Conserv Genet DOI 10.1007/s10592-007-9338-7
RESEARCH ARTICLE
The importance of reproductive strategies in population genetic approaches to conservation: an example from the marine angiosperm genus Zostera Jim Provan Æ Siaˆn Wilson Æ Alex A. Portig Æ Christine A. Maggs
Received: 13 October 2006 / Accepted: 23 April 2007 Springer Science+Business Media B.V. 2007
Abstract Knowledge of the levels of genetic diversity maintained in natural populations can play a central role in conservation programmes, particularly in threatened habitats or species. Fluctuations in population size can lead to loss of variation and, consequently, increase the risk of extinction. We have examined whether such a genetic bottleneck has occurred in populations of two species in the seagrass genus Zostera, which are believed to have been affected by an outbreak of wasting disease at the start of the last century. A test for heterozygote excess at five nuclear microsatellite loci did not suggest the occurrence of a genetic bottleneck, but analysis of seven chloroplast microsatellite loci and sequence data from two regions did suggest a bottleneck in the chloroplast genome. Extremely low levels of between-population diversity suggest that all subpopulations can be treated as a single management unit for each species. Comparable levels of nuclear genetic diversity were found in the three populations of the primarily sexual Zostera marina var. angustifolia studied but a wider range of within-population diversity was found in Zostera noltii, which displays both sexual and vegetative reproductive strategies. This may be due to an increase in sexual recruitment due to localised fresh water inflow into the study site near to the most diverse population. Such populations should be prioritised as source material for any
J. Provan (&) S. Wilson C. A. Maggs School of Biological Sciences, The Queen’s University of Belfast, 97 Lisburn Road, Belfast BT9 7BL, Northern Ireland e-mail:
[email protected] A. A. Portig Quercus Centre for Biodiversity and Conservation Biology, School of Biological Sciences, The Queen’s University of Belfast, 97 Lisburn Road, Belfast BT9 7BL, Northern Ireland
replanting or remediation due to natural or anthropogenic loss of Zostera beds in the area. Keywords bottleneck
Eelgrass Zostera Microsatellite Genetic
Introduction Recent advances in molecular genetic technology have opened a new chapter in conservation efforts and results from molecular studies are becoming increasingly important in the conservation and management of a wide range of rare or threatened species (Haig 1998; DeSalle and Amato 2004). It has long been known that the visible external phenotypes of organisms are not an infallible guide to either the levels of diversity or how these levels are partitioned. Populations harbouring reduced levels of genetic diversity may be at risk of extinction due to both a limited adaptive potential and the fixation of deleterious alleles where the stochastic nature of genetic drift can overcome selection due to small effective population sizes. As a consequence of this, regeneration and restoration programmes may be most effective when a priori knowledge of the genetic composition of potential source populations is taken into account with the overall aim of maximising the diversity of new populations and reintroductions and reducing the potential for founder effects (Frankham et al. 2002). In plants, contemporary factors determining levels of within- and between-population genetic diversity are often associated with differences in mating systems (sexual versus asexual, selfing versus outcrossing) and since many species of plant display flexibility in reproductive strategy, differing modes of reproduction under a variety of environmental conditions represent another potential
123
Conserv Genet
variable when formulating conservation strategies (Jones and Gliddon 1999; Collevatti et al. 2001; Telles et al. 2003). Sudden decreases in population numbers due to catastrophic events such as epidemics or periodic fluctuations such as seasonal desiccation of ponds can generate genetic bottlenecks. During these events, only a few individuals survive to continue the existence of the population and this may result in a marked decrease in levels of genetic diversity. Identifying bottlenecked populations is therefore important in a conservation context and an accurate picture of the demography of potentially bottlenecked populations can play a crucial role in formulating conservation strategies (Hedrick and Miller 1992; Lande 1994; Frankham 1995; Frankham et al. 2002. Unfortunately, because information on original population sizes and levels of genetic diversity is rarely available, it has generally been difficult to determine whether a population has suffered a decline in genetic diversity due to a reduction in numbers. Recently, however, theoretical and empirical studies based on known bottlenecked and non-bottlenecked populations have provided new opportunities to identify populations that have gone through a genetic bottleneck (Luikart and Cornuet 1998). Such populations will display an excess of heterozygotes and an examination of the relationship between heterozygosity and allelic diversity under a specific mutation model should reveal whether a population has recently been bottlenecked (Cornuet and Luikart 1996). This approach has been used to detect bottlenecks in natural populations of both plants (e.g. Friar et al. 2000; Ledig et al. 2002; Lee et al. 2002) and animals (e.g. Beebee and Rowe 2001). More recently, similar statistics have been developed specifically for use with microsatellite markers, which can consistently reconstruct the demographic history of bottlenecked populations (Garza and Williamson 2001). North Atlantic populations of the seagrass genus Zostera (eelgrass) are believed to have experienced a population genetic bottleneck within the last century due to an outbreak of ‘‘wasting disease’’ in the 1920s and 1930s. The disease, caused by the oomycete Labyrinthula macrocystis (syn. Labyrinthula zosterae), results in extensive leaf damage and is believed to have destroyed around 90% of Zostera beds in the north Atlantic (Short et al. 1987). Other researchers have suggested that the disease may be a secondary infection of already senescent plants (Nienhuis 1994; Vergeer and Develi 1997), although the ability of the pathogen to infect healthy eelgrass beds has been demonstrated (Ralph and Short 2002). Further theories suggest that climatic change may have been the primary causal agent and that the decline of seagrass beds was coincident with the Labyrinthula outbreak (Rasmussen 1977). Nevertheless, the first reports of eelgrass decline appeared in 1932 when Huntsman (1932) observed that Zostera marina
123
had diminished along the Atlantic coast of North America between Virginia and the Gulf of St. Lawrence. A similar situation was observed in Nova Scotia (Lewis 1932) and in the following year, the decline was reported for the first time in Britain (Cotton 1933). By the mid-1940s, eelgrasses had become comparatively scarce around the coasts of Britain (Tubbs 1995) and recovery of many Zostera beds did not begin until as recently as the mid-1980s. Recently, there have been reports that Labyrinthula may still be present in some seagrass beds in the UK, thus placing even greater importance on monitoring the effects of wasting disease outbreaks on genetic diversity (Cordrey 1997). Although not currently classed as endangered or threatened, Zostera species remain a high priority for monitoring and conservation management, reflecting their key role in coastal ecosystems. They enhance the biodiversity and habitat diversity of coastal waters by providing a habitat for many fish, shellfish and algal species, particularly during the developmental stages of these organisms. In addition, seagrasses are known to improve water quality by absorbing dissolved nutrients, as well as stabilising sediments and minimising resuspension (McRoy and Helfferich 1977; Larkum and den Hartog 1989). Finally, seagrass meadows represent an important carbon-sink in the oceans, accounting for about 12% of the total oceanic carbon storage (Duarte and Cebria´n 1996). Like other seagrasses, Zostera can reproduce both sexually and asexually. Vegetative growth seems to predominate, particularly in Z. noltii, although there have been reports of annual growth of some populations of Z. marina (sometimes accorded specific status as Z. angustifolia but more usually regarded as Z. marina var. angustifolia) which rely totally upon seed set (Cleator 1993; Reusch 2001b; Hammerli and Reusch 2003; Mun˜iz-Salazar et al. 2005). On the whole, however, Z. noltii appears to be relatively flexible in mode of reproduction, with both clonality and seed set contributing to the establishment of new beds and patches and with varying levels of inbreeding occurring during sexual reproduction (Coyer et al. 2004b; Diekmann et al. 2005). Indeed, it is likely that many beds may comprise a ‘‘mosaic’’ of clones that have spread vegetatively following seed dispersal (Reusch et al. 1999a). In addition, ‘‘rafting’’ of reproductive shoots may also play a role in larger-scale dispersal (Reusch 2001a). Since molecular genetic markers specific to organellar (chloroplast and mitochondrial) genomes are generally transmitted maternally in angiosperms, the comparative analysis of levels and patterns of genetic variation at nuclear and organellar loci can provide information on the relative roles of seed and pollen dispersal in natural populations (Ennos 1994; McCauley 1995; Ennos et al. 1999). In this study we have carried out a comparative analysis of the genetic structure of sympatric populations of Zostera
Conserv Genet
noltii and Z. marina var. angustifolia in Strangford Lough, Northern Ireland. Our aims were (a) to determine whether the Wasting Disease outbreak and/or population decline of the 1920s and 1930s has resulted in a genetic bottleneck in either or both species, and (b) to elucidate the levels and patterns of genetic diversity in extant populations and to correlate these with the relative roles of sexual and vegetative reproduction in the establishment and persistence of Zostera beds, thus forming a basis for conservation strategies.
Materials and methods Study site, sampling and DNA extraction Strangford Lough, Co. Down, Northern Ireland is the largest example of a fjordic sea lough in the British Isles, ~30 km long and covering 150 km2 in area. Around a third of the area is made up of mudflats, sandflats, coastal lagoons, tidal rivers and estuaries and the Lough has been designated a Special Area of Conservation under the European Commission Habitats Directive. Because of the ca. 3 m tidal range, it has been estimated that as much as 50% of the area of the Lough is exposed at low tide. The seagrass beds, which cover the intertidal mudflats and sandflats at the northern end of the Lough have been designated as priority habitats by the UK Biodiversity Steering Group.
Plants were sampled on a 200 · 200 m2 grid from three subpopulations at the northern end of Strangford Lough as shown in Fig. 1. Samples were only collected where both species (Z. marina var. angustifolia and Z. noltii) were found to grow sympatrically. Sampling at this scale should minimise the chance of sampling multiple ramets of a single genet. Studies of clone size in both Z. marina and Z. noltii have reported clones a few tens of metres across (Reusch et al. 1998, 2000; Coyer et al. 2004b) with the largest example in Z. marina measuring 160 · 40 m2 (Reusch et al. 1999b). A total of 167 samples of each species were collected: 108 from the North End subpopulation, 35 samples from Castle Espie (at the south west of the study area) and 24 samples from Greyabbey (at the south east of the study area). DNA was extracted from leaf material using the Qiagen plant DNeasy system. Nuclear microsatellite genotyping For Z. marina var. angustifolia, loci ZosmarCT-12 and ZosmarCT-35 from Reusch (2000) and loci ZosmarCT-3, ZosmarGA-2 and ZosmarGA-3 from Reusch et al. (1999a) were used to genotype individuals. For Z. noltii, loci ZnE7, ZnF8, ZnF11, ZnH8 and ZnH10 from Coyer et al. (2004a) were used. PCR was carried out on a MWG Primus thermal cycler using the following parameters: initial denaturation at 94C for 3 min followed by 35 cycles of denaturation at 94C, annealing at [Tm]C for 1 min (see Reusch 1999a, 2000; Coyer et al. 2004a, b for Tm values), extension at
Fig. 1 Sampling sites for Zostera marina var. angustifolia and Z. noltii from Strangford Lough. The heavy black arrow indicates the mouth of the Comber River, the only major freshwater inflow in the study area
123
Conserv Genet
72C for 1 min and a final extension at 72C for 5 min. PCR was carried out in a total volume of 10 ll containing 100 ng genomic DNA, 10 pmol of 32P-end labelled forward primer, 10 pmol of reverse primer, 1· PCR reaction buffer (5 mM Tris–HCl [pH9.1], 1.6 mM [NH4]2SO4, 15 lg/ll BSA), 2.5 mM MgCl2 and 0.5 U Taq polymerase (Genetix, Hampshire, Germany). Products were resolved on 6% denaturing polyacrylamide gels containing 1· TBE and 8 M urea after addition of 10 ll of 95% formamide loading buffer. Gels were run at 70 W constant power for 2 h, transferred to 3 MM Whatman blotting paper and exposed to X-ray film for 1 h at –20C. In all cases, previously analysed samples were included as controls to compare product sizes across gels.
3 min followed by 35 cycles of denaturation at 94C, annealing at 55C for 1 min, extension at 72C for 1 min and a final extension at 72C for 5 min. PCR was carried out in a total volume of 20 ll containing 200 ng genomic DNA, 20 pmol of forward primer, 20 pmol of reverse primer, 1· PCR reaction buffer (5 mM Tris–HCl [pH9.1], 1.6 mM [NH4]2SO4, 15 lg/ll BSA), 2.5 mM MgCl2 and 1.0 U Taq polymerase (Genetix). 10 ll PCR product was resolved on 2% agarose gels, visualised by ethidium bromide staining and the remaining 10 ll sequenced commercially (Macrogen, Seoul, South Korea). Sequences were aligned using the CLUSTALW program in the BioEdit software package. Data analysis
Chloroplast microsatellite genotyping Regions of the chloroplast genome were amplified in Z. marina var. angustifolia using the universal primers of Taberlet et al. (1991) and Demesure et al. (1995) and sequenced to identify putative chloroplast microsatellite loci. Primers were designed to amplify the seven microsatellites of eight repeats or more found in non-coding regions using the program PRIMER (V0.5; Table 1). PCR and gel electrophoresis were carried out for all samples of both species as described above using Tm values given in Table 1. Chloroplast genome sequencing The trnL intron region was amplified using the primers of Taberlet et al. (1991) and sequenced for a subset of the individuals (25% of the total) from both species. PCR was carried out on a MWG Primus thermal cycler using the following parameters: initial denaturation at 94C for
As many of the multi-locus genotypes for Z. noltii were represented more than once, we calculated the probability (PGEN) of each multi-locus genotype arising through sexual as opposed to clonal reproduction following the method of Parks and Werth (1993): PGEN ¼
h n1 2 Pðx1i x2i Þ ;
where h is the number of loci at which the genotype is heterozygous, x1i is the allele frequency of the first allele in the genotype at locus i, x2i is the allele frequency of the second allele in the genotype at locus i. Thus, samples which shared multi-locus genotypes with PGEN < 0.05 were considered clonemates and duplicate genotypes were removed from further analyses. Levels of polymorphism measured as observed and expected heterozygosity (HO/HE) were calculated using the POPGENE software package (V1.32; Yeh et al. 1997). Levels
Table 1 Zostera chloroplast microsatellite primers Locus
Repeat
Location
ZOSCPSSR1
(A)8
Downstream of trnS(UGA)
Primers (5¢–3¢)
Tm
Size (bp)
ATGGCTCGGCTAGGTAGGAT
55C
122
55C
136
48C
137
50C
138
50C
150
55C
133
55C
113
GATTTGAAAAAGGAATCGATCG ZOSCPSSR2
(A)8
trnH(GUG)/trnK(UUU) intergenic
GCTACATCCGACCCCTTACA ATCAATCAATGGAAAAAAGGA
ZOSCPSSR3
(A)12
trnL(UAA) intron
CCAAATTCAGAGAAACC TGGTATAATAGAATATGGAAA
ZOSCPSSR4
(TA)9
trnL(UAA) intron
TTTCCATATTCTATTATACCA AGAATTATTCCCCTTACC
ZOSCPSSR5
(A)7
trnL(UAA) intron
TTCTTGTGAATCCATGCCAA TGATATTGACACGTAGAACGGG
ZOSCPSSR6
(T)8
trnL(UAA)/trnF(GAA) intergenic
ATGTGGATTTGCACGTATATCG ATTTCCTTACTTTTTCCGCTCC
ZOSCPSSR7
(T)10
trnL(UAA)/trnF(GAA) intergenic
CATCTGGAAACAATAGAGTGAAT GGTTCAAGTCCCTCTATCCC
123
Conserv Genet
of allelic richness (AR) standardised to 24 diploid individuals (the sample size of the smallest population) were calculated using the FSTAT software package (V2.9.3.2; Goudet 2001). Calculation of allelic richness uses a rarefaction method and thus gives comparable measures of genetic diversity when unequal sample sizes are used. Levels of genetic differentiation between subpopulations were calculated within the analysis of molecular variance (AMOVA) framework (Excoffier et al. 1992) using the ARLEQUIN software package (V2.0; Schneider et al. 2000). To test for the occurrence of a genetic bottleneck, the Wilcoxon test for heterozygote excess was performed under the infinite alleles model (IAM), the stepwise mutation model (SMM) and a two-phase model (TPM) incorporating 90% single-stepwise mutations using the program BOTTLENECK (V1.2; Piry et al. 1999). The Wilcoxon test was used as it is recommended for a relatively low number of loci.
Results Levels of clonality Plants within the genus Zostera have the capacity to utilise both sexual and asexual reproduction and thus the data sets were analysed for the multiple occurrence of genotypes. From a total of 167 Z. marina var. angustifolia plants, four multi-locus genotypes were observed twice and one was observed three times but none of these were likely to be clonemates (PGEN > 0.05). In Z. noltii, 17 genotypes were present in more than one plant but four of these could not be attributed to clonal growth. The distribution of the remaining clonal genotypes is shown in Fig. 2.
Z. marina var. angustifolia ranged from 1.000 at locus ZosmarCT-12 in the Castle Espie population to 14.063 at locus ZosmarCT-35 in the North End population with an average range of 5.400 (Greyabbey) to 6.162 (North End). Levels of allelic richness in Z. noltii ranged from 1.000 at locus ZnF8 in the Greyabbey population to 6.281 at locus ZnE7 in the Castle Espie population with average values ranging from 3.107 (North End) to 3.600 (Greyabbey). The Wilcoxon test for heterozygote excess did not indicate a genetic bottleneck in any of the populations for either species (data not shown) under any of the three mutation models. In both species, the AMOVA showed a small but significant level of genetic substructuring between populations (FST = 0.008, P = 0.019 for Z. marina var. angustifolia; FST = 0.019, P = 0.007 for Z. noltii: Table 3). Chloroplast diversity No variation was detected at any of the seven chloroplast microsatellite loci analysed in either species. Both species were also monomorphic in the trnL intron region (619 bp in Z. marina var. angustifolia and 594 bp in Z. noltii). A comparison with previously published trnL intron sequences (Procaccini et al. 1999) revealed three indels and four substitutions between the Strangford Lough Z. marina var. angustifolia samples and a sample from Monterey Bay, California and three indels and eight substitutions between the Strangford Lough Z. noltii samples and a sample from Ischia, Italy.
Discussion
Nuclear diversity
Is there evidence of a genetic bottleneck in Zostera populations in Strangford Lough?
Levels of nuclear genetic diversity were generally substantially higher in the annual, sexually reproducing Z. marina var. angustifolia than in Z. noltii, which primarily reproduces vegetatively (mean overall expected heterozygosity = 0.511 vs. 0.188; mean allelic richness = 6.100 vs. 3.373; Table 2). Levels of expected heterozygosity in Z. marina var. angustifolia ranged from zero at the monomorphic ZosmarCT-12 locus in the Castle Espie subpopulation to 0.818 at locus ZosmarCT-35 in the Greyabbey population, and from 0.036 at locus ZnF8 in the Greyabbey population to 0.420 at locus ZnE7 in the Castle Espie population in Z. noltii. Mean expected heterozygosity by population ranged from 0.507 (Castle Espie) to 0.512 (Greyabbey) in Z. marina var. angustifolia, but was much more variable in Z. noltii, ranging from 0.153 (North End) to 0.263 (Castle Espie). Levels of allelic richness in
The transient departure from mutation-drift equilibrium caused by a historical reduction in population size should lead to an observable heterozygote excess in impacted populations since the loss of rare alleles has little effect on overall heterozygosity (Allendorf 1996; Hedrick et al. 1996). Such an excess of heterozygotes was not observed in the Zostera populations studied, suggesting that the population decline of the 1920s and 1930s has not resulted in a major genetic bottleneck in the Strangford Lough populations of either Z. marina var. angustifolia or Z. noltii. As only five polymorphic loci were studied in each case, there is a small chance that the apparent absence of a bottleneck may be due to a lack of statistical power but empirical studies have shown that this number of loci is usually sufficient to detect documented bottlenecks, particularly as the number of individuals studied here (167 in
123
Conserv Genet Fig. 2 Distribution of 13 clonal Z. noltii genotypes (labelled A– M)
Table 2 Levels of within-subpopulation diversity in Zostera marina var. angustifolia and Z. noltii Species/locus
North End n = 108 HO
HE
Castle Espie n = 35 AR
HO
HE
Greyabbey n = 24 AR
HO
HE
Overall n = 167 AR
HO
HE
AR
Z. marina var. angustifolia ZosmarCT-12
0.072
0.071
2.316
–
–
1.000
0.071
0.070
2.000
0.059
0.058
2.134
ZosmarCT-35
0.775
0.810
14.063
0.774
0.814
12.556
0.750
0.818
13.000
0.771
0.813
13.859
ZosmarCT-3
0.559
0.474
5.517
0.419
0.396
6.036
0.429
0.394
5.000
0.512
0.447
5.624
ZosmarGA-2
0.577
0.602
4.141
0.677
0.666
3.843
0.679
0.666
4.000
0.612
0.628
4.147
ZosmarGA-3
0.613
0.586
4.775
0.677
0.659
5.566
0.536
0.613
3.000
0.612
0.608
4.736
Mean
0.519
0.509
6.162
0.510
0.507
5.800
0.493
0.512
5.400
0.513
0.511
6.100
ZnE7
0.289
0.344
4.701
0.379
0.393
6.281
0.393
0.420
5.000
0.343
0.374
5.031
ZnF8
0.062
0.061
2.011
0.276
0.300
2.917
0.036
0.036
1.000
0.107
0.113
2.469
ZnF11 ZnH8
0.196 0.093
0.191 0.120
3.317 3.435
0.241 0.241
0.300 0.223
2.706 3.411
0.143 0.179
0.257 0.204
3.000 6.000
0.195 0.136
0.221 0.152
3.154 3.705
ZnH10
0.031
0.051
2.071
0.103
0.099
2.622
0.143
0.200
3.000
0.059
0.081
2.504
Mean
0.134
0.153
3.107
0.248
0.263
3.587
0.179
0.224
3.600
0.168
0.188
3.373
Z. noltii
HO observed heterozygosity; HE expected heterozygosity; AR allelic richness
total from the three subpopulations) is relatively high (Luikart and Cornuet 1998). Furthermore, the short time period since the end of the eelgrass decline (around 70– 80 years) means that any genetic effects of a reduction in effective population size would probably still be apparent, even when markers with a high-mutation rate such as microsatellites are utilised (Cornuet and Luikart 1996). Ultimately, it may be that the largely intertidal nature of both Z. marina var. angustifolia and Z. noltii made them less
123
susceptible than the subtidal broadleaved Z. marina to the effects of the outbreak. There are some reports that the taxa studied here were apparently not as affected by the wasting disease as populations of Z. marina (e.g. Rasmussen 1977), a fact which some have attributed to the fact that the potential for Labyrinthula infection tends to be ameliorated by the relatively low salinities associated with the intertidal habitats occupied by Z. marina var. angustifolia and Z. noltii (Muelhstein et al. 1988, 1991). It would appear from
Conserv Genet Table 3 Between-subpopulation partitioning of genetic diversity in Zostera marina var. angustifolia and Z. noltii Source of variation
df
Variance components
% Variation
P
Z. marina var. angustifolia Between subpopulations
2
0.00965
0.76
Within subpopulations
331
1.26840
99.24
Total
333
1.27805
P = 0.01857
Z. noltii Between subpopulations
2
0.00883
1.90
Within subpopulations
307
0.45561
98.10
Total
309
0.46444
our study that this may indeed be the case and that intertidal species of the genus Zostera may not have been impacted to the extent that was first assumed. There has been some debate concerning the direct causal role of Labyrinthula in the seagrass declines of the 1930s (Rasmussen 1977; Nienhuis 1994; Ralph and Short 2002) but, irrespective of cause, there is no obvious evidence of a genetic bottleneck from the nuclear microsatellite analysis of either species. Although there is no obvious evidence of a genetic bottleneck when biparentally inherited nuclear markers are studied, the analysis of maternally inherited cytoplasmic markers (seven chloroplast microsatellites and two regions of DNA sequence) suggests a severe maternal bottleneck in the evolution of extant eelgrass populations in Strangford Lough. It is unlikely that the lack of observed variation is due to any technical deficiency associated with the resolution of the markers used since the mutation rates associated with mononucleotide repeat loci are usually orders of magnitude higher than substitution rates elsewhere in the chloroplast genome (Provan et al. 1999a, 2001). Furthermore, these markers have revealed intrapopulation genetic variation in other populations of Z. marina (J. Provan et al., unpublished data). Olsen et al. (2004) also reported very low levels of cytoplasmic variation in North Atlantic populations of Z. marina, detecting no variation in the matK intron (422 bp) in Atlantic populations and only four substitutions between Atlantic and Pacific populations. This scenario of very high-nuclear diversity coupled with very low-cytoplasmic diversity has only been reported previously in crop plants, where male-sterility of offspring has led to their use as female parents in successive generations of crosses, thus leading to a cytoplasmic bottleneck (Provan et al. 1999b). In natural populations, since the chloroplast genome is haploid and uniparentally inherited in the vast majority of plant species, the effective population sizes associated with cytoplasmic markers is one quarter the effective population size of that of nuclear markers. Thus, it is possible that a decrease in population numbers would lead to a more pronounced reduction in
P = 0.00684
cytoplasmic diversity than that observed (or not observed in this particular case) for nuclear diversity due to the more pronounced effects of genetic drift in populations of organellar genomes. Another possible explanation for this lack of chloroplast diversity may be a selective sweep, since there is no recombination in the chloroplast genome. Bazin et al. (2006) reported evidence of a reduction in levels of diversity in animal mitochondrial genomes, which also do not undergo recombination, due to the effects of selection, but it is not obvious what genes in the chloroplast genome of Zostera would be a target for selection. Thus, it seems more likely that neutral evolutionary forces (i.e. genetic drift) coupled with the differences in effective population sizes of nuclear and organellar genomes have led to the asymmetrical patterns of diversity observed. Conservation implications Under the EC Habitats Directive, Strangford Lough in Northern Ireland, the site of this study, has been designated a Special Area of Conservation. Furthermore, seagrass beds have been designated as a priority habitat by the UK Biodiversity Habitat Action Plan (UK Biodiversity Group 2001) and have been highlighted as being under threat from climate change (Hossell et al. 2000). Consequently, the information on levels and structuring of genetic diversity generated in this study will be of direct relevance to any potential conservation/remediation projects (Hedrick 2000; Frankham et al. 2002), as has been suggested previously for other threatened Zostera populations (Rhode and Duffy 2004). In the annual, sexually reproducing Zostera marina var. angustifolia, levels of genetic diversity were comparable across the three subpopulations studied and the level of genetic differentiation between subpopulations was low. No significant evidence of clonality was observed. Any private alleles detected in any of the subpopulations were only present at frequencies of less than 2% (data not shown). This suggests that, if necessary, any future restoration work could utilise plant material from anywhere in
123
Conserv Genet
the area since the region is genetically homogeneous. This approach may require some caution and further consideration, though, since previous studies on restored Z. marina populations reported lower reproductive success rates in transplanted beds relative to source populations (Williams and Davis 1996) and highlighted the importance of levels of diversity in source populations (Williams 2001). Nevertheless, a study by Hughes and Stachowicz (2004) confirmed that maximising levels of genetic diversity promoted recovery rates of Z. marina populations subjected to disturbance by grazing geese. In Z. noltii, however, a somewhat different scenario was observed. At four of the five loci studied, the lowest levels of expected heterozygosity were observed in the North End subpopulation, where several clonal genotypes were represented multiple times, whilst the Castle Espie subpopulation displayed the highest levels of average expected heterozygosity. This is most likely due to an increase in seedling recruitment since this area lies at the mouth of the Comber River, one of only two substantial freshwater inflow points to the Lough and the only one at the northern end (see Fig. 1). Although vegetative reproduction generally predominates in Z. noltii, it has been observed that seedling germination is higher at low-salinity levels. Hootsmans et al. (1987) observed maximum recruitment at 10 psu and no recruitment above 30 psu in natural populations. Likewise, under experimental conditions, the highest levels of germination were observed at salinity levels of between 1 and 10 psu with no germination above 20 psu (Hughes et al. 2000). During the period of this study, the majority of the Castle Espie bed was lost due to human-mediated activity (http://news.bbc.co.uk/1/hi/northern_ireland/4148161.stm). Despite the obvious irony of the situation (the Castle Espie population of Z. noltii exhibited the highest average diversity levels), it is likely that the whole area comprising the three subpopulations studied can be considered a single management unit since levels of genetic differentiation between subpopulations are low for both taxa. Consequently, regeneration of this bed from seed may ultimately restore the broad-scale genetic architecture of the eelgrass beds through increased natural seedling recruitment in those areas with higher levels of fresh water. Nevertheless, the episode highlights all too acutely the value of information on levels and patterns of genetic variation as a basis for remedial conservation work. Acknowledgements The authors would like to thank Jim Coyer, Ian Montgomery, Jeanine Olsen and Rob Paxton as well as two anonymous referees for helpful discussions and comments on the manuscript and Jamie Magee for technical assistance. This work was funded under the European Union Building Sustainability Programme.
123
References Allendorf FW (1996) Genetic drift and the loss of alleles versus heterozygosity. Zoo Biol 5:181–190 Bazin E, Gle´min S, Galtier N (2006) Population size does not affect mitochondrial genetic diversity in animals. Science 312:570–572 Beebee T, Rowe G (2001) Application of genetic bottleneck testing to the investigation of amphibian declines: a case study with natterjack toads. Conserv Biol 15:266–270 Cleator B (1993) The status of the genus Zostera in Scottish coastal waters. Scottish Natural Heritage Review No. 22, Edinburgh, UK Collevatti RG, Grattapaglia D, Hay JD (2001) High resolution microsatellite based analysis of the mating system allows the detection of significant biparental inbreeding in Caryocar brasiliense, an endangered tropical tree species. Heredity 86:60–67 Cordrey L (1997) Action for Biodiversity in the South-West. RSPB Cornuet J-M, Luikart G (1996) Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144:2001–2014 Cotton AD (1933) Disappearance of Zostera marina. Nature 132:277 Coyer JA, Reusch TBH, Stam WT, Serra˜o EA, Pearson GA, Procaccini G, Olsen JL (2004a) Characterisation of microsatellite loci in the dwarf eelgrass Zostera noltii (Zosteraceae) and cross-reactivity with Z. japonica. Mol Ecol Notes 4:497–499 Coyer JA, Diekmann OE, Serra˜o EA, Procaccini G, Milchakova N, Pearson GA, Stam WT, Olsen JL (2004b) Population genetics of dwarf eelgrass Zostera noltii throughout its biogeographic range. Mar Ecol Prog Ser 281:51–62 Demesure B, Sodzi N, Petit RJ (1995) A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol Ecol 4:129–131 DeSalle R, Amato G (2004) The expansion of conservation genetics. Nat Rev Genet 5:702–712 Diekmann OE, Coyer JA, Ferreira J, Olsen JL, Stam WT, Pearson GA, Serrao EA (2005) Population genetics of Zostera noltii along the west Iberian coast: consequences of small population size, habitat discontinuity and near-shore currents. Mar Ecol Prog Ser 290:89–96 Duarte CM, Cebria´n J (1996) The fate of marine autotrophic production. Limnol Oceanogr 41:1758–1766 Ennos RA (1994) Estimating the relative rates of pollen and seed migration among plant populations. Heredity 72:250–259 Ennos RA, Sinclair WT, Hu X-S, Langdon A (1999) Using organelle markers to elucidate the history, ecology and evolution of plant populations. In: Hollingsworth PM, Bateman RM, Gornall RJ (eds) Molecular systematics and plant evolution. Taylor and Francis, London, pp 1–19 Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes—application to human mitochondrial DNA restriction data. Genetics 131:479–491 Frankham R (1995) Conservation genetics. Ann Rev Genet 29: 305–327 Frankham R, Ballou JD, Briscoe DA (2002) Introduction to conservation genetics. Cambridge University Press, Cambridge, UK Friar EA, Ladoux T, Roalson EH, Robichaux RH (2000) Microsatellite analysis of a population crash and bottleneck in the Mauna Kea silversword, Argyroxiphium sandwicense ssp. sandwicense and its implications for reintroduction. Mol Ecol 9:2027–2034 Garza JC, Williamson EG (2001) Detection of reduction in population size using data from microsatellite loci. Mol Ecol 10: 305–318
Conserv Genet Goudet J (2001) FSTAT, version 2.9.3. A program to estimate and test gene diversities and fixation indices. http://www2.unil.ch/ popgen/softwares/fstat.htm Haig SM (1998) Molecular contributions to conservation. Ecology 79:413–425 Hammerli A, Reusch TBH (2003) Inbreeding depression influences genet size distribution in a marine angiosperm. Mol Ecol 12:619–629 Hedrick PW, Brussard PF, Allendorf FW, Beardmore JA, Orzack S (1986) Protein variation, fitness and captive propagation. Zoo Biol 5:91–99 Hedrick PW, Miller PS (1992) Conservation genetics: techniques and fundamentals. Ecol Appl 2:30–46 Hedrick PW (2000) Conservation genetics: where are we now? Trends Ecol Evol 16:629–636 Hootsmans MJM, Vermaat JE, Vanvierssen W (1987) Seed-bank development, germination and early seedling survival of 2 seagrass species from the Netherlands—Zostera marina L. and Zostera noltii Hornem. Aquat Bot 28:275–285 Hossell JE, Briggs B, Hepburn IR (2000) Climate change and UK nature conservation: a review of the impact of climate change on UK species and habitat conservation policy. Department of the Environment, Transport and the Regions, London, UK Hughes AR, Stachowicz JJ (2004) Genetic diversity enhances the resistance of a seagrass ecosystem to disturbance. Proc Natl Acad Sci USA 101:8998–9002 Hughes RG, Lloyd D, Ball L, Emson D (2000) The effects of the polychaete Nereis diversicolor on the distribution and transplantation success of Zostera noltii. Helgoland Mar Res 54:129– 136 Huntsman AG (1932) Disease in eelgrass. Progress Report of the Atlantic Biology Station 5 Jones B, Gliddon C (1999) Reproductive biology and genetic structure in Lloydia serotina. Plant Ecol 141:151–161 Lande R (1994) Risk of population extinction from fixation of new deleterious mutations. Evolution 48:1460–1469 Larkum AWD, den Hartog C (1989) Evolution and biogeography of seagrasses. In: Larkum AWD, McComb AJ, Shepherd SA (eds) Biology of Seagrasses, Elsevier, New York, pp 112–156 Ledig FT, Hodgskiss PD, Jacob-Cervantes V (2002) Genetic diversity, mating system, and conservation of a Mexican subalpine relict, Picea mexicana Martinez. Conser Genet 3:113–122 Lee SL, Ng KKS, Saw LG et al (2002) Population genetics of Intsia palembanica (Leguminosae) and genetic conservation of virgin jungle reserves in peninsular Malaysia. Am J Bot 89:447–459 Lewis HF (1932) The eelgrass situation on the Atlantic coast. National Parks Department, Canada Luikart G, Cornuet J-M (1998) Empirical evaluation of a test for identifying recently bottlenecked populations from allele frequency data. Conser Biol 12:228–237 McCauley DE (1995) The use of chloroplast DNA polymorphism in studies of gene flow in plants. Trends Ecol Evol 10:198–202 McRoy CP, Helfferich C (eds) (1977) Seagrass ecosystems: a scientific perspective. Marcel Dekker Inc., New York Muelhstein LK, Porter D, Short FT (1988) Labyrinthula sp. a marine slime mould producing symptoms of wasting disease in eelgrass, Zostera marina. Mar Biol 99:465–472 Muelhstein LK, Porter D, Short FT (1991) Labyrinthula zosterae sp., the causative agent of wasting disease of eelgrass, Zostera marina. Mycologia 83:180–191 Mun˜iz-Salazar R, Talbot SL, Sage GK, Ward DH, Cabello-Pasini A (2005) Population genetic structure of annual and perennial populations of Zostera marina L. along the Pacific coast of Baja California and the Gulf of California. Mol Ecol 14:711–722 Nienhuis PH (1994) Causes of the eelgrass wasting disease: Van der Werff’s changing theories. Aquatic Ecol 28:55–61
Olsen JL, Stam WT, Coyer JA et al (2004) North Atlantic phylogeography and large-scale population differentiation of the seagrass Zostera marina L. Mol Ecol 13:1923–1941 Parks JC, Werth CR (1993) A study of spatial features of clones in a population of bracken fern, Pteridium aquilinum (Dennstaedtiaccae). Am J Bot 80:537–544 Piry A, Luikart G, Cornuet JM (1999) Bottleneck: a computer program for detecting recent reductions in the effective population size using allele frequency data. J Hered 90:502–503 Procaccini G, Mazzella L, Alberte RS, Les DH (1999) Chloroplast tRNALeu (UAA) intron sequences provide phylogenetic resolution on seagrass relationships. Aquat Bot 62:269–283 Provan J, Soranzo N, Wilson NJ, Goldstein DB, Powell W (1999a) A low mutation rate for chloroplast microsatellites. Genetics 153:943–947 Provan J, Powell W, Dewar H et al (1999b) An extreme cytoplasmic bottleneck in the modern European cultivated potato (Solanum tuberosum) is not reflected in decreased levels of nuclear diversity. Proc R Soc London Series B 266:633–639 Provan J, Powell W, Hollingsworth PM (2001) Chloroplast microsatellites: new tools for studies in plant ecology and evolution. Trends Ecol Evol 16:142–147 Ralph PJ, Short FT (2002) Impact of the wasting disease pathogen, Labyrinthula zosterae, on the photobiology of eelgrass Zostera marina. Mar Ecol Prog Ser 226:265–271 Rasmussen E (1977) The wasting disease of eelgrass (Zostera marina) and its effects on environmental factors and fauna.In: McRoy CP, Helfferich C (eds) Seagrass ecosystems—a scientific perspective, Marcel Dekker Inc, New York, pp 1–51 Reusch TBH, Stam WT, Olsen JL (1998) Size and estimated age of genets in eelgrass, Zostera marina, assessed with microsatellite markers. Mar Biol 133:519–525 Reusch TBH, Stam WT, Olsen JL (1999a) Microsatellite loci in eelgrass Zostera marina reveal marker polymorphism within and among populations. Mol Ecol 8:317–321 Reusch TBH, Bostro¨m C, Stam WT, Olsen JL (1999b) An ancient eelgrass clone in the Baltic. Mar Ecol Prog Ser 183:301–304 Reusch TBH (2000) Five microsatellite loci in eelgrass Zostera marina and a test of cross-species amplification in Z. noltii and Z. japonica. Mol Ecol 9:371–373 Reusch TBH, Stam WT, Olsen JL (2000) A microsatellite-based estimation of clonal diversity and population subdivision in Zostera marina, a marine flowering plant. Mol Ecol 9:127–140 Reusch TBH (2001a) New markers—old questions: population genetics of seagrasses. Mar Ecol Prog Ser 211:261–274 Reusch TBH (2001b) Microsatellites reveal high population connectivity in eelgrass (Zostera marina) in two contrasting coastal areas. Limnol Oceanogr 47:78–85 Rhode JM, Duffy JE (2004) Microevolution and genetic structure in Chesapeake Bay eelgrass, Zostera marina. Conser Genet 5: 1–11 Schneider S, Roessli D, Excoffier L (2000) ARLEQUIN, version 2: a software for population genetic data analysis Genetics and Biometry Laboratory. University of Geneva, Switzerland Short FT, Muehlstein LK, Porter D (1987) Eelgrass wasting disease: cause and recurrence of a marine epidemic. Biol Bull 173:557– 562 Taberlet P, Gielly L, Patou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol 17:1105–1109 Telles MPD, Coelho ASG, Chaves LJ, Diniz JAF, Valva FD (2003) Genetic diversity and population structure of Eugenia dysenterica DC. (‘‘cagaiteira’’-Myrtaceae) in Central Brazil: spatial analysis and implications for conservation and management. Conser Genet 4:685–695 Tubbs CR (1995) The meadows in the sea. Br Wildl 6:351–355
123
Conserv Genet UK Biodiversity Group (2001) Sustaining the variety of life: 5 years of the UK Biodiversity Plan. Report of the UK Biodiversity group to the UK Government, the Scottish Executive, The National Assembly for Wales and the Northern Ireland Executive. Department of the Environment, Transport and the Regions Vergeer LHT, Develi A (1997) Phenolic acid in healthy and infected leaves of Zostera marina and their growth-limiting properties towards Labyrinthula zosterae. Aquat Bot 58:65–72
123
Williams SL, Davis CA (1996) Population genetic analyses of transplanted eelgrass (Zostera marina) beds reveal reduced genetic diversity in southern California. Restor Ecol 4:163–180 Williams SL (2001) Reduced genetic diversity in eelgrass transplantations affects both population growth and individual fitness. Ecol Appl 11:1472–1488 Yeh FC, Yang R-C, Boyle T et al (1997) POPGENE, the user-friendly shareware for population genetic analysis. Molecular Biology and Biotechnology Centre, University of Alberta, Canada. http:// www.ualberta.ca/~fyeh/
