The Effects of Environmental Enrichment and Age ...

Original Article

ZEBRAFISH Volume 00, Number 00, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/zeb.2014.1045

The Effects of Environmental Enrichment and Age-Related Differences on Inhibitory Avoidance in Zebrafish (Danio rerio Hamilton) Remy Manuel,1 Marnix Gorissen,1 Mitchel Stokkermans,1 Jan Zethof,1 Lars O.E. Ebbesson,2 Hans van de Vis,3 Gert Flik,1 and Ruud van den Bos1

Abstract

The inhibitory avoidance paradigm allows the study of mechanisms underlying learning and memory formation in zebrafish (Danio rerio Hamilton). For zebrafish, the physiology and behavior associated with this paradigm are as yet poorly understood. We therefore assessed the effects of environmental enrichment and fish age on inhibitory avoidance learning. Fish raised in an environmentally enriched tank showed decreased anxiety-like behavior and increased exploration. Enrichment greatly reduced inhibitory avoidance in 6-month (6M)- and 12month (12M)-old fish. Following inhibitory avoidance, telencephalic mRNA levels of proliferating cell nuclear antigen ( pcna), neurogenic differentiation (neurod), cocaine- and amphetamine-regulated transcript 4 (cart4), and cannabinoid receptor 1 (cnr1) were lower in enriched-housed fish, while the ratios of mineralocorticoid receptor (nr3c2)/glucocorticoid receptor a [nr3c1(a)] and glucocorticoid receptor b [nr3c1(b)]/glucocorticoid receptor a [nr3c1(a)] were higher. This was observed for 6M-old fish only, not for 24-month (24M) old fish. Instead, 24M-old fish showed delayed inhibitory avoidance, no effects of enrichment, and reduced expression of neuroplasticity genes. Overall, our data show strong differences in inhibitory avoidance behavior between zebrafish of different ages and a clear reduction in avoidance behavior following housing under environmental enrichment. 1), age (experiment 2), and their interactions (experiment 3) on inhibitory avoidance behavior.

Introduction

T

he inhibitory avoidance paradigm is a promising tool to study molecular mechanisms underlying learning and memory formation in zebrafish.1–4 In this paradigm, zebrafish must learn to refrain from swimming from a white to a black compartment to avoid receiving an electric shock.1–4 So far, studies on this paradigm in zebrafish evaluated effects of unpredictable chronic stress,2,5 differences in shock intensity,4 and blocking of the N-methyl-Daspartate (NMDA) receptor.1,3 For the inhibitory avoidance paradigm to mature as a useful tool for neurobehavioral research in zebrafish, further characterization of factors affecting task performance seems warranted. In rodents, inhibitory avoidance behavior is affected by rearing under enriched conditions,6–9 as well as age-dependent differences in passive avoidance learning are found.10 Therefore, to further characterize inhibitory avoidance in zebrafish, we assessed the effects of environmental enrichment (experiment

Experiment 1: environmental enrichment

Laboratory housing of fish all too often is designed to standardize conditions between experiments and therefore typically consists of barren aquaria. However, housing rodents under such conditions is considered to lead to poor welfare: animals are often confined to small cages, isolated, and kept from performing highly motivated behaviors and may therefore more likely develop stereotypies.11 There is consensus that enrichment improves not only animal welfare12,13 but also the quality of research data.14 Enrichment can be defined as ‘‘a combination of complex inanimate and social stimulation’’15 and in this context refers to an environment richer than barren housing conditions.16 When rodents are housed under enriched conditions, they play more,17 are less anxious,18 and perform better in spatial learning and memory tasks.19,20

1 Department of Organismal Animal Physiology, Institute for Water and Wetland Research, Radboud University, Nijmegen, The Netherlands. 2 Uni Research AS, Bergen, Norway. 3 IMARES, Wageningen University and Research Centre, Yerseke, The Netherlands.

1

2

Typically, zebrafish in laboratory settings are kept in stimulus-poor environments, that is, a tank without bottom substrate, plants, rocks, or other shelter objects. We do know, however, that enrichment affects brain morphology and gene expression21 and behavior22–27 of fish. Effects of environmental enrichment on inhibitory avoidance behavior in zebrafish have to our knowledge as yet not been studied. We therefore housed zebrafish under enriched or barren conditions from larval stage onward. At 6 months, we first assessed anxiety-like behavior (in a dark–white preference box) followed by the inhibitory avoidance protocol at the age of 12 months. Remarkably, in mice, environmental enrichment increases inhibitory avoidance behavior,6,7 while in rats, enrichment reduces such.8,9 It follows that caution should be taken to predict the effects of environmental enrichment on inhibitory avoidance behavior in zebrafish. Experiment 2: age

Rats have a window where passive avoidance learning performance is better in adult animals (120–365 days) compared with both young (20–30 days) and aged animals (540 days).28–30 To assess whether age also affects inhibitory avoidance behavior in zebrafish, we studied 6-month (6M), 12-month (12M), and 24-month (24M) old zebrafish in the inhibitory avoidance paradigm. The 24M-old zebrafish are generally classified as ‘‘aged’’ and both the 6M- and 12M-old zebrafish are classified as ‘‘adults.’’31 However, at the age of 6 months, zebrafish are still growing in size,32 and as yet, it is unclear till what age the brain is still developing. We assessed the telencephalic expression of genes related to the stress response, individual differences in coping style, anxiety and fear-conditioning after inhibitory avoidance learning.33–39 We focused on the telencephalon, not the whole brain, as the telencephalon houses centers involved in learning, memory, and fear-conditioning (lateral and medial zone of the dorsal pallium, respectively).40–42 We predict that inhibitory avoidance behavior is reduced in 24M-old zebrafish compared with both 12M- and 6M-old fish. Experiment 3: interaction of age and environmental enrichment

In aged rats (25 months old), environmental enrichment improved learning up to the level of younger animals (2.5 and 15 months).43 We hypothesized (experiment 2) that 24M-old zebrafish would have lower brain plasticity and that this would impair inhibitory avoidance learning. Exposure to environmental enrichment could counter this reduction in brain plasticity and thus improve task performance. We housed 24M-old zebrafish under enriched conditions for 4 weeks. As a control, we housed a group of 6M-old zebrafish under similar conditions and assessed their respective inhibitory avoidance behavior. We hypothesize that enrichment increases inhibitory avoidance behaviour in 24M-old zebrafish, while we cannot make a clear prediction for 6M-old zebrafish (see experiment 1).

MANUEL ET AL.

2012-106) and were conducted in agreement with Dutch law (Wet op de Dierproeven 1996) and European regulations (Directive 86/609/EEC). Housing

Depending on experimental and life stage needs, fish were either housed in small aquaria or large aquaria. Whereas the barren environment consisted of the aquaria as they are, the enriched tanks received sand as bottom substrate and the aquarium was decorated with plastic plants and an artificial rock formation. Enrichment was kept constant (no changes in the amount, type, or location of enrichment) over the course of the experiment. Small aquaria. Two-liter zebrafish tanks were used to house zebrafish from fertilization up till 1 month. One group was housed under barren conditions, while the other was housed under enriched conditions. Large aquaria. A single aquarium (100 · 50 · 60 cm) was split in two compartments by addition of a black glass plate, creating two equally sized compartments (50 · 50 · 60 cm): one barren and one enriched. In each aquarium, the water level was brought to 30 cm, creating a total water volume of 150 L (or 75 L on either side). Both compartments were equipped with their own water in- and outflow (26C; pH = 8.0) and linked to a single biological filter (300 L volume). In addition, each compartment received an aeration stone, through which air was pumped, creating air bubbles and surface motion. The photoperiod was kept at 12-h light:12-h dark (lights on from 07:00 to 19:00 h) with feeding moments at 09:00 h (Artemia salina) and 15:00 h (TetraMin; Tetra, Melle, Germany). Animals

An in-house-bred Tupfel long fin (also known as Tu¨bingen long fin) of mixed sexes were used. Experiments were carried out at the Radboud University Nijmegen, the Netherlands. Experiment 1 (enrichment). A batch of freshly spawned and fertilized eggs was randomly divided into two groups of roughly equal size. Once hatched, fish were either placed in the barren (n = 20) or enriched (n = 24) environment. Zebrafish larvae were kept in small aquaria until the age of 1 month, after which they were transferred to larger aquaria (see small aquarium and large aquaria section). After 6 months, fish were exposed to a black and white preference test (for details, see black and white preference test section in the Materials and Methods section). After this test, the animals were returned to their housing tanks and left undisturbed for 6 months. At the age of 12 months, we assessed inhibitory avoidance behavior (for details, see inhibitory avoidance behavior section), an age that we used in our earlier study on chronic stress.5

Ethical approval

Experiment 2 (age). After 6 months (n = 22), 12 months (n = 35), or 24 months (n = 9) of housing under barren (standard) conditions, zebrafish were placed in one compartment of a large aquarium for 4 weeks. After this acclimation period, inhibitory avoidance behavior was assessed.

All experiments were approved by the Animal Ethics Committee of the Radboud University Nijmegen (RU-DEC

Experiment 3 (age and enrichment). Zebrafish, at the age of 6 months (n = 16) or 24 months (n = 17), were placed in one

Materials and Methods

INHIBITORY AVOIDANCE: ENRICHMENT AND AGE

compartment of a large aquarium for 4 weeks. After this acclimation period, inhibitory avoidance behavior was assessed. Black and White Preference Protocol

To assess anxiety-like behavior, an aquarium (60 · 30 · 30 cm; 10 cm water level) was split in two equal compartments. The walls and bottom of one compartment were covered with white plastic; walls and bottom of the other compartment with black plastic. No physical barrier separated the two compartments so the fish could cross to the other compartment freely. Zebrafish were placed individually in the white compartment and were allowed to swim around freely for 6 min, after which they were returned to their home-tank. Swimming behavior was recorded by camera and analyzed using EthoVision XT v8.0 tracking software (Noldus, Wageningen, the Netherlands). More time spent in the white compartment is indicative that animals are less anxious. A higher number of crossings between compartments are indicative for more exploratory behavior. Inhibitory avoidance protocol

To evaluate inhibitory fear avoidance, a protocol was used as previously described.5 In short, an aquarium (60 · 30 · 30 cm; 10 cm water level) was split into two equal compartments, separated by a manually operated sliding door. Surfaces of one compartment and sliding door were white, whereas surfaces of the other compartment and other side of the sliding door were black. Compartments were not covered by a lid. The black compartment contained two metal plates (covered with black sound box mesh to prevent light reflection by the metal) that covered two opposite walls completely. Both plates were wired to a power source, which allowed for 3 V AC (measured at the middle of the tank; across a distance of 15 cm between electrodes) to be put between the plates in the water. Assessment of inhibitory avoidance learning started at 11:00 h and was done for each fish individually (i.e., not as a group). On day 1, the fish were placed (individually) in the white compartment with the sliding door closed. After 60 s of acclimation, the sliding door was lifted, giving the fish free access to the black compartment. Their innate response, when anxious, is to readily enter the black compartment when given this option.44,45 Once the fish had completely entered the black compartment, the sliding door was closed and an electric shock (3 V AC) was given for 5 s, after which fish were netted and returned to their home tank. Fish that would not enter the black compartment within 180 s on the first day of the paradigm were excluded from further experimentation, as their innate responses were not compatible with the inhibitory avoidance paradigm. For each fish, the latency time to enter the black compartment was recorded. Higher latencies indicate that animals are less anxious in the white compartment. On day 2, the procedure was repeated. Once the sliding door had been opened after 60 s, the fish was given 180 s to make a choice to enter the black compartment. When the fish entered the black compartment within this time frame, a second shock was given. To give all fish the same number of shocks, fish that did not enter within 180 s were carefully driven into the black compartment with a small net and given

3

the second shock. For each fish, the latency to enter the black compartment was recorded. Higher latencies are indicative for associating the black compartment with the shock and thus increased avoidance behavior. On day 3, fish were placed within the white compartment once again. After 60 s, the sliding door was opened and the fish were given 180 s to make a choice to enter the black compartment. For each subject, the latency to enter the black compartment was recorded. This time, when the fish entered the black compartment, no shock was given and the fish that did not enter within 180 s were not driven into the black compartment. Rather, fish were netted and kept in a holding tank to be euthanized 2 h after the test (see tissue collection and preparation section). Operation of the sliding door was done manually, and visual observations were done in real-time and recorded onsite. Recording of the latency time was done by hand using a stopwatch. One experimenter (R.M.) recorded all latencies. All procedures were carried out in a manner that caused the least possible disturbance of fish during the experiment. Tissue collection and preparation

On the third day of the inhibitory avoidance protocol, fish were euthanized in water containing 0.5% (v/v) 2-phenoxyethanol 2 h after testing (between 14:00 and 15:00 h) in line with our earlier studies (see Manuel et al.4,5 for an extensive discussion of this 2-h time-window and pros and cons of posttask sampling). From each fish, the telencephalon was dissected, snap-frozen in liquid nitrogen, and stored at - 80C until further analysis. Analysis of gene expression

Genes of interest selected were brain-derived neurotrophic factor (bdnf), proliferating cell nuclear antigen ( pcna), neurogenic differentiation (neurod), cocaine- and amphetamineregulated transcript 4 (cart4), cannabinoid receptor 1 (cnr1), serotonin receptor 1ab (htr1ab), corticotropin-releasing factor (crf) binding protein (crf-bp), glucocorticoid receptor a [nr3c1(a)], glucocorticoid receptor b [nr3c1(b)], and the mineralocorticoid receptor (nr3c2).33–39 Two internal standards (ribosomal protein L13 [rpl13] and elongation factor 1a [elf1a]) were used for normalization. Primer sequences can be found in Table 1. Total RNA from individual telencephalons was isolated using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions, including an additional precipitation step with ethanol and sodium acetate. RNA concentration and purity was measured by nanodrop spectrophotometry (Nanodrop; Thermo Fisher Scientific, Waltham, MA). Possible present genomic DNA was removed by treatment with DNase I (Invitrogen) as follows: 1 lL of DNase I (1 U/lL) and 1 lL of DNase I reaction buffer (10 · ) were added to 8 lL of total RNA (250 ng) and incubated in a total volume of 10 lL at room temperature for 15 min. DNase was inactivated by addition of 1 lL of ethylenediaminetetraacetic acid (25 mM) and incubated for 10 min at 65C. Subsequently, each sample received 1 lL of random primers (250 ng/lL), 4 lL of firststrand buffer (5 · ), 1 lL of dNTP mix (10 mM), 1 lL of dithiothreitol (DTT) (0.1 M), 1 lL of RNaseOUT (40 U), and 0.5 lL of superscript II reverse transcriptase (200 U/lL) (all from Invitrogen) and incubated for 10 min at 25C, followed

4

MANUEL ET AL.

Table 1. Nucleotide Sequences of the Forward and Reverse Primers Used for qPCR Gene

Accession number

elf1a rpl13 bdnf pcna neurod cart4 cnr1 htr1ab crf crf-bp nr3c1(a) nr3c1(b) nr3c2

AY422992 NM_212784 NM_131595 AF140608.1 AF036148.1 NM_001082932 NM_212820 NM_001145766 BC164878 NM_001003459 EF436284.1 EF436285.1 NM_001100403

Forward primer

Reverse primer

CTGGAGGCCAGCTCAAACAT TCTGGAGGACTGTAAGAGGTATGC AGAGCGGACGAATATCGCAG AAGGAGGATGAAGCGGTAACAAT TCCCTACTCCTACCAGACGC GCTGAGGCACTCGATGAACT TACATCCTCTGGAAGGCCCA GGACATTAAAACGCGCTGCT CGAGACATCCCAGTATCCAAAAAG ACAATGATCTCAAGAGGTCCAT ACTCCATGCACGACTTGEIG GATGAACTACGAATGTCTTA CTTCCAGGTTTCCGCAGTCTAC

TCAAGAAGAGTAGTACCGCTAGCATTAC AGACGCACAATCTTGAGAGCAG GTTGGAACTTTACTGTCCAGTCG GTCTTGGACAGAGGAGTGGC CAGTCTGTGAGGGTGGTGTC GAAGAAAGTGTTGCAGGCGG GGGGGTCTGCACCTTTGTG ATGCAAGTCTTGGGTTGAGACT TCCAACAGACGCTGCGTTAA CCACCAAGAAGCTCAACAAA GCATTTCGGGAAACTCCACG GCAACAGACAGCCAGACAGCTCACT GGAGGAGAGACACATCCAGGAAT

Elongation factor 1a (elf1a) and ribosomal protein L13 (rpl13) were used as housekeeping genes. Genes of interest were brain-derived neurotrophic factor (bdnf), proliferating cell nuclear antigen ( pcna), neurogenic differentiation (neurod), cocaine- and amphetamineregulated transcript 4 (cart4), cannabinoid receptor 1 (cnr1), serotonin receptor 1ab (htr1ab), corticotropin-releasing factor (crf) binding protein (crf-bp), glucocorticoid receptor a [nr3c1(a)], glucocorticoid receptor b [nr3c1(b)], and the mineralocorticoid receptor (nr3c2). qPCR, quantitative polymerase chain reaction.

by 50 min at 42C and finally 15 min at 70C. Afterward, cDNA was diluted five times with ultra-pure water and stored at - 20C until analysis. Relative gene expression was assessed by real-time quantitative polymerase chain reaction (qPCR). Briefly, 4 lL of cDNA was used as template in a reaction with 10 lL iQ SYBR Green Supermmix (BioRad, Hercules, CA), 0.7 lL of forward and reverse primer (10 lM each; Table 1), and 4.6 lL of ultra-pure water. qPCR (3 min 95C, 40 cycles of 15 s 95C, and 1 min 60C) was carried out on a CFX 96 (BioRad). Data were analyzed according to Vandesompele et al.46 Statistical analyses

Statistical analyses were performed with GraphPad Prism 5.0 for Mac (GraphPad Software, Inc., La Jolla, CA). Experiment 1 (enrichment). We used a two-way analysis of variance (ANOVA) (with the factors time and enrichment) to test for significant differences in the black and white preference test. In case of a significant interaction, a Bonferroni post hoc test was used. A D’Agostino and Pearson omnibus normality test revealed that the latency times did not conform to Gaussian distribution. Therefore, differences in inhibitory avoidance behavior were assessed by the Kruskal– Wallis test (followed by Dunn’s multiple comparison post hoc tests) to test for differences across days and the Mann– Whitney U tests to test for differences between groups on each day. Experiment 2 (age). A D’Agostino and Pearson omnibus normality test revealed that the latency times did not conform to Gaussian distribution. Therefore, differences in inhibitory avoidance behavior were assessed by the Kruskal–Wallis test (followed by Dunn’s multiple comparison post hoc tests) to test for differences across days and the Mann–Whitney U tests to test for differences between groups on each day. Gene expression data were analyzed for Gaussian distribution using the D’Agostino and Pearson omnibus normality test. In

case of a Gaussian distribution, significance between barren and enriched fish was assessed using a one-way ANOVA (with the Student–Newman–Keuls post hoc test); in case of a non-Gaussian distribution, the Kruskal–Wallis test (followed by Dunn’s multiple comparison post hoc tests) was used to assess differences between groups. Experiment 3 (age and enrichment). A D’Agostino and Pearson omnibus normality test revealed that the latency times did not conform to Gaussian distribution. Therefore, differences in inhibitory avoidance behavior were assessed by the Kruskal–Wallis test (followed by Dunn’s multiple comparison post hoc tests) to test for differences across days and the Mann–Whitney U tests to test for differences between groups on each day. Gene expression data were analyzed for Gaussian distribution using the D’Agostino and Pearson omnibus normality test. In case of a Gaussian distribution, significance between barren and enriched fish was assessed using the Student’s t-test (with a Welch’s correction in case of unequal variances); in case of a non-Gaussian distribution, the Mann–Whitney U test was used to assess differences between groups. In all cases, significance was accepted when p £ 0.05 (two-tailed). Results Experiment 1: environmental enrichment Enrichment: black and white preference test. We excluded the first minute from our data analysis, as we believe that this minute reflects a habituation period in which fish recover from entering the experimental tank (Fig. 1A, B). We found that enriched-housed fish spent more time in the white compartment compared with barren-housed fish [Fenrich(1,190) = 12.53; p = 0.0005]. Furthermore, the number of crossings between compartments was significantly higher for enriched-housed fish compared with the barren-housed fish [Fenrich(1,190) = 23.07; p < 0.0001]. No other statistically significant differences were found.


5

ence between days 2 and 3. For enriched-housed fish, we did not observe significant differences (H = 5.250; p = 0.07). Experiment 2: age Age: inhibitory avoidance behavior. All fish entered the black compartment within 60 s on the first day, except two individuals: one in the 6M-old group (95 s) and one in the 12M-old group (115 s). Median values of groups ranged from 4 to 9 s (Fig. 3). We observed no significant differences between groups on day 1 (H = 4.884; p = 0.09). On day 2, the latencies to enter the dark compartment of the tank of the 24M-old fish were significantly lower compared with the latencies of both the 6M- and 12M-old fish (H = 11.96; p = 0.003). On day 3, we did not observe significant differences between the three age groups (H = 0.4284; p = 0.81). The latencies on days 2 and 3 were significantly higher compared with the latencies on day 1 for both the 6M-old fish (H = 18.58; p < 0.0001) and the 12M-old fish (H = 29.15; p < 0.0001), but there was no significant difference between days 2 and 3 for either age. For 24M old fish, we did not observe significant differences across days (H = 5.785; p = 0.06).

FIG. 1. Black and white preference test. (A) Zone preference under barren (white) and enriched (black) conditions. Fish from an enriched environment spent significantly more time in the white compartment compared with fish from a barren environment. (B) Frequency of entries into the white compartment. Fish from an enriched environment (black) had a significantly higher frequency of entering the white zone compared with fish from a barren (white) environment. All data were assessed by a two-way analysis of variance (ANOVA). n = 20 fish per housing condition. Statistical analysis excludes the first minute (indicated by a gray box). Enrichment: inhibitory avoidance paradigm. All fish entered the black compartment within 60 s on the first day, except one individual in the barren-housed group (80 s) and two in the enriched-housed group (90 and 130 s). Median values of groups were 14 and 8 s for barren and enriched conditions, respectively (Fig. 2). The latencies of barren-housed fish and enriched-housed fish were not significantly different on day 1 (U = 69.50; p = 0.52). However, we observed significantly higher latencies for fish raised in a barren environment compared with those raised in an enriched environment on day 2 (U = 38.50; p = 0.02) and day 3 (U = 35.00; p = 0.01). The latencies for barren-housed fish on days 2 and 3 were significantly higher compared with the latencies on day 1 (H = 18.25; p = 0.0001), but there was no significant differ-

Age: gene expression analysis. Statistics on the data are shown in Figure 4A–M. Following the inhibitory avoidance paradigm, expression levels of bdnf, pcna, and cart4 were significantly lower in 24M-old zebrafish compared with both the 6M- and 12M-old zebrafish. Gene expression levels of neurod, htr1ab, crf-bp, nr3c1(b), and the nr3c1(b)/nr3c1(a) ratio were significantly higher in the 12M-old fish compared with both the 6M- and 24M-old zebrafish, while the expression of nr3c1(a) was significantly lower. The expression of crf was higher in the 6M-old group compared with both the 12M- and 24M-old zebrafish, whereas the nr3c2/nr3c1(a) ratio was significantly lower. Only for the expression of nr3c2, we observed significant differences between all age groups, where the expression levels increased with age. We found no significant differences for cnr1 expression. Experiment 3: age and enrichment Age and enrichment: inhibitory avoidance behavior: 6Mold zebrafish. All fish entered the black compartment

within 60 s on the first day, except three individuals: two in the barren-housed group (62 and 97 s) and one in the enriched-housed group (118 s) (Fig. 5A). On day 1, median values of both barren-housed and enriched-housed groups were 9 s, and there was no significant difference between the groups (U = 165.0; p = 0.76). However, we observed significantly higher latencies for barrenhoused fish compared with enriched-housed fish on day 2 (U = 48.00; p = 0.0002) and day 3 (U = 90.00; p = 0.01). In addition, we found that latencies for barren-housed fish on days 2 and 3 were significantly higher compared with the latencies on day 1 (H = 18.58; p = 0.0001), but there was no significant difference between days 2 and 3. For enrichedhoused fish, we did not observe significant differences (H = 1.088; p = 0.58). Age and enrichment: inhibitory avoidance behavior: 24Mold zebrafish. All fish entered the black compartment within

60 s on the first day (Fig. 5B).

6

MANUEL ET AL.

FIG. 2. Inhibitory avoidance learning in lifelong barren and enriched house zebrafish. Day 1 (no training) shows no significant differences in the initial latencies between barrenhoused (white) and enriched-housed (black) zebrafish. Day 2 (one shock) and day 3 (two shocks) show a significant lower latency for fish housed under enriched conditions compared with those from a barren environment: bars indicate median values. Capital letters above groups indicate significant differences assessed by the Mann–Whitney U test: groups that do not share corresponding letters are significantly different from each other. Triple asterisks ( p £ 0.001) indicate a significant increase in latency from days 1 to 2 or from days 2 to 3 within a single housing conditions. n.s. = not significant, n = the number of fish.

FIG. 3. Inhibitory avoidance learning in 6M-, 12M-, and 24M-old zebrafish. Day 1 (no training) shows no significant differences in the initial latencies between 6M-old (black dots), 12M-old (open squares), and 24M-old (black triangles) zebrafish. Day 2 (one shock) shows a significant lower latency for the 24M-old zebrafish compared with the 6M- and 12Mold zebrafish. Day 3 (two shocks) shows no significant differences in latencies between 6M-, 12M-, and 24M-old zebrafish: bars indicate median values. Capital letters above groups indicate significant differences assessed by the Dunn’s multiple comparison test following the Kruskal–Wallis test: groups that do not share corresponding letters are significantly different from each other. Triple asterisks ( p £ 0.001) indicate a significant increase in latency from days 1 to 2 or from days 2 to 3 within a single age category. n.s. = not significant, n = the number of fish.


7

FIG. 4. (A–K) Normalized telencephalic gene expression following inhibitory avoidance learning in 6M-old (black dots), 12M-old (open squares), and 24M-old (black triangle) zebrafish. Individuals are plotted as single data points; bars represent group mean. Capital letters above groups indicate significant differences assessed by the LSD post hoc analysis following a significant one-way ANOVA: groups that do not share corresponding letters are significantly different from each other ( p £ 0.05). n = the number of fish. (L, M) Display ratios and not actual gene expression levels.

8

MANUEL ET AL.

A

FIG. 5. Inhibitory avoidance learning following 4 weeks of enrichment in 6M- and 24M-old zebrafish. (A) For the 6M-old zebrafish, we saw no significant differences in the initial latencies between barren-housed (white) and enriched-housed (black) zebrafish (day 1: no training). On day 2 (one shock) and day 3 (two shocks), we saw that enriched zebrafish had significantly lower latencies compared with barren zebrafish. (B) For the 24M-old zebrafish, we saw no significant differences in the initial latencies between barren (white) and enriched (black) zebrafish. On day 2 (one shock) and day 3 (two shocks), we saw no significant differences between barren and enriched zebrafish. In addition, regardless of housing condition, we saw no significant differences between days for the 24M-old zebrafish: bars indicate median values. Capital letters above groups indicate significant differences assessed by the Mann– Whitney U test: groups that do not share corresponding letters are significantly different from each other. Triple asterisks ( p £ 0.001) indicate a significant increase in latency from days 1 to 2 or from days 2 to 3 within a single housing conditions. n.s. = not significant, n = the number of fish.

B

On day 1, median values of groups were 4 and 6 s for barren-housed and enriched-housed fish, respectively, and the Mann–Whitney U test did not reveal significant differences between rearing conditions (U = 65.0; p = 0.42). We observed no significant differences between the latencies of

barren-housed fish and enriched-housed fish on day 2 (U = 47.00; p = 0.12) and day 3 (U = 66.00; p = 0.58). In addition, we found no significant difference in latencies across days for both barren-housed fish (H = 5.785; p = 0.06) and enriched-housed fish (H = 5.689; p = 0.06).


9

Table 2. Telencephalic Gene Expression Analysis from 6M- and 24M-Old Zebrafish Housed Under a Barren and Enriched Environment 6M old Gene

24M old

Barren

Enriched

Significant

Barren

Enriched

Significant

bdnf pcna neurod

0.83 – 0.28 1.13 – 0.18 1.02 – 0.24

0.88 – 0.30 0.94 – 0.18 0.83 – 0.27

0.43 – 0.14 0.39 – 0.13 0.98 – 0.18

0.39 – 0.12 0.33 – 0.07 1.03 – 0.32

n.s. n.s. n.s.

cart4 cnr1 htr1ab crf crf-bp nr3c1(a) nr3c1(b) nr3c2 nr3c2/nr3c1(a)

0.87 – 0.32 1.08 – 0.25 0.84 – 0.30 0.98 – 0.46 0.89 – 0.51 1.08 – 0.37 0.74 – 0.32 1.04 – 0.26 0.32 – 0.09

0.77 – 0.31 0.92 – 0.19 1.01 – 0.56 1.03 – 0.34 0.96 – 0.48 1.01 – 0.37 0.75 – 0.22 1.00 – 0.20 0.43 – 0.12

0.19 – 0.14 0.94 – 0.25 3.10 – 1.51 0.35 – 0.14 0.14 – 0.06 0.92 – 0.14 0.24 – 0.14 1.50 – 0.39 0.58 – 0.22

0.15 – 0.12 0.90 – 0.28 2.99 – 1.182 0.27 – 0.17 0.17 – 0.10 1.02 – 0.23 0.16 – 0.08 1.71 – 0.53 0.67 – 0.31

n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s.

nr3c1(b)/nr3c1(a)

0.02 – 0.01

0.03 – 0.02

n.s. U = 62.00; p = 0.003 t = 2.295; df = 34; p = 0.03 U = 94.00; p = 0.03 U = 90.00; p = 0.04 n.s. n.s. n.s. n.s. n.s. n.s. t = 3.008; df = 33; p = 0.005 U = 90.50; p = 0.04

0.007 – 0.004

0.004 – 0.002

t = 2.362; df = 18; p = 0.03

Values listed are means – 1 SD of the relative and normalized (to elf1a and rpl13) expression for each group. Please note that these data are not presented such that the different age groups can be compared. M, month.

Age and enrichment: gene expression analysis. Statistically significant differences in gene expression between barrenhoused and enriched-housed fish following inhibitory avoidance were found (Table 2). We observed the following significant differences for the 6M-old fish: compared with barren-housed fish, enriched-housed fish had significantly lower gene expression levels of pcna, neurod, cart4, and cnr1, but the ratios of nr3c2/nr3c1(a) and nr3c1(b)/nr3c1(a) were significantly higher. In contrast, for the 24M-old fish, we only observed a significantly lower nr3c1(b)/nr3c1(a) ratio for enriched-housed fish. No other significant differences were observed. Discussion

In this study, we report a decrease in anxiety-like behavior and an increase in exploratory behavior following long-term housing under enriched conditions. In addition, exposure to environmental enrichment reduced inhibitory avoidance behavior in 6M- and 12M-old fish, but not in 24M-old fish. Gene expression analysis following the task revealed that enriched-housed 6M-old fish had lower levels of pcna, neurod, cart4, and cnr1 in the telencephalon and higher telencephalic ratios of nr3c2/nr3c1(a) and nr3c1(b)/nr3c1(a). No such changes were observed for enriched-housed 24M-old fish. We further observed a delay in inhibitory avoidance behavior of 24M-old fish compared with 6M- and 12M-old fish, which was associated with lower telencephalic expression levels of bdnf, pcna, and cart4. Experiment 1: enrichment

In contrast to previous studies,23,47 where environmental enrichment was either offered for a shorter period ( < 6 months) or the position of items was changed weekly, we here raised zebrafish under enriched conditions starting from the time they were hatched and aimed to keep the position of

enrichment items constant and unchanged. Fish housed under these enriched conditions displayed reduced anxiety-like behavior (more time spent in the white compartment) and increased exploration (more transitions between the white and black compartment), which is in line with previous experiments.23,47 Although we did not observe a significant interaction term, our data do suggest that barren-housed fish become more explorative and less anxious toward the end of the experiment (i.e., minutes 5 and 6). Indeed, separate t-tests show a significant difference between enriched- and barrenhoused fish for minutes 2, 3, and 4, but not for minutes 5 and 6. In rats, environmental enrichment reduced inhibitory avoidance learning,8,9 while mice raised in an enriched environment had increased inhibitory avoidance behavior.6,7 In our study, we observed that zebrafish from an enriched environment displayed reduced inhibitory avoidance behavior. Interestingly, not all fish in the enrichedhoused group seemed to have lowered avoidance behavior, as we still observed fish that learned to refrain from swimming to the dark compartment where they experienced a shock before. However, the number of such fish in the enriched-housed group was clearly lower compared with the barren-housed group, and this resulted in an overall lower latency time. Impaired associative learning or a different appraisal of the shock by the subject could be at the basis of this observed reduction in avoidance behavior. However, studies in several fish species have demonstrated that environmental enrichment promotes learning and memory in fish24–27 and suggests that impaired associative learning in all likelihood does not underlie the reduction observed. It is thus more likely that the electric shock had a weaker impact for fish from an enriched environment. In rodents, environmental enrichment attenuated the need for pain relief in animals submitted to invasive procedures48 and reduced the injury-induced nerve hypersensitivity to both mechanical and cold stimuli,49 that is,

10

environmental enrichment is accompanied by a potentially higher pain threshold. Thus, an increased pain threshold due to environmental enrichment would offer an explanation for the reduction in avoider fish. It is clear that this warrants further studies (see concluding remarks below). Experiment 2: age

Inhibitory avoidance behavior in 6M-old zebrafish was not significantly different from that of 12M-old zebrafish in our Kruskal–Wallis test. However, our data suggest that there might be a difference in learning curves between these age groups. And, indeed, when comparing the 6M-old group with the 12M-old group only, we observed no difference on day 2 ( p = 0.07), but a significant difference on day 3 ( p = 0.02). Where the 12M-old group showed a steady increase in latency after each shock, the 6M-old group had a strong increase after a single shock but did not improve performance following the second shock. The expression levels of neurod, htr1ab, crf-bp, nr3c1(b), and nr3c2 following the inhibitory avoidance paradigm were found to be significantly lower in 6M-old zebrafish, whereas the expression of crf and nr3c1(a) was significantly higher compared with the 12M-old group. In addition, the nr3c2/nr3c1(a) ratio was found to be significantly lower. As the ratio between mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) activation is crucial for learning and memory,33,50 differences in the ratio of the expression of these genes observed between 6M- and 12M-old fish may have contributed to the observed differences in latency on day 3. The observed higher levels of crf and lower levels of crf-bp mRNA are likely related to age differences: in rats, levels of Crf increased with age while the expression of Crf-bp decreased.51 Corticotropin-releasing factor (CRF)-family peptides within the brain modulate learning and memory,52–54 and differences in expression levels may cause differences in learning and memory. Although dependent on the region where neurod is expressed, expression levels in the brain change as an individual ages. In the cerebellum of rodents for instance, an increased expression was observed followed by a decline at older age.55,56 The serotonergic system also undergoes changes during development and aging57,58; in rats, serotonin transporters increased up to the adult phase after which they decreased again with aging.59 Although little is known about the expression of htr1ab specifically during aging, our expression data (showing a hyperbolic relationship) suggest that the expression of htr1ab may follow a similar pattern. Although 6M- and 12M-old zebrafish have been classified as ‘‘adults,’’31 our data suggest that differences between 6M- and 12M-old zebrafish exist in avoidance learning. We observed minor, but significant, differences in inhibitory avoidance performance, and telencephalic gene expression showed strong differences following the task, most of which are linked to the endocrine stress system. Further characterization of the maturation of the zebrafish brain seems warranted. Twenty-four-month-old zebrafish appear to have delayed inhibitory avoidance behavior compared with 12M-old zebrafish, in the sense that they required an extra training day (day 3) to reach a similar latency time as 12M-old zebrafish (day 2). This reduced avoidance behavior might

MANUEL ET AL.

relate to the vast reduction in telencephalic gene expression related to plasticity and learning observed. Compared with 12M-old zebrafish, the 24M-old group had reduced levels of bdnf, pcna, cart4, neurod, htr1ab, and crf-bp and a higher expression of nr3c1(a) and nr3c2 in the telencephalon. The overall reduced expression of genes suggests a lower brain activity and neural plasticity. Lower expression of bdnf is associated with aging58 and may lead to reduced fear learning and lower ability to consolidate fear memories.60,61 Higher expression of pcna has been directly linked to increased cell proliferation in the brain of fish62,63 and may be considered as an indicator for brain plasticity. Higher concentrations of cocaine and amphetamine-regulated transcript (CART) peptide lead to enhanced learning and memory39,64 and a reduction in the expression of cart4 likely results in reduced peptide concentrations. In line with these observations, age-related spatial changes in the expression of neurod have been observed in the rodent brain55,56 and similarly may hold true for the fish brain. As discussed earlier, the serotonergic system changes during aging and the lower expression of htr1ab fits in the overall reduction of the system as seen at later age.57–59 In contrast to the reported increase of Crf-bp expression in aged rats,51 we observed a reduction in the crf-bp expression in older zebrafish. This reduction might result from an interaction of the aging effect with the effect of our inhibitory avoidance task, which lowers crf-bp expression (unpublished data). CRF peptides modulate learning and memory formation52–54 and are bound by corticotropin-releasing factor-binding protein (CRF-BP). By doing so, CRF-BP inhibits CRF-mediated activation of CRF receptors.65 A reduction in crf-bp expression may thus result in more CRF-mediated activity in the brain. Higher expression of nr3c2 may indicate a higher need for MR activation; for under basal conditions, the MR is fully occupied to maintain basal neuronal activity.66 Both MR and GR are involved in learning and memory,67–70 and the ratio between MR and GR activation is crucial.33,50 This may explain the higher nr3c1(a) expression, as it may maintain a proper MR/GRa ratio. Indeed, the nr3c2/nr3c1(a) ratio does not differ between 12M- and 24M-old fish. The need for more GRa activation is also reflected by the decrease in nr3c1(b), which is a splice variant that gives rise to GRb. In zebrafish, the GRb is thought to act as a decoy receptor, which inhibits the activation of GRa (but not MR due to its much higher affinity for steroids) by binding circulating glucocorticoids.71 A reduction in GRb seems thus an adaptive mechanism to ensure activation of GRa. Experiment 3: age and enrichment

Similar to the effects observed in our 12M-old zebrafish, inhibitory avoidance behavior in 6M-old zebrafish housed in an enriched environment was reduced. Gene expression analysis following inhibitory avoidance revealed a lower expression level of pcna, neurod, cart4, and cnr1 in 6M-old fish from an enriched environment. These observations are in contrast with previous studies, where pcna and neurod were upregulated following housing under enriched conditions.21,72 Yet, the decrease in pcna, neurod and cnr1 is in line with a decrease in inhibitory avoidance as indicated above and as revealed by comparison with unpublished baseline data from our laboratory. Thus, the higher


11

expression of these genes in the barren-housed group may reflect the acquisition of avoidance behavior, which was not observed in the enriched group. The lower expression of cart4 found in the enriched group may also be related to avoidance learning rather than housing condition. While gene expression levels of cart4 are decreased when measured after the task (Manuel et al.4), we reported previously that cart4 expression was higher in avoider fish (latencies equal to or larger than 180 s) than in nonavoider fish (latencies smaller than 60 s) when a 3 V shock was given.4 Our enriched-housed group consisted nearly only of nonavoider fish, which corresponds to lower cart4 expression, whereas the barren-housed group contained both nonavoider and avoider fish, which corresponds to higher levels of cart4. CART is involved in learning and memory,39,64 but higher levels of CART are also known to increase fear and anxietylike behavior.39,73 The lower expression of cart4 in the enriched-housed fish not only relates to the observed behavior in our current study: reduced anxiety-like behavior (6 months) and reduced inhibitory avoidance (12 months) but also corroborates previously reported inhibitory avoidance behavior and associated cart4 expression.4 Thus, next to possible changes in pain as discussed above, enrichment may affect levels of fear, lowering inhibitory avoidance behavior. In 24M-old zebrafish, we saw no clear effect of enrichment with regard to inhibitory avoidance behavior or gene expression analysis. We only observed a reduction in the nr3c1(b)/nr3c1(a) ratio, which suggests a higher potential for cortisol to activate GRa. Possibly, 4 weeks of enrichment is too short a period, or the enrichment came too late in the life history for 24M-old fish to benefit. In rats, lifelong enrichment reduced cognitive dysfunction at an older age.43 Whether lifelong enrichment has similar effects on zebrafish warrants further studies. However, we would suggest to expand the behavioral assessment paradigms to include a spatial learning task, as performance in such a task improved with enrichment.72 Here, both environmental enrichment and old age reduced inhibitory avoidance behavior, making it difficult to properly assess the effects of environmental enrichment on the cognitive abilities of aged fish.

experiment in barren-housed 6M-old zebrafish4 using a 1day shock paradigm showed only little differences between pre-task (baseline) and post-task gene expression levels. As indicated above, preliminary data comparing baseline and task-related gene expression levels in 12M-old barrenhoused fish revealed changes in levels of gene expression, which may help explaining our findings. We are currently studying this in more detail.

Limitations

Disclosure Statement

It should be noted that anxiety-like behavior could also have been assessed using the novel tank test74 rather than the black and white preference test. While both tests may be used to assess anxiety-like behavior, data suggest that they may not assess the same phenomenon as pharmacological profiles are not always identical.74 Therefore, our conclusions only relate to anxiety-like behavior (and the modulation thereof) as assessed through a black and white preference test. In addition, as we tested animals individually, this may have an effect on the outcome of the tests.75 This also applies to our inhibitory avoidance protocol. This warrants further studies. Given that we sampled post-task, differences in gene expression between experimental groups are closely associated with differences in inhibitory avoidance behavior, as discussed earlier.5 We do not as yet know whether differences in telencephalic gene expression between age and/or enrichment conditions were already present before the task and how the task alters them. However, data from our earlier

Concluding Remarks

Our data show that environmental enrichment reduces inhibitory avoidance behavior in 6M- and 12M-old zebrafish. For 6M-old zebrafish, this enrichment-induced reduction in performance was associated by differences in the mRNA levels of several genes in the telencephalon indicative for neuroplasticity. In contrast, 24M-old fish showed poor/ delayed inhibitory avoidance behavior without any noticeable effects of environmental enrichment on task performance. This poor task performance was associated with strongly reduced levels of genes indicative for neuroplasticity as well as the endocrine stress system. Where we observed minor differences in avoidance behavior between 6M- and 12M-old zebrafish, post-task gene expression analysis revealed clear differences in the expression level of genes involved in the endocrine stress system. For example, both the 6M and 12M age groups are often categorized as ‘‘adult’’ based on external morphological characteristics, yet our study indicates that there are age-related differences in behavior, cognition, and gene expression profiles. Acknowledgments

The authors thank Mr. F.A. Tom Spanings for excellent organization of fish husbandry and expert technical assistance throughout the experiment. This study was sponsored by the Dutch Science Organization (NWO; programme: Value of Animal Welfare; project no. 827.09.040). Further support came from the Norwegian Research Council (grant no. 190469) (L.O.E.E.) and by the EU Seventh Framework Programme (FP7/2010–2014) under grant agreement no. 265957–COPEWELL (L.O.E.E., M.G., and G.F.)

No competing financial interests exist. References

1. Blank M, Guerim LD, Cordeiro RF, Vianna MRM. A onetrial inhibitory avoidance task to zebrafish: rapid acquisition of an NMDA-dependent long-term memory. Neurobiol Learn Mem 2009;92:529–534. ˆ L, Capiotti KM, Tamborski AR, et al. Un2. Piato A predictable chronic stress model in zebrafish (Danio rerio): behavioral and physiological responses. Prog Neuropsychopharmacol Biol Psychiatry 2011;35:561–567. 3. Ng M-C, Hsu C-P, Wu Y-J, Wu S-Y, Yang Y-L, Lu K-T. Effect of MK-801-induced impairment of inhibitory avoidance learning in zebrafish via inactivation of extracellular signal-regulated kinase (ERK) in telencephalon. Fish Physiol Biochem 2012;38:1099–1106. 4. Manuel R, Gorissen M, Piza Roca C, et al. Inhibitory avoidance learning in zebrafish (Danio rerio): effects of

12

5.

6.

7.

8.

9.

10. 11. 12. 13.

14.

15. 16. 17.

18.

19.

20.

MANUEL ET AL.

shock intensity and unraveling differences in task performance. Zebrafish 2014;11:341–352. Manuel R, Gorissen M, Zethof J, et al. Unpredictable chronic stress decreases inhibitory avoidance learning in Tuebingen long-fin zebrafish (Danio rerio Hamilton): stronger effects in the resting phase than in the active phase. J Exp Biol 2014; 217:3919–3928. Huang FL, Huang K-P, Wu J, Boucheron C. Environmental enrichment enhances neurogranin expression and hippocampal learning and memory but fails to rescue the impairments of neurogranin null mutant mice. J Neurosci 2006;26:6230–6237. Kazlauckas V, Pagnussat N, Mioranzza S, et al. Enriched environment effects on behavior, memory and BDNF in low and high exploratory mice. Physiol Behav 2011;102: 475–480. Garrido P, De Blas M, Ronzoni G, et al. Differential effects of environmental enrichment and isolation housing on the hormonal and neurochemical responses to stress in the prefrontal cortex of the adult rat: relationship to working and emotional memories. J Neural Transm 2012;120:829– 843. Rojas JJ, Deniz BF, Miguel PM, et al. Effects of daily environmental enrichment on behavior and dendritic spine density in hippocampus following neonatal hypoxia-ischemia in the rat. Exp Neurol 2012;241C:25–33. McNamara MC, Bepjignus G, Benignus VA, Miller AT Jr. Active and passive avoidance in rats as a function of age. Exp Aging Res 1977;3:3–16. Balcombe JP. Laboratory environments and rodents’ behavioural needs: a review. Lab Anim 2006;40:217–235. Olsson IAS, Dahlborn K. Improving housing conditions for laboratory mice: a review of ‘‘environmental enrichment.’’ Lab Anim 2002;36:243–270. Mason G, Clubb R, Latham N, Vickery S. Why and how should we use environmental enrichment to tackle stereotypic behaviour? Appl Anim Behav Sci 2007;102:163– 188. The influences of standard laboratory cages on rodents and the validity of research data. 2004. Available at http:// www.ingentaconnect.com/content/ufaw/aw/2004/00000013/ A00101s1/art00003. Rosenzweig MR, Bennett EL, Hebert M, Morimoto H. Social grouping cannot account for cerebral effects of enriched environments. Brain Res 1978;153:563–576. van Praag H, Kempermann G, Gage FH. Neural consequences of environmental enrichment. Nat Rev Neurosci 2000;1:191–198. Marashi V, Barnekow A, Ossendorf E, Sachser N. Effects of different forms of environmental enrichment on behavioral, endocrinological, and immunological parameters in male mice. Horm Behav 2003;43:281–292. Milshtein NB, Hollander N. Environmental enrichment in mice decreases anxiety, attenuates stress responses and enhances natural killer cell activity. Eur J Neurosci 2004;20:1341–1347. Tees RC. The influences of rearing environment and neonatal choline dietary supplementation on spatial learning and memory in adult rats. Behav Brain Res 1999;105:173– 188. Harris AP, D’Eath RB, Healy SD. Environmental enrichment enhances spatial cognition in rats by reducing thigmotaxis (wall hugging) during testing. Anim Behav 2009;77:1459–1464.

21. Krogh von K, Sørensen C, Nilsson GE, Øverli Ø. Forebrain cell proliferation, behavior, and physiology of zebrafish, Danio rerio, kept in enriched or barren environments. Physiol Behav 2010;101:32–39. 22. Brown C, Davidson T, Laland K. Environmental enrichment and prior experience of live prey improve foraging behaviour in hatchery-reared Atlantic salmon. J Fish Biol 2003;63:187–196. 23. Braithwaite VA, Salvanes AGV. Environmental variability in the early rearing environment generates behaviourally flexible cod: implications for rehabilitating wild populations. Proc Biol Sci 2005;272:1107–1113. 24. Brydges NM, Braithwaite VA. Does environmental enrichment affect the behaviour of fish commonly used in laboratory work? Appl Anim Behav Sci 2009;118:137–143. 25. Strand DA, Utne-Palm AC, Jakobsen PJ, Braithwaite VA, Jensen KH, Salvanes A. Enrichment promotes learning in fish. Mar Ecol Prog Ser 2010;412:273–282. 26. Spence R, Magurran AE, Smith C. Spatial cognition in zebrafish: the role of strain and rearing environment. Anim Cogn 2011;14:607–612. 27. Salvanes AGV, Moberg O, Ebbesson LOE, Nilsen TO, Jensen KH, Braithwaite VA. Environmental enrichment promotes neural plasticity and cognitive ability in fish. Proc Biol Sci 2013;280:20131331. 28. Feigley DA, Spear NE. Effect of age and punishment condition on long-term retention by the rat of active- and passive-avoidance learning. J Comp Physiol Psychol 1970; 73:515–526. 29. Egger GJ, Livesey PJ. Age effects in the acquisition and retention of active and passive avoidance learning by rats. Dev Psychobiol 1972;5:343–351. 30. Brunner R. Age differences in one-trial passive avoidance learning. Psychonomic Sci 1969;14:134–136. 31. Stewart AM, Braubach O, Spitsbergen J, Gerlai R, Kalueff AV. Zebrafish models for translational neuroscience research: from tank to bedside. Trends Neurosci 2014;37: 264–278. 32. Almaida-Pagań PF, Lucas-Sańchez A, Tocher DR. Changes in mitochondrial membrane composition and oxidative status during rapid growth, maturation and aging in zebrafish, Danio rerio. Biochim Biophys Acta 2014;1841: 1003–1011. 33. de Kloet ER, Oitzl MS, Joe¨ls M. Stress and cognition: are corticosteroids good or bad guys? Trends Neurosci 1999; 22:422–426. 34. Liu IYC. Brain-derived neurotrophic factor plays a critical role in contextual fear conditioning. J Neurosci 2004;24:7958–7963. 35. Flik G, Klaren PHM, Van den Burg EH, Metz JR, Huising MO. CRF and stress in fish. Gen Comp Endocrinol 2006; 146:36–44. 36. Koolhaas JM, de Boer SF, Buwalda B, van Reenen K. Individual variation in coping with stress: a multidimensional approach of ultimate and proximate mechanisms. Brain Behav Evol 2007;70:218–226. 37. Koolhaas JM, de Boer SF, Coppens CM, Buwalda B. Neuroendocrinology of coping styles: towards understanding the biology of individual variation. Front Neuroendocrinol 2010;31:307–321. 38. Maximino C, Puty B, Benzecry R, et al. Role of serotonin in zebrafish (Danio rerio) anxiety: relationship with serotonin levels and effect of buspirone, WAY 100635, SB 224289, fluoxetine and para-chlorophenylalanine (pCPA)


39.

40.

41. 42. 43.

44. 45. 46.

47. 48.

49.

50. 51.

52.

53.

54.

55.

in two behavioral models. Neuropharmacology 2013;71: 83–97. Upadhya MA, Kokare DM, Subhedar NK. Cocaine- and amphetamine-regulated transcript peptide (CART) in the central nucleus of amygdala potentiates behavioral and hormonal responses of the rat exposed to its predator. Behav Brain Res 2013;243:129–137. Broglio C, Gomez A, Duran E, et al. Hallmarks of a common forebrain vertebrate plan: specialized pallial areas for spatial, temporal and emotional memory in actinopterygian fish. Brain Res Bull 2005;66:277–281. Mueller T, Dong Z, Berberoglu MA, Guo S. The dorsal pallium in zebrafish, Danio rerio (Cyprinidae, Teleostei). Brain Res 2011;1381:95–105. Ebbesson LOE, Braithwaite VA. Environmental effects on fish neural plasticity and cognition. J Fish Biol 2012;81: 2151–2174. Kobayashi S, Ohashi Y, Ando S. Effects of enriched environments with different durations and starting times on learning capacity during aging in rats assessed by a refined procedure of the Hebb-Williams maze task. J Neurosci Res 2002;70:340–346. Serra EL, Medalha CC, Mattioli R. Natural preference of zebrafish (Danio rerio) for a dark environment. Braz J Med Biol Res 1999;32:1551–1553. Stephenson JF, Whitlock KE, Partridge JC. Zebrafish preference for light or dark is dependent on ambient light levels and olfactory stimulation. Zebrafish 2011;8:17–22. Vandesompele J, De Preter K, Pattyn F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3:1–11. Maximino C, de Brito TM, de Mattos Dias C. Scototaxis as anxiety-like behavior in fish. Nat Protoc 2010;5:209–216. Pham TM, Hagman B, Codita A, Van Loo PLP, Stro¨mmer L, Baumans V. Housing environment influences the need for pain relief during post-operative recovery in mice. Physiol Behav 2010;99:663–668. Vachon P, Millecamps M, Low L, et al. Alleviation of chronic neuropathic pain by environmental enrichment in mice well after the establishment of chronic pain. Behav Brain Funct 2013;9:1–9. Lupien SJ, Lepage M. Stress, memory, and the hippocampus: can’t live with it, can’t live without it. Behav Brain Res 2001;127:137–158. Pisarska M, Mulchahey JJ, Welge JA, Geracioti TD, Kasckow JW. Age-related alterations in emotional behaviors and amygdalar corticotropin-releasing factor (CRF) and CRF-binding protein expression in aged Fischer 344 rats. Brain Res 2000;877:184–190. Behan DP, Heinrichs SC, Troncoso JC, et al. Displacement of corticotropin-releasing factor from its binding-protein as a possible treatment for Alzheimers-disease. Nature 1995;378:284–287. Radulovic J, Ru¨hmann A, Liepold T, Spiess J. Modulation of learning and anxiety by corticotropin-releasing factor (CRF) and stress: differential roles of CRF receptors 1 and 2. J Neurosci 1999;19:5016–5025. Radulovic J, Fischer A, Katerkamp U, Spiess J. Role of regional neurotransmitter receptors in corticotropin-releasing factor (CRF)-mediated modulation of fear conditioning. Neuropharmacology 2000;39:707–710. Seki T. Expression patterns of immature neuronal markers PSA-NCAM, CRMP-4 and NeuroD in the hippocampus of

13

56. 57.

58. 59.

60. 61. 62.

63.

64.

65.

66. 67.

68. 69.

70.

71. 72.

young adult and aged rodents. J Neurosci Res 2002;70: 327–334. Munõz EM, Bailey MJ, Rath MF, et al. NeuroD1: developmental expression and regulated genes in the rodent pineal gland. J Neurochem 2007;102:887–899. Hansson SR, Mezey E, Hoffman BJ. Serotonin transporter messenger RNA in the developing rat brain: early expression in serotonergic neurons and transient expression in non-serotonergic neurons. Neuroscience 1998;83:1185– 1201. Mattson MP, Maudsley S, Martin B. BDNF and 5-HT: a dynamic duo in age-related neuronal plasticity and neurodegenerative disorders. Trends Neurosci 2004;27:589–594. Ulloa R-E, Diaz-Valderrama A, Herrera-Perez J, LeonOlea M, Martinez-Mota L. Age differences in the impact of forced swimming test on serotonin transporter levels in lateral septum and dorsal raphe. Behav Brain Funct 2014;10:3. Monfils M-H, Cowansage KK, LeDoux JE. Brain-derived neurotrophic factor: linking fear learning to memory consolidation. Mol Pharmacol 2007;72:235–237. Schulz-Klaus B, Lessmann V. BDNF-dependent consolidation of fear memories in the perirhinal cortex. Front Behav Neurosci 2013;7:1–7. Grandel H, Kaslin J, Ganz J, Wenzel I, Brand M. Neural stem cells and neurogenesis in the adult zebrafish brain: origin, proliferation dynamics, migration and cell fate. Dev Biol 2006;295:263–277. Ekstro¨m P, Johnsson CM, Ohlin LM. Ventricular proliferation zones in the brain of an adult teleost fish and their relation to neuromeres and migration (secondary matrix) zones. J Comp Neurol 2001;436:92–110. Yermolaieva O, Chen JG, Couceyro PR, Hoshi T. Cocaineand amphetamine-regulated transcript peptide modulation of voltage-gated Ca2 + signaling in hippocampal neurons. J Neurosci 2001;21:7474–7480. Manuel R, Metz JR, Flik G, Vale WW, Huising MO. Corticotropin-releasing factor-binding protein (CRF-BP) inhibits CRF- and urotensin-I-mediated activation of CRF receptor-1 and -2 in common carp. Gen Comp Endocrinol 2014;202:69–75. Reul JMHM, De Kloet ER. Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology 1985;117:2505–2511. Cerqueira JJ, Catania C, Sotiropoulos I. Corticosteroid status influences the volume of the rat cingulate cortex–a magnetic resonance imaging study. J Psychiatr Res 2005;39:451–460. Lupien S, McEwen B. The acute effects of corticosteroids on cognition: integration of animal and human model studies. Brain Res Rev 1997;24:1–27. Zhou M, Bakker EHM, Velzing EH, et al. Both mineralocorticoid and glucocorticoid receptors regulate emotional memory in mice. Neurobiol Learn Mem 2010;94:530– 537. Horst Ter JP, Van Der Mark MH, Arp M, Berger S, De Kloet ER, Oitzl MS. Stress or no stress: mineralocorticoid receptors in the forebrain regulate behavioral adaptation. Neurobiol Learn Mem 2012;98:33–40. Schaaf MJM, Champagne D, van Laanen IHC, et al. Discovery of a functional glucocorticoid receptor b-isoform in zebrafish. Endocrinology 2008;149:1591–1599. Salvanes AGV, Moberg O, Ebbesson LOE, Nilsen TO, Jensen KH, Braithwaite VA. Environmental enrichment

14

promotes neural plasticity and cognitive ability in fish. Proc Biol Sci 2013;280:20131331. 73. Koylu EO, Balkan B, Kuhar MJ, Pogun S. Cocaine and amphetamine regulated transcript (CART) and the stress response. Peptides 2006;27:1956–1969. 74. Maximino C, Benzecry R, Oliveira KRM, et al. A comparison of the light/dark and novel tank tests in zebrafish. Behaviour 2012;149:1099–1123. 75. Gleason PE, Weber PG, Weber SP. Effect of group size on avoidance learning in zebra fish, Brachydanio rerio (Pisces: Cyprinidae). Anim Learn Behav 1977;5:213–216.

MANUEL ET AL.

Address correspondence to: Remy Manuel, MSc Department of Organismal Animal Physiology Institute for Water and Wetland Research Radboud University Nijmegen Heyendaalseweg 135 Postbox 30 6525 AJ Nijmegen The Netherlands E-mail: [email protected]