The Effect of Serial Passaging on the Proliferation and ...

Original Paper Cells Tissues Organs 2012;195:414–427 DOI: 10.1159/000329254

Accepted after revision: May 10, 2011 Published online: September 5, 2011

The Effect of Serial Passaging on the Proliferation and Differentiation of Bovine Adipose-Derived Stem Cells Yimu Zhao a, d Stephen D. Waldman a, b, d Lauren E. Flynn a, c, d Departments of a Chemical Engineering, b Mechanical and Materials Engineering and c Anatomy and Cell Biology, Queen’s University, and d Human Mobility Research Centre, Kingston General Hospital, Kingston, Ont., Canada

Key Words Tissue engineering ⴢ Adipose-derived stem cells ⴢ Cell culture ⴢ In vitro proliferation ⴢ Multi-lineage differentiation

Abstract Adipose-derived stem cells (ASCs) represent an excellent cell source for the development of regenerative therapies for a broad variety of tissue disorders. Commonly, in vitro expansion is necessary to obtain sufficient cell populations for research purposes and clinical applications. Although it has been demonstrated that human ASCs can maintain their adipogenic, chondrogenic and osteogenic potential in longterm culture (up to 15 passages), it is not guaranteed that a satisfactory level of differentiation is achievable in later passages. In this study, we investigated the self-renewal and multilineage differentiation capacity of bovine ASCs, isolated from the interdigital fat pad, and explored how serial passaging influences the cells. A proliferation study examined the changes in growth kinetics from passage 1 to 5, and multilineage (adipogenesis, chondrogenesis and osteogenesis) differentiation studies were conducted to compare the potential between passage 2 (P2) and passage 5 (P5). From the proliferation study, a statistically significant change in the doubling time did not appear until P5. In the differentiation study, both P2 and P5 ASCs could be stimulated to undergo multilineage differentiation under specific culturing con-

© 2011 S. Karger AG, Basel 1422–6405/12/1955–0414$38.00/0 Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

Accessible online at: www.karger.com/cto

ditions. However, adipogenic and chondrogenic cultures showed significantly lower levels of differentiation in the P5induced cultures. In contrast, P5-induced osteogenic cultures had higher alkaline phosphatase enzyme activity than P2-induced cultures, suggesting an increase in the osteogenic response with serial passaging. Overall, bovine ASCs are capable of self-renewal and multilineage differentiation; however, long-term in vitro expansion has a negative effect on adipogenic and chondrogenic differentiation, while potentially favoring osteogenesis. Copyright © 2011 S. Karger AG, Basel

Introduction

Adipose tissue is an extremely promising source of autologous or allogenic stem cells, termed adipose-derived stem cells (ASCs), for regenerative therapies for the treatment of various tissue disorders, including those affecting bone, cartilage and fat [Zuk et al., 2001; Strem et al., 2005; Fraser et al., 2006; Chamberlain et al., 2007; Yang et al., 2007; Mizuno, 2009]. ASCs have many advantages over bone marrow-derived mesenchymal stem cells (MSCs), including that they are more easily isolated using minimally invasive techniques, and that the multipotent population within adipose tissue is more abundant per extraction volume [Gimble and Guilak, 2003]. More speDr. Lauren Elizabeth Flynn Department of Chemical Engineering, Queen’s University Dupuis Hall, Room 210 19 Division St., Kingston, ON K7L 3N6 (Canada) Tel. +1 613 533 6000, ext. 79177, E-Mail lauren.flynn @ chee.queensu.ca

Abbreviations used in this paper

ASC bASC BSA C/EBPa DTT DMEM DMMB DNA EDTA FBS GAG GAPDH GPDH IHC LPL MSC OCN P2 P5 PBS PCR PPAR␥ RNA RT-PCR sGAG TGF-␤1 U

adipose-derived stem cell bovine adipose-derived stem cell bovine serum albumin CCAAT/enhancer binding protein-a dithiothreitol Dulbecco’s modified Eagle’s medium dimethylene blue deoxyribonucleic acid ethylenediaminetetraacetic acid fetal bovine serum glycosaminoglycan glyceraldehyde-3-phosphate dehydrogenase glycerol-3-phosphate dehydrogenase immunohistochemical lipoprotein lipase mesenchymal stem cell osteocalcin passage 2 passage 5 phosphate-buffered saline polymerase chain reaction peroxisome proliferator activated receptor-␥ ribonucleic acid reverse transcriptase-polymerase chain reaction sulphated glycosaminoglycan transforming growth factor-␤1 unit

cifically, a clinically relevant stem cell yield from fat is possible, as up to 1 ! 108 viable ASCs can be isolated from processed human lipoaspirates in the range of 100– 500 ml, depending on the donor source [De Ugarte et al., 2003a]. In contrast, only a very small percentage (0.001– 0.01%) of cells from bone marrow isolates have recognized multilineage potential [De Ugarte et al., 2003b]. Further, ASCs have been demonstrated to trigger minimal immune response in allogenic applications in vivo [Gimble and Guilak, 2003] and downregulate T cell activation in vitro [McIntosh et al., 2006]. Recent research has demonstrated that ASCs are capable of long-term self-renewal in culture, while maintaining multipotency in several species, such as human, mouse and rat [Zuk et al., 2001; Strem et al., 2005; Zheng et al., 2006; Neupane et al., 2008]. Bovine preadipocytes have been previously described in the literature [Nakajima et al., 2002; Hirai et al., 2007; Ohsaki et al., 2007]. More recently, Sampaio et al. [2009] published a brief report suggesting that cells from bovine adipose tissue can be induced to express histological markers of the adipogenic and osteogenic linSerial Passaging and Bovine Adipose-Derived Stem Cells

eages. However, the presence of a multipotent stem cell population within bovine adipose tissue has not yet been fully investigated. For most cell biology and tissue-engineering applications, the cells of interest first need to be expanded in vitro in order to obtain sufficient quantities of purified cells for cell culture studies and/or implantation models, with most studies using stem cells between passages 1 and 5. Therefore, it is important for ASCs to maintain their stem cell capacity to differentiate while undergoing extensive in vitro expansion. Bone marrow-derived MSCs have been shown to maintain osteogenic differentiation capacity for 10–15 passages, but adipogenic potential decreases rapidly with increasing time in culture [Bruder et al., 1997; Digirolamo et al., 1999]. While Zuk et al. [2001] showed that subpopulations of human ASCs obtained from lipoaspirates proliferate well for up to 15 passages, adipogenic, chondrogenic and osteogenic differentiation was assessed only at the first passage. As an extension of this work, Wall et al. [2007] found that only a fraction of human ASCs retain their ability to differentiate along the adipogenic and osteogenic lineages through 10 passages, using defined differentiation media containing cocktails of stimulatory factors. Overall, it remains unclear whether ASCs retain a satisfactory level of differentiation after extensive in vitro culturing. These studies raise the issues of whether there is a threshold for maintained ASC proliferation ability and multipotent differentiation capacity, as well as when this threshold might occur. A thorough understanding of the ASC response within the culture environment would ensure that optimized conditions could be utilized in future studies. As such, the objectives of the current study were to isolate and characterize the ASC population from the bovine interdigital fat pad, and to investigate the influence of the in vitro cell culture environment on the proliferation ability and multilineage differentiation potential of the cells after serial passaging. Materials and Methods Materials Unless otherwise stated, all reagents were purchased from Sigma-Aldrich Canada Ltd. (Oakville, Ont., Canada) and were used as received. Bovine ASC Isolation and Culture Bovine adipose-derived stem cells (bASCs) were extracted under sterile conditions from the interdigital fat pad found in the hoof, from adult tissues obtained from a commercial slaughterhouse. Cell isolation methods were based on human ASC extrac-

Cells Tissues Organs 2012;195:414–427

415

tion protocols described by Flynn et al. [2007]. Briefly, the fat pads were minced and digested under agitation (120 rpm) at 37 ° C for 1 h in Krebs-Ringer buffer containing 2% collagenase type VIII, 3 mM glucose, 25 mM HEPES and 20 mg/ml bovine serum albumin. The bASC-enriched cell fraction was pelleted by centrifugation at 1200 g for 5 min. Red blood cells were lysed using erythrocyte lysing buffer (0.154 M NH4Cl, 10 mM KHCO3, 0.1 mM ethylenediaminetetraacetic acid, EDTA) under gentle agitation for 10 min at room temperature. The bASCs were then resuspended in growth medium (1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s F-12 nutrient mixture, DMEM:Ham’s F-12, supplemented with 10% fetal bovine serum, FBS, 100 U/ml penicillin and 0.1 mg/ml streptomycin) [Flynn et al., 2006] and filtered through a 100-␮m nylon filter. The cells were then washed 3 times in sterile cation-free phosphate-buffered saline (PBS), and resuspended in growth medium. Isolated bASCs were plated in 75-cm2 flasks (Corning T-75, 30,000 cells/cm2) and incubated at 37 ° C with 5% CO2. The growth medium was changed 24 h after isolation and every 2–3 days thereafter. For passaging, cells at 90% confluence were trypsin released (0.25% trypsin/0.1% EDTA; Gibco, Burlington, Ont., Canada), washed, counted and replated in new flasks at a density of 30,000 cells/cm2.

bASC Proliferation bASCs (n = 3, N = 5) from passage 1–5 were seeded in 12-well plates at a density of 2,000 cells/cm2, and 3 wells of each passage were trypsin released and counted daily using a hemocytometer with trypan blue viability staining, for up to 8 days after seeding. The population doubling time was calculated from the slope of the linear portion of the growth curve (that is, log total viable cells vs. time), assuming exponential growth. bASC Differentiation and Preliminary Characterization Passage 2 (P2) and passage 5 (P5) bASCs, from the same donor source were differentiated towards the adipogenic, chondrogenic or osteogenic lineages, with characterization carried out at 14 days after induction. Triplicate negative control samples (that is, noninduced) cultured in growth medium (DMEM:Ham’s F-12, 10% FBS, 1% pen-strep), were included in every trial. Adipogenic Differentiation bASCs were plated at a density of 50,000 cells/cm2 and cultured in growth medium for 48 h. The cells were then cultured in adipogenic induction medium (0.5 mM 3-isobutyl-1-methylxanthine, 0.25 ␮ M dexamethasone, 2.5 ␮g/ml insulin, and 5 ␮ M troglitazone and 1% penicillin-streptomycin in DMEM:Ham’s F-12) for 48 h and then transferred into adipogenic differentiation medium (5% FBS, 2.5 ␮g/ml insulin, and 5 ␮ M troglitazone and 1% penicillin-streptomycin in DMEM:Ham’s F-12) [Hirai et al., 2007] for the remainder of the culture period, with medium exchanges 3 times per week. Adipogenesis was assayed in terms of glycerol-3-phosphate dehydrogenase (GPDH) enzyme activity (n = 3, N = 3) as well as oil red O staining of intracellular lipid accumulation (n = 3, N = 3) at 14 days after the induction of differentiation. Glycerol-3-Phosphate Dehydrogenase Activity. Fourteen days after the adipogenic induction, triplicate wells from induced and control cultures (P2 and P5 cultured in proliferation medium) were rinsed with PBS. GPDH enzyme activity was then determined using a GPDH measurement kit (cat. No. KT-010; Kamiya

416


Biomedical, Seattle, Wash., USA). To extract the total intracellular protein content, the cells were disrupted by sonication with three 5-second bursts in 2 ml of extraction buffer (supplied with the kit) with intermittent cooling on ice. The samples were then centrifuged (13,000 g for 10 min at 4 ° C) and the supernatants were immediately assayed according to the manufacturer’s instructions. Data was normalized to the total intracellular protein concentration measured using a Bio-Rad protein assay (cat. No. 5000002; Bio-Rad Laboratories Inc., Hercules, Calif., USA) with an albumin standard. One unit of GPDH activity was defined as the amount required to consume 1 ␮mol of NADH in 1 min. Oil Red O Staining. Intracellular lipid accumulation was assessed by oil red O staining 14 days after adipogenic induction. Cultures were rinsed thoroughly with PBS and fixed for 30 min in 10% neutral buffered formalin. Oil red O stock solution (3 g/l in isopropanol) was prepared according to the protocol of Flynn et al. [2007]. Briefly, 1 ml of oil red O working solution (stock solution diluted 3:2 in deionized water) was applied to each well for 5 min, followed by extensive rinsing with distilled water and counterstaining with hematoxylin for 2 min.

Chondrogenic Differentiation Three-dimensional pellet cultures of bASCs (2 ! 106 cells/ pellet) were created by centrifugation (300 g for 10 min), and then transferred into 24-well plates coated with 2% agarose (type VII) to limit cell adhesion (while maximizing medium exposure and gas transfer) and initially cultured in growth medium. After 48 h, the pellets were transferred into chondrogenic medium (10 ng/ml recombinant human transforming growth factor-␤1 (TGF-␤1; PeproTech Inc., Rocky Hill, N.J., USA), 50 ␮g/ml ascobate-2phosphate, 6.25 ␮g/ml bovine insulin, 100 nM dexamethasone in growth medium) [Neupane et al., 2008] with medium exchanges 3 times per week. Chondrogenesis was analyzed using toluidine blue staining of glycosaminoglycans (GAG) (n = 3, N = 3), immunohistochemical (IHC) localization of collagen types I and II (n = 3, N = 3), as well as quantitative analysis of sulphated GAG (sGAG) content, using the dimethylene blue (DMMB) assay (n = 3, N = 2), and hydroxyproline content, as an estimation of total collagen (n = 3, N = 2) at 14 days after the induction of differentiation. Negative control bASC pellets cultured in proliferation medium for the same duration were included to facilitate comparative analyses. Toluidine Blue Staining. For histology and IHC analysis, 14 days after induction, the pellets were fixed overnight in 4% paraformaldehyde, paraffin embedded and sectioned (5-␮m sections). Sections were incubated overnight at 65 ° C, deparaffinized, and rehydrated in distilled water prior to toluidine blue staining (0.1% for 2–3 min). IHC Staining for Collagen I and II. After deparaffinization, sections were incubated in 0.5 U/ml chondroitinase and 0.5 U/ml hyaluronidase, each for 30 min, to facilitate antigen availability. Endogenous peroxidase activity was neutralized with 0.3% hydrogen peroxide for 30 min, followed by overnight incubation with the primary antibody (either 1:200 dilution of mouse polyclonal anti-human collagen II or 1:10 dilution of anti-rabbit collagen I; Biolynx, Brockville, Ont., Canada) at 4 ° C. All antibodies were tested for cross-reactivity with the bovine system in the Waldman research group. Detection was facilitated using the Vectastain ABC Kit (mouse IgG for collagen II and rabbit IgG for collagen I; Vector Labs, Burlingame, Calif., USA) with DAB as the

Zhao /Waldman /Flynn

substrate and counterstained using methyl green [Waldman et al., 2008]. Controls without primary antibodies were included to detect nonspecific staining. Sulphated GAG and Collagen Content. After 14 days of culture in chondrogenic medium, bASC pellets (n = 3, N = 2) were washed with PBS and digested in papain solution (40 mg/ml in 20 mM ammonium acetate, 1 mM EDTA, and 2 mM dithiothreitol) for 72 h at 65 ° C. As described, triplicate negative control pellets (n = 3, N = 2) cultured in proliferation medium were analyzed using identical methods. The papain digest aliquots were stored at –20 ° C and assayed separately for the sGAG [Goldberg and Kolibas, 1990], hydroxyproline and DNA contents [Waldman et al., 2002]. sGAG content was assessed according to the established DMMB assay [Farndale et al., 1986]. Collagen content was estimated from the determination of the hydroxyproline content, using the standard assumption that hydroxyproline accounts for 10% of the total collagen mass in cartilage [Heinegard et al., 1998]. In brief, aliquots of the papain digest were hydrolyzed in 6 N HCl at 110 ° C for 18 h and the hydroxyproline content was determined using the chloramine-T/Ehrlich’s reagent assay [Woessner, 1961]. For data normalization purposes, the DNA content was determined from aliquots of the papain digest using the Hoechst dye 33258 assay.

Osteogenic Differentiation bASCs were plated at a density of 20,000 cells/cm2 and cultured in growth medium for 48 h. The cells were then transferred to osteogenic medium (50 ␮ M ascorbate-2-phosphate, 10 mM ␤glycerophosphate, 100 nM dexamethasone in growth medium) [Zuk et al., 2001] for 12 days, with medium changes 3 times per week. Osteogenic differentiation was measured using the alkaline phosphatase (ALP) activity assay (n = 3, N = 3) as well as von Kossa staining of calcium deposition (n = 3, N = 3) at 14 days after the induction of differentiation. Negative control cultures maintained in proliferation medium were included for comparison in all assays. Alkaline Phosphatase Activity. Triplicate wells from both induced and control cultures (P2 and P5) were rinsed with PBS. Total intracellular protein was collected, using the methods described in the GPDH section. The ALP activity was measured using the p-nitrophenol phosphate liquid substrate system [Bessey et al., 1946; Beresford et al., 1986; Wang et al., 2008]. Briefly, 100 ␮l of liquid substrate was added into a well of a 96well plate containing 100 ␮l of the extracted intracellular protein or p-nitrophenol standards. The plates were incubated at 37 ° C for 15 min and quenched with 100 ␮l of 1 M NaOH per well. The absorbance was assayed using a microplate reader (405 nm wavelength) and the results were normalized to the total intracellular protein content, measured using the Bio-Rad protein assay. One unit of ALP activity was defined as the amount of enzyme required to catalyze the liberation of 1 ␮mol of p-nitrophenol per minute. Von Kossa Staining. Fourteen days after seeding, cultures were rinsed thoroughly with PBS and fixed for 30 min in 10% neutral buffered formalin. After rinsing with distilled water, cultures were stained with silver nitrate (1% in distilled water), incubated under UV light for 1 h, followed by incubation in sodium thiosulphate (5% in distilled water) for 5 min. The cultures were then counterstained with hematoxylin for 2 min.

Serial Passaging and Bovine Adipose-Derived Stem Cells

Reverse Transcriptase-Polymerase Chain Reaction Analysis Lineage-specific gene expression was assessed in all three investigated lineages at 14 days after induction (n = 3, N = 3). Negative control bASC cultures, maintained in proliferation medium for the same culture period, were included to qualitatively assess gene upregulation. As positive controls, freshly isolated mature bovine adipocytes, chondrocytes and osteoblasts were isolated from the native tissues of 12- to 18-month-old calves obtained from the commercial slaughterhouse. More specifically, mature adipocytes were isolated from the interdigital fat pad following collagenase digestion, as described in the bASC isolation methods. Primary articular chondrocytes were isolated from the metacarpalephalangeal joint, using established enzymatic (protease and collagenase) digestion methods [Boyle et al., 1995]. Mature osteoblasts were extracted from the cancellous bone in the sacral vertebrae from the tail using enzymatic (collagenase) digestion, as described in the literature [Gundle and Beresford, 1995]. The RNA was extracted from the mature populations immediately after cell isolation. First, total RNA was extracted from the cells (mature cells, induced and control samples from both P2 and P5) using TRIzol쏐 reagent (Invitrogen Canada Ltd.) according to the manufacturer’s instructions. The total RNA concentration and purity was determined using a NanoDrop spectrophotometer, and the 260/280 ratio generally ranged between 1.9 and 2.1. cDNA was synthesized from 1 ␮g of total RNA using random primers (Invitrogen) and SuperScriptTM II reverse transcriptase (RT) (Invitrogen). The reverse transcription was carried out in a 20-␮l reaction volume containing first-strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2), 10 mM dithiothreitol, 0.09 OD260 units of random primers (Invitrogen), 0.5 mM of each dNTP (Invitrogen) and 200 units of SuperScriptTM II RT. Gene-specific primers were designed using Primer3 software and are listed in table 1. GAPDH and 18S were included as the housekeeping genes [Gorzelniak et al., 2001]. The melting temperature for all primers was 60 ° C. Each polymerase chain reaction (PCR) was conducted in a 50-␮l reaction volume with 2.5 ␮l of diluted cDNA (containing 50 ng of input RNA), 1! Taq buffer (10 m M Tris-HCl, 50 mM KCl, 0.08% Nonidet P40), 250 nM forward primer, 250 nM reverse primer, 250 nM of each dNTP, 2.5 mM MgCl2 and 0.375 units of recombinant Taq DNA polymerase (Fermentas International Inc., Burlington, Ont., Canada). PCR was conducted for 40 cycles (95 ° C for 30 s, 58 ° C for 30 s, and 72 ° C for 30 s) using a Bio-Rad C1000 thermal cycler. Expression was analyzed following 5% agarose gel electrophoresis by ethidium bromide staining (G:box Chemi HR16; Syngene, Cambridge, UK). Minus-RT and no template controls were included in every run.

Statistical Analysis Unless otherwise stated, all numerical data are presented as means 8 standard error. For each experiment, the number of samples per group (n), plus the number of times each experiment was repeated with cells from a different donor (N) are indicated. Within an individual trial, all groups were seeded with bASCs isolated from one donor to eliminate the potential for donor-todonor variability. The effect of passage number was assessed using a one-way ANOVA with the Tukey post hoc test, performed using Origin Pro8 statistical software. A p value of less than 0.05 was considered to be statistically significant.


417

Table 1. Bovine-specific primer pairs used for RT-PCR

Markers

Gene

Primer sequence (5ⴕ–3ⴕ)

Amplicon size

Chondrocytes

Collagen II

Forward: CTCAAGTCCCTCAACAACCAG Reverse: TTGGGGTCGATCCAGTAGTC Forward: CAGTCACACCTGAGCAGCAT Reverse: CCTTCGATGGTCTTGTCGTT Forward: AGAAGGACCACCCGGACTAC Reverse: CGTTCTTCACCGACTTCCTC

134

Forward: ATGGAACTCCAGGTCAAACG Reverse: CACCAACACGTCCTCTCTCA Forward: CATGGGAGCTGGGAGAGTAA Reverse: AAGGGGCAAATGGATTAAG Forward: CAGATGACTCCTCCGTCCAT Reverse: ACTGAGAGTGGAAGGCCAGA

60

Aggrecan Sox9 Osteoblasts

Collagen I Osteocalcin RUNX2

Adipocytes

C/EBP␣ PPAR␥ LPL

Housekeeping

GAPDH 18S

57

113 147

Forward: ATCGACATCAGCGCCTACAT Reverse: CGGGTAGTCAAAGTCGTTGC Forward: CAGTGTCTGCAAGGACCTCA Reverse: GATGTCAAAGGCATGGGAGT Forward: TGCTGGTATTGCAGGAAGTC Reverse: AAAATCCGCATCATCAGGAG

138

Forward: CACCCTCAAGATTGTCAGCA Reverse: GTCTTCTGGGTGGCAGTGAT Forward: ATGGCCGTTCTTAGTTGGTG Reverse: GAACGCCACTTGTCCCTCTA

135

128 124

136

Table 2. Mean doubling times for passage 1–5 bASC

Results

Cellular Isolation Fat dissected from the bovine interdigital region (fig. 1a) was light yellow in color, with little or no visible vascularization (fig. 1b). Any white fibrous tissue associated with the pads was removed before digestion. After seeding, the isolated cells appeared to be small and flat, with several extending processes (fig. 1c). When the cells approached confluence, they became more spindle-like and elongated, closely packing together (fig. 1d). Proliferation Study bASCs at each of the 5 passages were examined for changes in growth kinetics through an 8-day proliferation study (fig. 2). Only passage 1 and 2 cells reached a plateau before day 7, whereas the other passages (P3–P5) appeared to proliferate through the 8-day culture period. Although total cell yields from each passage were not statistically different at the end of the culture period, the growth rate declined with increasing passage number (table 2). The doubling time of cells from passages 1–4 was 418

104


Mean, h Error

P1

P2

P3

P4

P5

16.44 0.33

17.39 0.26

17.71 0.14

18.66 0.11

22.06 0.32

Error represents the standard deviation (n = 3, N = 5).

the same at approximately 16–19 h, which significantly increased (p ! 0.05) at P5 to approximately 22 h. As a significant difference in the doubling time was only observed at P5, the differentiation studies were conducted using P2 (most commonly used to study differentiation) and P5 cells. Adipogenic Differentiation Cells from P2 and P5 were analyzed for levels of GPDH enzyme activity, intracellular lipid accumulation and mRNA expression of adipogenic markers at 14 days after the induction of adipogenic differentiation to determine Zhao /Waldman /Flynn

a

b

c

d

Fig. 1. Cow hoof interdigital region (a) and exposed bovine interdigital fat pad (b).

Representative cell morphology at 24 h after seeding (c) and confluence (d), observed by optical microscopy. Scale bars = 100 ␮m.

350,000 Passage 1 Passage 2 Passage 3 Passage 4 Passage 5

Total viable cells/well

300,000 250,000 200,000 150,000 100,000 50,000

Fig. 2. Growth kinetics of bASCs. Hemo-

cytometer cell counts represent the average number of viable cells per well. N = 5 donors, with 3 replicates per donor. Error bars represent the standard deviation.

0 0

1

2

3

4 Days

5

6

7

8

the ability of passaged bASCs to undergo adipogenesis (fig. 3). ASCs undergoing intracellular lipid accumulation tended to be found in clusters, while the remainder of the cells were unchanged. Approximately 40–50% of the cells differentiated, depending on the donor and passage number. GPDH assay results (fig. 3a) indicated that both P2- and P5-induced cultures had significantly upregulated GPDH enzymatic activity relative to the con-

trol cultures. However, P5 cells had approximately 50% of the GPDH activity of the P2 cells. The reduced adipogenesis at P5 was confirmed by oil red O staining (fig. 3b–e), which showed lower levels of intracellular lipid accumulation and a less mature phenotype in the P5 cells. More specifically, differentiated P2 cells had a more unilocular morphology, with large singular lipid droplets in the cytoplasm. In contrast, P5-induced cells contained multi-



419

GPDH enzymatic activity (mU/mg protein)

20

Passage 2 Passage 5

Passage 5

15

10

5

0 Controls

a

Passage 2

b

d

c

e

Adipogenic induced

–5 P2

P2 control P5

P5 control Native

CEBP␣ PPAR␥

LPL

GAPDH 18S

f

Fig. 3. Adipogenic differentiation of bovine ASCs assessed by 3 independent assays at 14 days after the induction of adipogenic differentiation. a GPDH enzyme activity showed upregulation in both induced cultures, with higher activity at P2. Oil red O staining of bASCs in P2 control culture (b), P2-induced culture (c), P5 control culture (d) and P5-induced culture (e). Scale bars = 100

␮m. Boxed regions in c and e are shown in detail below to visualize intracellular lipid accumulation at higher magnification. f Adipogenic gene expression (C/EBP␣, PPAR␥ and LPL) in P2 and P5 bASCs, and in freshly isolated bovine mature adipocytes (native; positive control). GAPDH and 18S are included as internal housekeeping genes.

ple, small lipid droplets located around the nucleus. Both P2 and P5 control cultures stained negative for intracellular lipid. The CCAAT/enhancer-binding protein- ␣ (C/ EBP␣), peroxisome proliferator activated receptor-␥ (PPAR␥) and lipoprotein lipase (LPL) genes were all expressed in P2-induced cultures as well as mature bovine adipocyte samples (positive control) (fig. 3f). In the P5induced cultures, C/EBP␣ and LPL genes were expressed at lower levels (compared to P2 cells) and PPAR␥ gene expression was undetected.

of differentiation. In all pellets, the cells maintained a packed and rounded morphology for the 2-week culture period, with no significant differences in pellet size between the control and induced groups. Initial studies with a cell density of 1 ! 106 bASCs/pellet produced pellets that were very small and difficult to process without disruption, so an optimized density of 2 ! 106 bASCs/ pellet was used for all comparative analyses. Control pellets from both P2 and P5 cells displayed limited GAG staining (fig. 4a, c), whereas both induced pellets (P2 and P5) had more intense staining, with P2-induced cultures showing greater GAG accumulation as compared to P5induced cultures (fig. 4b, d). P2- and P5-induced pellets stained positive for collagen type II (fig. 4f, h), with the P2-induced pellets displaying more intense staining than P5-induced pellets. All control pellets displayed no

Chondrogenic Differentiation Pellet cultures created from P2 and P5 cells were analyzed for GAG accumulation, synthesis of collagen I and II as well as chondrogenic gene expression analysis to measure chondrogenesis at 14 days after the induction 420



a

b

e

f

c

d

g

h

P2

P2 control

P5

P5 control

Native

Collagen II

AGC

i

j Sox9

GAPDH

18S

m k

l

Fig. 4. Chondrogenic differentiation of bovine ASCs assessed by

3 independent assays at 14 days after the induction of chondrogenic differentiation. Toluidine blue staining of GAG in P2 control pellets (a), P2-induced pellets (b), P5 control pellets (c) and P5-induced pellets (d). Collagen II IHC staining in P2 control pellets (e), P2-induced pellets (f), P5 control pellets (g) and P5-in-

duced pellets (h). Collagen I IHC staining in P2 control pellets (i), P2-induced pellets ( j), P5 control pellets (k) and P5-induced pellets (l). Scale bars = 100 ␮m. m Chondrogenic gene expression (collagen II, aggrecan and SOX9) compared between P2, P5 and freshly-isolated bovine chondrocytes (native; positive control). GAPDH and 18S are included as internal housekeeping genes.

obvious staining for collagen II (fig. 4e, g). In contrast, collagen I was detected in both the control and induced pellets from both passages (fig. 4i–l); however, P5 pellets displayed more intense staining than P2 for both the control and induced samples. In terms of gene expression (fig. 4m), P2-induced pellets expressed collagen II, aggrecan (AGC) and SOX9, whereas P5-induced pellets had lower expression of AGC and SOX9, and no detect-

able collagen II gene expression. Supporting the previous data, the DMMB assay indicated that there was statistically higher sGAG content in the P2-induced pellets than the P5-induced pellets (fig. 5). Further, based on the hydroxyproline content measurements, the total collagen content in the P2-induced cultures was statistically greater than all other samples (fig. 5).



421

30

dsDNA (µg/µg)

25 20 15

P2 control P2 P5 control P5

*

*

Discussion

10 5 0

Sulphated GAG content

Collagen content

Fig. 5. Mean hydroxyproline content and sGAG content, mea-

sured using the DMMB assay, in the chondrogenic testing of pellet-cultured bASCs (n = 3, N = 2). The hydroxyproline assay was used as an estimation of the total collagen content. All data was normalized to the total DNA content in each sample. Control samples were noninduced and cultured in proliferation medium. Error bars represent the standard deviation. * Statistically different at p ! 0.05.

An ALP assay was carried out on the P2- and P5-induced pellets at 14 days after the induction of chondrogenic differentiation, to assess the potential of osteogenic differentiation under the chondrogenic culturing conditions. Interestingly, the P2-induced samples had an average activity of 12 8 2 U/mg protein and P5-induced samples had an average activity of 13 8 1 U/mg protein, which was similar to the ALP activity levels measured in the osteogenic-induced cultures (fig. 6). Osteogenic Differentiation Cells from P2 and P5 were analyzed for levels of ALP enzyme activity, calcium deposition and osteogenic gene expression using RT-PCR at 14 days after the induction of differentiation to determine the osteogenic potential of the passaged bASCs. After 14 days, the induced bASCs became more cubical in morphology and had secreted extensive extracellular matrix. After prolonged culture (approx. 15–18 days), the cell sheets would detach from the plates, forming matrix-rich nodules. ALP activity (fig. 6a) was upregulated in both the P2- and P5-induced cultures, with P5-induced cells having higher ALP activity than P2-induced cells. While calcium deposition (observed by von Kossa staining) was undetectable in the control cultures (P2 and P5) (fig. 6b, d), positive staining for calcium deposition of similar intensity was observed for both induced cultures (P2 and P5) (fig. 6c, e). Gene expression results were 422

similar, without a detectable difference in the expression of RUNX2, osteocalcin and collagen I, between the P2- and P5-induced cultures (fig. 6f).


In this study, we have demonstrated that ASCs isolated from bovine interdigital fat, a structural adipose source, are capable of long-term in vitro expansion and multilineage differentiation up to P5. While bovine pre-adipocytes have been identified previously [Hirai et al., 2007; Ohsaki et al., 2007] and recent work has suggested the promise of multipotent stem cells within bovine fat [Sampaio et al., 2009], no published studies to date have fully investigated the multipotent (adipogenic, chondrogenic, osteogenic) stem cell population from bovine adipose tissue. The identification and characterization of this cell population is of interest in terms of developing a better understanding of ASCs in general, including the influence of species variability, as well as for applications in tissue-engineering models based on bovine sources [Boyle et al., 1995; Waldman et al., 2002; Waldman et al., 2006]. In order to characterize the proliferation ability and multipotent differentiation capacity of these cells, we first examined the growth kinetics of bASCs from passage 1–5. While there was no significant difference in the population doubling time from passages 1 to 4 (16–19 h), P5 cells displayed a statistically longer doubling time (22 h). This result is consistent with the study by Wall et al. [2007] who found that human ASC doubling times were significantly longer at passage 6 and later. In addition to the slower growth, changes in response to chemical stimuli were also observed after passage 4 [Wall et al., 2007]. Hence, using traditional cell expansion methods, it is likely that there is a threshold for ASC growth in vitro, after which their proliferative ability declines upon further passaging. This result has significant implications in terms of the application of these cells in tissue-engineering strategies, which commonly employ cells of passage 1–5. The observed increase in doubling time may be an indicator of specific changes in the bASC population, including a reduction in potency. A loss of multilineage differentiation potential with subculturing has been observed for other MSC sources [Digirolamo et al., 1999; Banfi et al., 2000; Muraglia et al., 2000]. In terms of models, Caplan [1991] introduced the concept of multipotent MSCs, and Aubin [1998] postulated that these MSCs give Zhao /Waldman /Flynn

ALP enzymatic activity (U/mg protein)

18

Color version available online

20

Passage 2 Passage 5

Passage 2

16

Passage 5

14 12 10 8 6 4 2 0

a

Controls P2

P2 control

b

d

c

e

Osteogenic induced P5

P5 control Native

Collagen I RUNX2 OCN GAPDH

18S

f

independent assays at 14 days after the induction of chondrogenic differentiation. a ALP enzyme activity showed significant upregulation in the induced cultures, with higher activity at P5. Von Kossa staining for mineralization of P2 control culture (b), P2-

induced culture (c), P5 control culture (d) and P5-induced culture (e). Scale bars = 100 ␮m. f Osteogenic gene expression (collagen I, RUNX2 and osteocalcin) in P2 and P5 samples, as well as in mature bovine osteoblasts (native; positive control). GAPDH and 18S are included as internal housekeeping genes.

rise to more restricted tri- or bipotential progenitors before ultimately becoming limited, monopotential precursors. Sarugaser et al. [2009] utilized clonal self-renewal and differentiation analyses to postulate that expanding MSCs become more restricted self-renewing progenitors by gradually losing their differentiation potential until they become fibroblasts. In these previous studies, adipogenic potential declines first, followed by chondrogenic potential. The osteogenic lineage is preserved the longest in culture, before the proliferating cells become fibroblastic. For human bone marrow-derived MSCs, this trend is supported by the work of Digirolamo et al. [1999], who found decay in the adipogenic differentiation potential with passaging, combined with calcium deposition in the adipogenic cultures after passage 8. However, the effects of serial passaging on the multipotent differentiation potential of ASCs have not been thoroughly characterized.

To better understand the effects of expansion on bASC differentiation, we compared the extent of differentiation towards the adipogenic, chondrogenic and osteogenic lineages between P2 and P5, based on the proliferation data and the common use of cells ^P5 in tissue-engineering applications. P2 was selected as a relevant control, as it is commonly used in differentiation studies in order to minimize the time in culture, while still obtaining a sufficiently sized cell population for experimental purposes [Flynn and Woodhouse, 2008]. In the present study, induced P2 bASCs had comparable levels of differentiation towards all three lineages investigated as what has been reported for ASCs from other species [Zuk et al., 2001; Strem et al., 2005; Im et al., 2006; Zheng et al., 2006; Neupane et al., 2008]. In terms of adipogenic differentiation, both GPDH enzyme activity and the presence of intracellular lipid indicated that there was a significantly higher level of differ-



Fig. 6. Osteogenic differentiation of bovine ASCs assessed by 3

423

entiation in the P2 cells compared to the P5 cells. This result was confirmed by C/EBP␣ and PPAR␥ gene expression analysis – two early markers of adipogenesis [Morrison and Farmer, 2000]. Both genes are required for lipogenesis, and the forced expression of either gene can induce adipogenesis in nonadipogenic cells [Tontonoz et al., 1994; Ailhaud, 2001; Lazar, 2002]. While the P5 cells showed minimal expression of C/EBP␣, PPAR␥ expression was absent in these cultures, indicative of a less differentiated state. Similarly, Wall et al. [2007] found decreases in PPAR␥ gene expression in human adipogenic ASC cultures with extended serial passaging. LPL, a downstream gene of C/EBP␣ [Previato et al., 1991], was expressed in both the P2 and P5 cells at similar levels, indicating that the bASCs at both passages were responsive to the adipogenic stimuli by expressing this lipase, which is required for triglyceride uptake during lipogenesis [Franssen et al., 2008]. The chondrogenic differentiation capacities of the bASCs were similar to the results observed with adipogenesis, in which there was a higher level of differentiation in the P2 cells. While the extent of collagen II staining was somewhat higher in the P2-induced cultures, GAG staining gave a better understanding of the differentiation state. The presence of GAG was more pronounced in the P2-induced cultures (compared to the P5-induced cultures) indicating an enhanced chondrogenesis in the early passage cells. This result was confirmed by quantification of sGAG content in the pellets by the DMMB assay, which clearly showed a statistically higher concentration in the P2-induced pellets. Similarly, the quantitative analysis of hydroxyproline content indicated that the P2-induced pellets contained a statistically higher total collagen content. Gene expression results confirmed these trends, as lower expression of SOX9 (an early chondrogenic marker [Mori-Akiyama et al., 2003; Akiyama et al., 2005; Hargus et al., 2008]), collagen II and AGC were found in the P5-induced pellets. Interestingly, collagen I was detected in all induced cultures. The presence of collagen I may indicate the cultures were not fully differentiated towards a chondrogenic phenotype. It is well recognized that there is a close relationship between chondrogenesis and osteogenesis both in vitro and in vivo [Leucht et al., 2008]. Thus, it is possible that the bASCs were driven towards an unstable chondrogenic state that could ultimately lead to osteogenesis in the cultures. This phenomenon is supported by the ALP data, which showed high levels of enzyme activity in the induced chondrogenic pellets. The inability to facilitate complete chondrogenic differentiation 424


and the formation of stable mature cartilage is a common limitation in cell-based regeneration strategies involving the differentiation of mesenchymal stem cells. Future work will include developing a better understanding of the pathways that drive this osteogenic/chondrogenic switch, in order to develop optimized conditions for chondrogenesis. In many studies to date, human ASCs are induced toward the adipogenic or chondrogenic lineages under serum-free or low serum (1%) conditions, as FBS contains a heterogeneous mixture of growth factors and hormones that can mediate proliferation, matrix synthesis, and inhibit both adipogenesis and chondrogenesis [Zuk et al., 2002; Guilak et al., 2004; Ogawa et al., 2004; Flynn and Woodhouse, 2008]. Interestingly, during our adipogenic medium optimization, we observed that the inclusion of 5% FBS was required after an initial serum-free induction phase (48 h), to facilitate long-term viability of the bovine ASCs, as well as significant intracellular lipid accumulation. In addition, higher concentrations of FBS (up to 10%) had beneficial effects on the chondrogenic differentiation of bovine ASCs in terms of protein synthesis and extracellular matrix production, with no apparent inhibitory effects or batch-to-batch variability issues. Species variability is well documented in the literature, and the differential effects of FBS on human versus bovine cells are not entirely unexpected. In terms of the osteogenic potential of the bASCs, a different trend was observed. No detectable differences between P2- and P5-induced cultures were observed in relation to all markers investigated, with the exception of ALP activity. Higher ALP activity levels were found in the P5-induced cultures, indicating a trend towards enhanced osteogenesis with serial passaging. This result is consistent with previous work on human bone marrowderived MSCs, which demonstrated that osteogenesis tends to dominate at later passages, at the expense of both the adipogenic and chondrogenic potentials [Digirolamo et al., 1999; Wall et al., 2007]. In contrast, extensive passaging of porcine bone marrow-derived MSCs resulted in a loss in osteochondrogenic potential while favoring adipogenesis [Vacanti et al., 2005]. The variation in these studies emphasizes that it is critical to understand the differences in differentiation potential between cell donor sources, both in terms of the species, as well as the specific tissue depot from which the cells originate. The influences of the cell culture microenvironment are well recognized as an important factor in mediating cellular behavior. In particular, the growth substrate stiffness has been shown to Zhao /Waldman /Flynn

influence stem cell specification [Engler et al., 2006]. Traditional plate culturing methods using two-dimensional tissue culture polystyrene, as employed in our current study, provide a high-stiffness substrate, which is most similar to bone matrix, rather than that of fat or cartilage. Thus, our results combined with these findings, may suggest that long-term in vitro expansion using traditional cell culture substrates favors the osteogenic lineage. To date, the growth kinetics and multipotency of bASCs have not been well studied. In fact, for many species, the changes in the extent of multilineage differentiation of culture-expanded ASCs, even at early passages, have not been well characterized. For our investigation, the interdigital fat pad was selected on the basis of convenience of acquisition and the assurance of sterility. Most ASC studies have been carried out using cells isolated from the subcutaneous abdominal, hip or breast regions. The literature results indicate that there is great variability in the ASCs isolated from the various tissue depots, which respond differently to hormonal, chemical or mechanical stimuli [Schaffler and Buchler, 2007]. As there is evidence that MSCs reside in a perivascular niche [Crisan et al., 2008; Zannettino et al., 2008], the different degrees of vascularization of the adipose tissue sources may influence the characteristics of the isolated stem cell populations. In particular, the limited apparent vascularity of the interdigital fat pad may have played a role in the results obtained in this study. Overall, fat tissues from different locations behave differently in terms of growth kinetics and differentiation potential [Flynn and Woodhouse, 2008]. However, based on our results, the ASCs from bovine interdigital fat are capable of long-term in vitro expansion and multilineage differentiation poten-

tial similar to stem cells isolated from other sites on other species. The success of utilizing stem cells in tissue-engineering applications is highly dependent on maintaining a satisfactory level of differentiation potential after extensive in vitro expansion. This study demonstrates that there are changes in the proliferation ability and multipotency of bASCs upon cell expansion. While the P2 and P5 bASCs were capable of undergoing multilineage differentiation (adipogenic, chondrogenic and osteogenic), it was shown that adipogenesis and chondrogenesis were favored at lower passage, and osteogenesis was maintained, or potentially improved, upon increased passaging. Further studies of the related signaling pathways and influences of the microenvironment on ASC differentiation will help lead to better usage of these cells in tissueengineering applications. In addition, it would be interesting to probe alternative growth substrates, each designed to mimic a specific tissue stiffness, to determine if it is possible to maintain the adipogenic and chondrogenic potentials by altering the mechanical properties of the cellular microenvironment during the proliferation phase.

Acknowledgements Funding to support this work was provided by the Natural Sciences and Engineering Research Council (NSERC) of Canada and Queen’s University. This research was conducted using infrastructure purchased with the support of NSERC Research Tools and Instruments, the Canada Foundation for Innovation Leader’s Opportunity Fund, and the Ministry of Research and Innovation Ontario Research Fund – Research Infrastructure programs.

References Ailhaud, G. (2001) Development of white adipose tissue and adipocyte differentiation. Georgetown, Landes Biosciences. Akiyama, H., J.E. Kim, K. Nakashima, G. Balmes, N. Iwai, J.M. Deng, Z. Zhang, J.F. Martin, R.R. Behringer, T. Nakamura, B. de Crombrugghe (2005) Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors. Proc Natl Acad Sci USA 102: 14665–14670. Aubin, J.E. (1998) Bone stem cells. J Cell Biochem Suppl 30–31: 73–82.


Banfi, A., A. Muraglia, B. Dozin, M. Mastrogiacomo, R. Cancedda, R. Quarto (2000) Proliferation kinetics and differentiation potential of ex vivo expanded human bone marrow stromal cells: implications for their use in cell therapy. Exp Hematol 28: 707–715. Beresford, J.N., J.A. Gallagher, R.G. Russell (1986) 1,25-Dihydroxyvitamin D3 and human bone-derived cells in vitro: effects on alkaline phosphatase, type I collagen and proliferation. Endocrinology 119: 1776–1785. Bessey, O.A., O.H. Lowry, M.J. Brock (1946) A method for the rapid determination of alkaline phosphates with five cubic millimeters of serum. J Biol Chem 164: 321–329.

Boyle, J., B. Luan, T.F. Cruz, R.A. Kandel (1995) Characterization of proteoglycan accumulation during formation of cartilagenous tissue in-vitro. Osteoarthritis Cartilage 3: 117– 125. Bruder, S.P., N. Jaiswal, S.E. Haynesworth (1997) Growth kinetics, self-renewal, and the osteogenic potential of purified human mesenchymal stem cells during extensive subcultivation and following cryopreservation. J Cell Biochem 64: 278–294. Caplan, A.I. (1991) Mesenchymal stem cells. J Orthop Res 9: 641–650.


425

Chamberlain, G., J. Fox, B. Ashton, J. Middleton (2007) Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells 25: 2739–2749. Crisan, M., S. Yap, L. Casteilla, C.W. Chen, M. Corselli, T.S. Park, G. Andriolo, B. Sun, B. Zheng, L. Zhang, C. Norotte, P.N. Teng, J. Traas, R. Schugar, B.M. Deasy, S. Badylak, H.J. Buhring, J.P. Giacobino, L. Lazzari, J. Huard, B. Peault (2008) A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell 3: 301–313. De Ugarte, D., P. Ashjian, A. Elbarbary, M. Hedrick (2003a) Future of fat as raw material for tissue regeneration. Ann Plast Surg 50: 4. De Ugarte, D.A., K. Morizono, A. Elbarbary, Z. Alfonso, P.A. Zuk, M. Zhu, J.L. Dragoo, P. Ashjian, B. Thomas, P. Benhaim, I. Chen, J. Fraser, M.H. Hedrick (2003b) Comparison of multi-lineage cells from human adipose tissue and bone marrow. Cells Tissues Organs 174: 101–109. Digirolamo, C.M., D. Stokes, D. Colter, D.G. Phinney, R. Class, D.J. Prockop (1999) Propagation and senescence of human marrow stromal cells in culture: a simple colonyforming assay identifies samples with the greatest potential to propagate and differentiate. Br J Haematol 107: 275–281. Engler, A.J., S. Sen, H.L. Sweeney, D.E. Discher (2006) Matrix elasticity directs stem cell lineage specification. Cell 126: 677–689. Farndale, R.W., D.J. Buttle, A.J. Barrett (1986) Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta 883: 173–177. Flynn, L., G.D. Prestwich, J.L. Semple, K.A. Woodhouse (2007) Adipose tissue engineering with naturally derived scaffolds and adipose-derived stem cells. Biomaterials 28: 3834–3842. Flynn, L., J.L. Semple, K.A. Woodhouse (2006) Decellularized placental matrices for adipose tissue engineering. J Biomed Mater Res A 79: 359–369. Flynn, L., K. Woodhouse (2008) Adipose tissue engineering with cells in engineered matrices. Organogenesis 4: 7. Franssen, R., M.E. Visser, J.A. Kuivenhoven, J.J. Kastelein, G.M. Dallinga-Thie, E.S. Stroes (2008) Role of lipoprotein lipase in triglyceride metabolism: potential therapeutic target. Future Lipidology 3: 12. Fraser, J., I. Wulur, Z. Alfonso, M. Hedrick (2006) Fat tissue: an underappreciated source of stem cells for biotechnology. Trends in Biotechnology 24: 150–154. Gimble, J., F. Guilak (2003) Adipose-derived adult stem cells: isolation, characterization, and differentiation potential. Cytotherapy 5: 362–369. Goldberg, R.L., L.M. Kolibas (1990) An improved method for determining proteoglycans synthesized by chondrocytes in culture. Connect Tissue Res 24: 265–275.

426

Gorzelniak, K., J. Janke, S. Engeli, A. Sharma (2001) Validation of endogenous controls for gene expression studies in human adipocytes and preadipocytes. Horm Metab Res 33: 3. Guilak, F., H.A. Awad, B. Fermor, H.A. Leddy, J.M. Gimble (2004) Adipose-derived adult stem cells for cartilage tissue engineering. Biorheology 41: 389–399. Gundle, R., J.N. Beresford (1995) The isolation and culture of cells from explants of human trabecular bone. Calcif Tissue Int 56(suppl 1): S8–S10. Hargus, G., R. Kist, J. Kramer, D. Gerstel, A. Neitz, G. Scherer, J. Rohwedel (2008) Loss of Sox9 function results in defective chondrocyte differentiation of mouse embryonic stem cells in vitro. Int J Dev Biol 52: 323–332. Heinegard, D., M. Bayliss, P. Lorenzo, D. Heinegard, M. Bayliss, P. Lorenzo (1998) Biochemistry and metabolism of normal and osteoarthritic cartilage; in Brandt, K.D., M. Doherty, L.S. Lohmander (eds): Osteoarthritis. New York, Oxford University Press, pp 74–84. Hirai, S., H. Matsumoto, N. Hino, H. Kawachi, T. Matsui, H. Yano (2007) Myostatin inhibits differentiation of bovine preadipocyte. Domest Anim Endocrinol 32: 1–14. Im, G.I., N.H. Jung, S.K. Tae (2006) Chondrogenic differentiation of mesenchymal stem cells isolated from patients in late adulthood: the optimal conditions of growth factors. Tissue Eng 12: 527–536. Lazar, M.A. (2002) Becoming fat. Genes Dev 16: 1–5. Leucht, P., S. Minear, D. Ten Berge, R. Nusse, J.A. Helms (2008) Translating insights from development into regenerative medicine: the function of Wnts in bone biology. Semin Cell Dev Biol 19: 434–443. McIntosh, K., S. Zvonic, S. Garrett, J.B. Mitchell, Z.E. Floyd, L. Hammill, A. Kloster, Y.D. Halvorsen, J.P. Ting, R.W. Storms, B. Goh, G. Kilroy, X.Y. Wu, J.M. Gimble (2006) The immunogenicity of human adipose-derived cells: temporal changes in vitro. Stem Cells 24: 1246–1253. Mizuno, H. (2009) Adipose-derived stem cells for tissue repair and regeneration: ten years of research and a literature review. J Nippon Med Sch 76: 56–66. Mori-Akiyama, Y., D.H. Rowitch, B. de Crombrugghe (2003) Sox9 is required for determination of the chondrogenic cell lineage in the cranial neural crest. Proc Natl Acad Sci USA 100: 5. Morrison, R.F., S.R. Farmer (2000) Hormonal signaling and transcriptional control of adipocyte differentiation. J Nutr 130: 3116S– 3121S. Muraglia, A., R. Cancedda, R. Quarto (2000) Clonal mesenchymal progenitors from human bone marrow differentiate in vitro according to a hierarchical model. J Cell Sci 113: 1161–1166.


Nakajima, I., S. Muroya, R. Tanabe, K. Chikuni (2002) Positive effect of collagen V and VI on triglyceride accumulation during differentiation in cultures of bovine intramuscular adipocytes. Differentiation 70: 84–91. Neupane, M., C.C. Chang, M. Kiupel, V. Yuzbasiyan-Gurkan (2008) Isolation and characterization of canine adipose-derived mesenchymal stem cells. Tissue Eng A 14: 1007– 1015. Ogawa, R., H. Mizuno, A. Watanabe, M. Migita, T. Shimada, H. Hyakusoku (2004) Osteogenic and chondrogenic differentiation by adipose-derived stem cells harvested from GFP transgenic mice. Biochem Biophys Res Commun 313: 871–877. Ohsaki, H., T. Sawa, S. Sasazaki, K. Kano, M. Taniguchi, F. Mukai, H. Mannen (2007) Stearoyl-CoA desaturase mRNA expression during bovine adipocyte differentiation in primary culture derived from Japanese Black and Holstein cattle. Comp Biochem Physiol A Mol Integr Physiol 148: 629–634. Previato, L., C.L. Parrott, S. Santamarina-Fojo, H.B. Brewer, Jr. (1991) Transcriptional regulation of the human lipoprotein lipase gene in 3T3-L1 adipocytes. J Biol Chem 266: 18958–18963. Sampaio, R.V., M.R. Chiaratti, F.F. Bressan, J.R. Sangalli, M.S. Miranda, T.H.C. De Bem, T.V.G. Silva, N.N. Costa, M.S. Cordeiro, S.S.D. Santos, C.E. Ambrosio, F.V. Meirelles, O.M. Ohashi (2009) Isolation and characterization of bovine mesenchymal stem cells derived from adipose tissue. Reprod Fertil Dev 22: 356–356. Sarugaser, R., L. Hanoun, A. Keating, W.L. Stanford, J.E. Davies (2009) Human mesenchymal stem cells self-renew and differentiate according to a deterministic hierarchy. PLoS One 4: e6498. Schaffler, A., C. Buchler (2007) Concise review: adipose tissue-derived stromal cells–basic and clinical implications for novel cell-based therapies. Stem Cells 25: 818–827. Strem, B.M., K.C. Hicok, M. Zhu, I. Wulur, Z. Alfonso, R.E. Schreiber, J.K. Fraser, M.H. Hedrick (2005) Multipotential differentiation of adipose tissue-derived stem cells. Keio J Med 54: 132–141. Tontonoz, P., E. Hu, B.M. Spiegelman (1994) Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79: 1147–1156. Vacanti, V., E. Kong, G. Suzuki, K. Sato, J.M. Canty, T. Lee (2005) Phenotypic changes of adult porcine mesenchymal stem cells induced by prolonged passaging in culture. J Cell Physiol 205: 194–201. Waldman, S., Y. Usmani, M. Tse, S. Pang (2008) Differential effects of natriuretic peptide stimulation on tissue-engineered cartilage. Tissue Eng A 14: 7.


Waldman, S.D., D.C. Couto, M.D. Grynpas, R.M. Pilliar, R.A. Kandel (2006) A single application of cyclic loading can accelerate matrix deposition and enhance the properties of tissue-engineered cartilage. Osteoarthritis Cartilage 14: 323–330. Waldman, S.D., M.D. Grynpas, R.M. Pilliar, R.A. Kandel (2002) Characterization of cartilagenous tissue formed on calcium polyphosphate substrates in vitro. J Biomed Mater Res 62: 323–330. Wall, M.E., S.H. Bernacki, E.G. Loboa (2007) Effects of serial passaging on the adipogenic and osteogenic differentiation potential of adipose-derived human mesenchymal stem cells. Tissue Eng 13: 1291–1298.


Wang, V., G. Misra, B. Amsden (2008) Immobilization of a bone and cartilage stimulating peptide to a synthetic bone graft. J Mater Sci Mater Med 19: 2145–2155. Woessner, J.F., Jr. (1961) The determination of hydroxyproline in tissue and protein samples containing small proportions of this imino acid. Arch Biochem Biophys 93: 440– 447. Yang, C.C., S.E. Ellis, F. Xu, K.J. Burg (2007) In vitro regulation of adipogenesis: tunable engineered tissues. J Tissue Eng Regen Med 1: 146–153. Zannettino, A.C., S. Paton, A. Arthur, F. Khor, S. Itescu, J.M. Gimble, S. Gronthos (2008) Multipotential human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. J Cell Physiol 214: 413–421.

Zheng, B., B. Cao, G. Li, J. Huard (2006) Mouse adipose-derived stem cells undergo multilineage differentiation in vitro but primarily osteogenic and chondrogenic differentiation in vivo. Tissue Eng 12: 1891–1901. Zuk, P.A., M. Zhu, P. Ashjian, D.A. De Ugarte, J.I. Huang, H. Mizuno, Z.C. Alfonso, J.K. Fraser, P. Benhaim, M.H. Hedrick (2002) Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 13: 4279–4295. Zuk, P.A., M. Zhu, H. Mizuno, J. Huang, J.W. Futrell, A.J. Katz, P. Benhaim, H.P. Lorenz, M.H. Hedrick (2001) Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7: 211– 228.


427