamic acid, and oxidation of number of organic acids was much higher by C. jejuni 1118 at 42 °C. In the subsequent experiments, authors have noted greater utilisation of certain amino acids, e.g. L-glutamine and organic substrates including succinate, DL-malate supporting active respiration by C. coli to a significantly greater extent at 42 °C. Authors have suggested further investigations to determine the basis for the temperature-dependent utilisation of substrates by Campylobacter spp. and their possible role in species-specific colonisation.

339

The results of our study also support the fact that body temperature does have an effect on growth, motility and invasion potential of Campylobacter. Strains showing better growth and motility at 42 °C, such as C. coli, were more invasive at 37 °C, whereas strains more motile at 42 °C were more invasive at 37 °C as C. jejuni 81116. However, from the available evidence it is not clear whether the difference in the pathogenicity of campylobacter is solely dependent on temperature or other factors such as composition of intestinal mucus or viscosity. Further studies are required to understand the mechanisms responsible for the divergent difference in the behaviour of campylobacter in different hosts. Acknowledgments The authors would like to thank the Department for the Environment, Food and Rural Affairs (DEFRA) and the Higher Education Funding Council for England (HEFCE) for supporting and funding this study through the Veterinary Training and Research Initiative.

References 1. Alm RA, Guerry P, Trust TJ (1993) The Campylobacter sigma (54) flab flagellin promoter is subject to environmental regulation. J Bacteriol 175(14):4448–4455 2. Belley A, Keller K, Gottke M, Chadee K, Goettke M (1999) Intestinal mucins in colonization and host defense against pathogens. Am J Trop Med Hyg 60:10–15 3. Blaser MJ (1997) Epidemiologic and clinical features of Campylobacter jejuni infections. J Infect Dis 176(Suppl 2):S103– S105 4. Byrne CM, Clyne M, Bourke B (2007) Campylobacter jejuni adhere to and invade chicken intestinal epithelial cells in vitro. Microbiology 153:561–569 5. Cogan TA, Thomas AO, Rees LE, Taylor AH, Jepson MA, Williams PH et al (2007) Norepinephrine increases the pathogenic potential of Campylobacter jejuni. Gut 56(8):1060–1065 6. Corry JEL, Post DE, Colin P, Laisney MJ (1995) Culture media for the isolation of campylobacters. Int J Food Microbiol 26:43–76 7. Crushell E, Harty S, Sharif F, Bourke B (2004) Enteric Campylobacter: purging its secrets? Pediatr Res 55:3–12 8. Dharmsathaphorn K, McRoberts JA, Mandel KG, Tisdale LD, Masui H (1984) A human colonic tumor cell line that maintains vectorial electrolyte transport. Am J Physiol 246(2 Pt 1):G204– G208 9. Dorman CJ (1991) DNA super coiling and environmental regulation of gene expression in pathogenic bacteria. Infect Immun 59(3):745–749 10. Duffy L, Dykes GA (2006) Growth temperature of four Campylobacter jejuni strains influences their subsequent survival in food and water. Lett Appl Microbiol 43(6):596–601 11. Everest PH, Goossens H, Butzler JP, Lloyd D, Knutton S, Ketley JM, Williams PH (1992) Differentiated Caco-2 cells as a model for enteric invasion by Campylobacter jejuni and Campylobacter coli. J Med Microbiol 37(5):319–325 12. Fernie DS, Park RW (1977) The isolation and nature of campylobacters (microaerophilic vibrios) from laboratory and wild rodents. J Med Microbiol 10(3):325–329 13. Fouts DE, Mongodin EF, Mandrell RE, Miller RE, Miller WG, Rasko DA et al (2005) Major structural differences and novel

123

340

14.

15. 16.

17.

18. 19. 20.

21.

22. 23.

24.

25.

S. V. Aroori et al.: Effect of Temperature on Campylobacter Pathogenicity potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biol 3:e15 Friis LM, Pic C, Pearson BM, Wells JM (2005) In vitro cell culture methods for investigating Campylobacter invasion mechanisms. J Microbiol Methods 61(2):145–160 Garcia M, Eaglesome MD, Rigby C (1983) Campylobacters important in veterinary medicine. Vet Bull 53:793–818 Grant CC, Konkel ME, Cieplak W, Tompkins LS (1993) Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures. Infect Immun 61(5):1764–1771 Hazeleger WC, Janse JD, Koenraad PM, Beumer RR, Rombouts FM, Abee T (1995) Temperature-dependent membrane fatty acid and cell physiology changes in coccoid forms of Campylobacter jejuni. Appl Environ Microbiol 61(7):2713–2719 Hewson P (1986) Origin and development of the British poultry industry: the first hundred years. Taylor Francis 27:525–539 Hurme R, Rhen M (1998) Temperature sensing in bacterial gene regulation—what it all boils down to. Mol Microbiol 30(1):1–6 Jørgensen F, Bailey R, Williams S, Henderson P, Wareing DR, Bolton FJ, Frost JA, Ward L, Humphrey TJ (2002) Prevalence and numbers of Salmonella and Campylobacter spp. on raw, whole chickens in relation to sampling methods. Int J Food Microbiol 76(1–2):151–164 Kempf I, Dufour-Gesbert F, Hellard G, Prouzet-Maule´on V, Me´graud F (2006) Broilers do not play a dominant role in the Campylobacter fetus contamination of humans. J Med Microbiol 55(9):1277–1278 Ketley JM (1997) Pathogenesis of enteric infection by Campylobacter. Microbiology 143:5–21 Khanna MR, Bhavsar SP, Kapadnis BP (2006) Effect of temperature on growth and chemotactic behaviour of Campylobacter jejuni. Lett Appl Microbiol 43(1):84–90 Lee A, O’Rourke JL, Barrington PJ, Trust TJ (1986) Mucus colonization as a determinant of pathogenicity in intestinal infection by Campylobacter jejuni: a mouse cecal model. Infect Immun 51(2):536–546 Line JE, Hiett KL, Guard-Bouldin J, Seal BS (2010) Differential carbon source utilisation by Campylobacter jejuni 11168 in response to growth temperature variation. J Microbiol Methods 80(2):198–202

123

26. Line J, Hiett K, Guard J, Seal B (2011) Temperature affects sole carbon utilization patterns of Campylobacter coli 49941. Curr Microbiol 62(3):821–825 27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25(4):402–408 28. Murakami H, Masui H (1980) Hormonal control of human colon carcinoma cell growth in serum-free medium. Proc Natl Acad Sci USA 77(6):3464–3468 29. Palmer SR, Gully PR, White JM, Pearson AD, Suckling WG, Jones DM, Rawes JCL, Penner JL (1983) Water-borne outbreak of Campylobacter gastroenteritis. Lancet 321:287–290 30. Rozen S, Skaletsky HJ (2000) Primer 3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365–386 31. Stintzi A (2003) Gene expression profile of Campylobacter jejuni in response to growth temperature variation. J Bacteriol 185(6):2009–2016 32. Stintzi A, Whitworth L (2003) Investigation of the Campylobacter jejuni cold shock response by global transcript profiling. Genome Lett 2:18–27 33. Szymanski CM, King M, Haardt M, Armstrong GD (1995) Campylobacter jejuni motility and invasion of Caco-2 cells. Infect Immun 63(11):4295–4300 34. Takkinen J, Ammon A, Robstad O, Breuer T (2003) European survey on Campylobacter surveillance and diagnosis 2001. Euro Surveill 8:207–213 35. Thomas CH, Gibson H, Hill DJ, Mabey M (1999) Campylobacter epidemiology: an aquatic perspective. J Appl Microbiol 85:168S– 177S 36. van de Giessen AW, Heuvelman CJ, Abee T, Hazeleger WC (1996) Experimental studies on the infectivity of non-culturable forms of Campylobacter spp. in chicks and mice. Epidemiol Infect 117(3):463–470 37. Young KT, Davis LM, Dirita VJ (2007) Campylobacter jejuni: molecular biology and pathogenesis. Nat Rev Microbiol 5(9):665–679 38. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31(13):3406–3415