The Mitochondrial DNA Mutation - Europe PMC

P1: GCP Journal of Assisted Reproduction and Genetics

pp375-jarg-367303

February 9, 2002

8:21

Style file version Oct. 14, 2000

C 2002) Journal of Assisted Reproduction and Genetics, Vol. 19, No. 2, February 2002 (°

Clinical Assisted Reproduction

The Mitochondrial DNA Mutation (1mtDNA5286 ) in Human Oocytes: Correlation with Age and IVF Outcome1 Vered Yesodi,2 Yuval Yaron,3 Joseph B. Lessing,2 Ami Amit,2 and Dalit Ben-Yosef 2,4

Submitted August 3, 2001; accepted October 8, 2001

Purpose : To evaluate the correlation between the presence of a newly described mitochondrial DNA (mtDNA) mutation (1mtDNA5286 ), patients’ age, and in vitro fertilization (IVF) outcomes. Methods: The presence of 1mtDNA5286 was analyzed by nested-primer PCR in 224 unfertilized oocytes of 81 women undergoing IVF for various reasons. Age, number of oocytes retrieved, fertilization and embryo cleavage, number of embryos transferred, and pregnancy rates were compared between patients with and without a mtDNA mutation in their oocytes. Results: The 23 patients in which 1mtDNA5286 was detected in at least one oocyte were significantly younger than the other 58 with no mutations (30.9 years vs. 33.8 years, respectively, P = 0.03), and had a significantly lower fertilization rate (28.9% vs. 42.1%, respectively, P = 0.01). No other outcome variable was significantly different between the two groups. Conclusion(s): The mtDNA mutation 1mtDNA5286 may serve as a marker of decreased oocyte quality in IVF. KEY WORDS: Fertilization; human oocytes; mitochondrial DNA; mutations.

INTRODUCTION

of mitochondrial DNA (mtDNA) mutations in the oocyte (1,2). The mitochondrial genome is a circular, 16,569 bp, histone-free DNA molecule that is present in one or more copies in every mitochondrion (3,4). Most mitochondrial proteins are encoded by the nuclear genome and are transported to the mitochondria by a complex shuttling system (5). The mitochondrial genome encodes 13 proteins, 2 rRNAs, and 22 tRNAs. All mtDNA-encoded proteins are subunits of the mitochondrial energy-generating pathway, the oxidative phosphorylation system (6). Several human diseases occur as a direct result of mtDNA mutations, among them Leber hereditary optic neuropathy (LHON) and Kearns-Sayre Syndrome (KSS) (7,8). In addition, and consistent with the overall aging process, there is an increase in the rate of accumulation of somatic mtDNA mutations concomitant with a decrease in mitochondrial respiratory function (4,9). Accumulation of mtDNA mutations in a specific tissue is inversely correlated to its replicative

In women, age is the best predictor of success rates in infertility treatments, including in vitro fertilization (IVF) and empirical superovulation. The oocyte is believed to be the major locus of female reproductive aging. Oocytes not only undergo progressive atresia and depletion in numbers, but also manifest diminished quality. The precise mechanism for oocyte senescence has not been elucidated. One of the proposed explanations for this phenomenon is the accumulation

1 2

Presented in part at the SGI 2000; ASRM 2000. Sara Racine IVF Unit, LIS Maternity Hospital, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel. 3 Prenatal Diagnosis Unit, Genetic Institute, Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel. 4 To whom correspondence should be addressed at Sara Racine IVF Unit, LIS Maternity Hospital, Tel Aviv Sourasky Medical Center, 6 Weizmann Street, Tel Aviv 64239, Israel; e-mail: dalitbenyosef@ hotmail.com.

C 2002 Plenum Publishing Corporation 1058-0468/02/0200-0060/0 °

60


pp375-jarg-367303

February 9, 2002

8:21


Mitochondrial DNA Mutation in Human Oocytes

61

potential and directly related to its metabolic state. Indeed, mtDNA mutations are more common in the brain and in striated muscle (7,8,10). More than 150 different types of mtDNA mutations have been identified, among which one of the most frequently observed is a 4977 bp deletion which occurs at a presumed “hot spot” and is called the common deletion or 1mtDNA4977 . This mutation accumulates with age in various human tissues and has been proposed as a marker of natural aging (11–13). While Keefe et al. (1) suggested that 1mtDNA4977 is positively correlated with patients’ age and may, therefore, serve as a marker of oocyte senescence, other studies have failed to confirm this observation (14– 16). Barritt et al. (16) detected 23 different mtDNA rearrangements in 50% of human oocytes and found no age-related change in the presence of mtDNA rearrangements in human oocytes. They did, however, note that the donor age of oocytes with mtDNA rearrangements was significantly lower than the donor age of oocytes without mtDNA rearrangements. Employing the same set of nested-primers that is used to detect 1mtDNA4977 , we now detected a previously undescribed 5286 bp mtDNA deletion (1mtDNA5286 ) in human oocytes. In the current study, we evaluated the correlation between the presence of this newly described deletion with patients’ age and IVF outcome. MATERIALS AND METHODS Subjects All experiments were approved by the local Internal Review Board and met the guidelines for oocyte experimentation as outlined by the American Society of Reproduction Medicine (17). Unfertilized human oocytes were obtained from patients undergoing IVF at the Sara Racine IVF Unit. The population treated by the unit is characterized by 30% having had more than four previous failed IVF cycles, and 27% of the patients are ≥40 years of age. Ovulation induction was achieved by a standard proto-

col of gonadotrophin-releasing hormone analogue (GnRH-a) and human menopausal gonadotrophin (hMG, Pergonal; Teva Pharmaceutical Industries, Israel) as described previously (18). Oocyte retrieval was scheduled to take place 35–36 h after the administration of 10,000 IU human chorionic gonadotrophin (hCG; Chorigon; Teva Pharmaceutical Industries, Israel). The cumulus–oocyte complexes were isolated into P1 medium (Irvine Scientific, California) with 20% Synthetic Serum Substitute (Irvine Scientific, California). Insemination of the retrieved oocytes was performed by standard insemination (IVF) or intracytoplasmic sperm injection (ICSI) according to sperm parameters, and inspection for fertilization was performed 16–20 h later. Embryo cleavage and quality were evaluated on day 3, prior to transfer. Embryo morphology was scored from I to IV according to the shape of the blastomeres and the amount of detached anuclear fragments, as described previously (18). Clinical pregnancies were defined by a sonographic demonstration of a gestational sac. Sample Preparation Unfertilized metaphase II (MII) oocytes which showed no evidence of fertilization (i.e., failure to demonstrate a second polar body and two pronuclei) were washed and collected in phosphate-buffered saline (PBS), frozen in liquid nitrogen, boiled for 10 min to completely lyse the cells, and stored at −20◦ C until use. A total of 224 oocytes, retrieved from 81 patients, were analyzed. Only one or two unfertilized oocytes were available for analysis in 68% of the patients, whereas at least three oocytes were analyzed in 32%. Polymerase Chain Reaction (PCR) Standard PCR Strategy. The presence of mtDNA in single human oocytes was confirmed by standard PCR with the use of primers P4 and P5 for amplifying a fragment outside the deletion area (Table I). The initial denaturation step was performed at 94◦ C for

Table I. mtDNA Primer Sequences Primer set no.

Primer name

1 1 2 2 3 3

P4 P5 V1 H35 V3 V2

Sequence 50 –30

Base pairs

CCTCCCTGTACGAAAGGAC GCGATTAGAATGGGTACAATG CCACAGTTTCATGCCCATCGTCC CTAGGGTAGAATCCGAGTATGTTGGAG GAGAACCAACACCTCTTTACAGTG GTCCTAGGAAAGTGACAGCGAGGG

3116–3134 3333–3353 8194–8216 13928–13902 8340–8363 13805–13828

Forward/reverse Forward Reverse Outer forward Outer reverse Inner forward Inner reverse

Journal of Assisted Reproduction and Genetics, Vol. 19, No. 2, February 2002


pp375-jarg-367303

February 9, 2002

62

8:21


Yesodi, Yaron, Lessing, Amit, and Ben-Yosef

Fig. 1. Diagrammatic representation of the PCR primers and mitochondrial DNA mutations in the human oocyte. Schematic representation of the homologous recombination resulting in either the 1mtDNA4977 or the 1mtDNA5286 in human oocytes. The primer sets V1, H35 and V3, V2 were used in the nested PCR approach, flank the delected 4977 bp fragment. Primers P4, P5 were used in the standard PCR approach to amplify mtDNA outside the deleted region, representing total mtDNA. – Direct repeats at positions 8470–8482 bp and 13447– 13459 bp, responsible for the 1mtDNA4977 . – Direct repeats at positions nt 8393–8412 and nt 13678–13697 responsible for the 1mtDNA5286 .

3 min. This was followed by 30 cycles of denaturation at 94◦ C for 1 min, annealing at 60◦ C for 1 min, elongation at 72◦ C for 1 min, and final extension at 72◦ C for 10 min. Amplification was performed in a final volume of 25 µL containing 50 pmol of each primer, 200 µM of each dNTP, and 2.5 U Taq polymerase. The resulting amplified fragment was 237 bp long (Table I). Nested-Primer PCR Strategy. A nested-primer PCR technique was used to detect the presence of 1mtDNA4977 and 1mtDNA5286 in human oocytes (Fig. 1). The first step, outer PCR reaction, employed primers V1 and H35 (Table I). PCR conditions were as follows: initial denaturation step at 94◦ C for 3 min, followed by 30 cycles of denaturation at 94◦ C for 1 min, annealing at 60◦ C for 1 min, elongation at 72◦ C for 1 min, and final extension at 72◦ C for 10 min. The amplification was performed in a final volume of 25 µL containing 50 pmol of each primer (Gibco-BRL), 200 µM of each dNTP, and 2.5 U Taq polymerase (TaKaRa cat # TKR001A), using an MJ Thermocycler. For the nested PCR, amplification was performed for 30 cycles using the same conditions as for the outer PCR with the inner primers V3 and V2 (Table I). Precautions were taken to prevent contamination, and all experiments included buffer-only negative controls. Nested PCR products were separated on 10% polyacrylamide gel stained with ethidium bromide. The 1mtDNA4977 approximates the primerannealing sites such that the expected final PCR product is 511 bp long and similarly, the 1mtDNA5286

results in a PCR product that is 200 bp long. Under the above-mentioned conditions, these sets of primers will not amplify across the whole nondeleted 5.5 kb region. However, even if such an amplification does occur, the resulting fragment will easily be distinguished from that of the deleted mtDNA. DNA Sequencing Analysis For direct sequencing, PCR products were purified by a DNA purification kit (Wizard PCR Preps, Promega). Sequencing analysis was carried out by using the ABI PRISM dye terminator cycle sequencing ready reaction kit (PE Applied Biosystems). An ABI 310 DNA sequencer performed the automated sequencing (PE Applied Biosystems). Statistical Analysis Patients were divided into two groups: the 1mtDNA5286 positive group included all patients in whom the mutation was detected in at least one unfertilized oocyte and the 1mtDNA5286 negative group included patients without this mutation in any of their oocytes. Statistical analysis was performed using the nonparametric Kruskal–Wallis one-way ANOVA test for comparing age, number of retrieved oocytes, fertilization and embryo cleavage, embryo quality, and the number of embryos transferred. The χ 2 analysis was used to compare pregnancy and implantation rates. A P value of 0.05). d χ 2 test: nonsignificant difference between the two groups (P > 0.05).

a

33.8 ± 0.7 years, respectively, P = 0.03). In addition, fertilization rate was significantly lower in the 1mtDNA5286 positive group (28.9% ± 4.8% compared to 42.1% ± 3.0% in the 1mtDNA5286 negative group; P = 0.01) (Table II). No other outcome variable was significantly different between the two groups. In comparison, 1mtDNA4977 was found in 143 (64%) of the 224 oocytes analyzed. In 66 patients, this deletion was detected in at least one oocyte, while none were found in any of the oocytes in the remaining 15 patients. When comparing patients with or without 1mtDNA4977 in their oocytes, no statistically significant difference was noted in the patients’ age (32.9 ± 0.7 years versus 33.1 ± 1.5 years, respectively, P = 0.19) or any of the IVF outcome variables, including fertilization rate (37.2% ± 3.0% vs. 43.4% ± 5.5%, respectively, P = 0.26), embryo quality, and clinical pregnancy rates. DISCUSSION Women experience a decline in their reproductive potential with age. This trend culminates in a com-

plete loss of fertility by midlife, despite the fact that oocytes may still be present within the ovary. This age-related decline in fertility has been attributed to oocyte senescence. However, it is yet unclear what biochemical or molecular processes underlie this phenomenon. mtDNA mutations accumulate with age, especially in nondividing tissues. It is therefore tempting to speculate that oocyte senescence is the result of an age-related accumulation of mtDNA mutations causing respiratory dysfunction and thereby disturbing proper occyte maturation (1). This is due to the fact that meiosis involves tightly choreographed movements of chromosomes and organelles, a high energy-requiring process in which mitochondria have been shown to play an important role (19–21). To test this hypothesis, Keefe et al. analyzed the correlation between age and the presence of 1mtDNA4977 in unfertilized oocytes from women undergoing IVF (1). They found a significantly higher rate of oocytes with 1mtDNA4977 in women >38 years of age compared to younger ones. Subsequent studies, however, found no direct relationship between age and the presence of 1mtDNA4977 in human oocytes and embryos (14,15). Our results concur with those of Chen et al. (14), Brenner et al. (15), and Barritt et al. (16) in that no correlation was found between the 1mtDNA4977 in oocytes, patients’ age, and IVF outcome. It may, therefore, be contended that 1mtDNA4977 is not a marker of oocyte senescence. There is, however, a significantly higher proportion of oocytes harboring 1mtDNA4977 compared to embryos (47 and 20%, respectively [15]). Those authors suggested that with embryo development, a mitochondrial “bottleneck” filters out the mutated mtDNA, thus eliminating the sporadic mutations that accumulate in oocytes during oogenesis. Alternatively, it was speculated that oocytes harboring the mtDNA mutation are less likely to develop into embryos (15,16,22,23). The newly described 1mtDNA5286 was detected fortuitously with the same primer set that had been used to detect 1mtDNA4977 . The 1mtDNA5286 was found in only 16% of unfertilized oocytes, raising the question of why the 1mtDNA5286 is less frequent than 1mtDNA4977 . Although the regions of homology responsible for the 1mtDNA5286 span 20 bp, they share only 80% homology, whereas the repeats responsible for 1mtDNA4977 , albeit shorter in length (13 bp), share 100% homology throughout their length. For that reason, a homologous recombination resulting in 1mtDNA5286 is less likely to occur. As for why the 1mtDNA5286 had not been previously detected, the answer lies in the fact that previous



pp375-jarg-367303

February 9, 2002

8:21


Mitochondrial DNA Mutation in Human Oocytes studies used either a hemi-nested PCR approach or a long-range PCR, followed by a second round PCR for the detection of 1mtDNA4977 (14,15). In contrast, we used a nested-primer PCR strategy which is more sensitive as manifested by the higher rate of 1mtDNA4977 in our study (64%) compared to others (33–49%) (1,14,15). Moreover, previous studies used agarose gel electrophoresis whereas we used acrylamide gel, which may have also improved the detection threshold. There is an age-related accumulation of mtDNA mutations in human tissues, but there is insufficient evidence to suggest that this occurs in human oocytes. Herein, we demonstrate that women harboring the 1mtDNA5286 in their oocytes were significantly younger than those in whom this mutation was not detected (30.9 ± 0.9 years and 33.8 ± 0.7 years, respectively, P < 0.05). The same phenomenon was also observed for other mtDNA rearrangements (16). What effect can the presence of infrequent mtDNA mutations have on oocyte respiratory function? Previous studies estimated that the frequency of 1mtDNA4977 in oocytes in only 0.01–0.1%. Given that the estimated number of mitochondrial genomes in an oocyte is ∼100,000, it is thus estimated that each oocyte contains ∼10 to 100 1mtDNA4977 copies (14). The frequency of 1mtDNA5286 and other mutations may be even lower. Hence, the overall frequency of such mtDNA mutations is probably too low to result in any degree of respiratory dysfunction. Instead, we suggest that the presence of such infrequent mtDNA mutations may serve as a marker, and not the cause, of decreased oocyte function. A decline in oocyte quality, as manifested by a decreased fertilization rate, is often referred to as the “egg factor,” and is commonly associated with patients’ age (24,25). Occassionally, however, younger women may also demonstrate a reduced fertilization rate that is attributed to the “egg factor.” The fact that the 1mtDNA5286 was more frequent in unfertilized oocytes from younger women led us to hypothesize that this mutation may be a marker for an “egg factor” that is not age-related. This hypothesis may be supported by the fact that patients who have the 1mtDNA5286 in their unfertilized oocytes had a significantly lower fertilization rate than those who did not (28.9% vs. 42.1%). The caveat to this statement is that the analysis was performed on unfertilized oocytes, and it is not known whether the findings can be generalized to the embryos transferred into patients. We, as others, have not been able to examine the muta-

65 tion in all MII oocytes because of ethical constraints. The common assumption is that unfertilized oocytes represent, at least in part, the status of the overall oocyte population. It should be stressed that 30% of the women treated by the unit had had more than four previous failed IVF cycles and that 27% of them were ≥40 years of age. Nevertheless, during the study period, the overall clinical pregnancy rate per cycle was 24% and the take home baby rate was 17%. However, insofar as only oocytes that failed to fertilize in IVF were analyzed for the presence of the 1mtDNA, this selected group of patients demonstrated lower than our usual fertilization rates and, as a consequence, lower pregnancy rates. Another issue that requires further investigation is the precise quantification of 1mtDNA5286 in single human oocytes. However, the nested PCR approach used in this study is qualitative rather than quantitative; thus, the threshold above which the mutation will have an impact upon oocyte metabolism awaits further investigation. The findings of the present study suggest that the presence of the novel 1mtDNA5286 may serve as a non-age-related marker for decreased oocyte quality in IVF. It could, therefore, predict fertilization failure and provide a potential indicator of failure rate in IVF.

ACKNOWLEDGMENTS The authors gratefully acknowledge the efforts of the team of embryologists at the Racine IVF Unit, T. Moldavsky, M. Ben-Haim, A. Carmon, N. Mei-Raz, and T. Shwartz, for their support of this study. We thank Y. Villa, PhD, for the expert statistical analysis and E. Eshkol for editorial assistance in the preparation of this manuscript.

REFERENCES 1. Keefe DL, Niven-Fairchild T, Powell S, Buradagunta S: Mitochondrial deoxyribonucleic acid deletions in oocytes and reproductive aging in women. Fertil Steril 1995;64:577–583 2. Cummins J: Mitochondrial DNA in mammalian reproduction. Rev Reprod 1998;3:172–182 3. Clayton DA: Nuclear-mitochondrial intergenomic communication. Biofactors 1998;7:203–205 4. Wallace DC: Mitochondrial diseases in man and mouse. Science 1999;283:1482–1488 5. Schatz G, Dobberstein B: Common principles of protein translocation across membranes. Science 1996;271:1519–1526 6. Saraste M: Oxidative phosphorylation at the fin de siecle. Science 1999;283:1488–1493



pp375-jarg-367303

February 9, 2002

66

8:21


Yesodi, Yaron, Lessing, Amit, and Ben-Yosef

7. Schon EA, Bonilla E, Di Mauro S: Mitochondrial DNA mutations and pathogenesis. J Bioenerg Biomembr 1997;29:131–149 8. Ozawa T: Genetic and functional changes in mitochondria associated with aging. Physiol Rev 1997;77:425–464 9. Beckman KB, Ames BN: Mitochondrial aging: Open questions. Ann NY Acad Sci 1998;854:18–27 10. Grossman LI, Shoubridge EA: Mitochondrial genetics and human disease. Bioessays 1996;18:983–991 11. Meissner C, von Wurmb N, Oehmichen M: Detection of the age-dependent 4977 bp deletion of mitochondrial DNA. A pilot study. Int J Legal Med 1997;110:288–291 12. Meissner C, von Wurmb N: Sensitive detection of the 4977-bp deletion in human mitochondrial DNA of young individuals. Biotechniques 1998;25:652–654 13. Von Wurmb N, Oehmichen M, Meissner C: Demonstration of the 4977 bp deletion in human mitochondrial DNA from intravital and postmortem blood. Mutat Res 1998;422:247– 254 14. Chen X, Prosser R, Simonetti S, Sadlock J, Jagiello G, Schon EA: Rearranged mitochondrial genomes are present in human oocytes. Am J Hum Genet 1995;57:239–247 15. Brenner CA, Wolny YM, Barritt JA, Matt DW, Munne S, Cohen J: Mitochondrial DNA deletion in human oocytes and embryos. Mol Hum Reprod 1998;4:887–892 16. Barritt JA, Brenner CA, Cohen J, Matt DW: Mitochondrial DNA rearrangements in human oocytes and embryos. Mol Hum Reprod 1999;5:927–933

17. American Fertility Society: Ethics and the new reproductive technologies. Fertil Steril 1990;53(Suppl 2):17S–22S 18. Ben-Yosef D, Yogev L, Hauser R, Yavetz H, Azem F, Yovel I, Lessing JB, Amit A: Testicular sperm retrieval and cryopreservation prior to initiating ovarian stimulation as the first line approach in patients with non-obstructive azoospermia. Hum Reprod 1999;14:1794–1801 19. Nogawa T, Sung WK, Jagiello GM, Bowne W: A quantitative analysis of mitochondria during fetal mouse oogenesis. J Morphol 1988;195:225–234 20. Van Blerkom J: Microtubule mediation of cytoplasmic and nuclear maturation during the early stages of resumed meiosis in cultured mouse oocytes. Proc Natl Acad Sci 1991;88:5031–5035 21. Calarco PG: Polarization of mitochondria in the unfertilized mouse oocyte. Dev Genet 1995;16:36–43 22. Jansen RPS, de Boer K: The bottleneck: Mitochondrial imperatives in oogenesis and ovarian follicular fate. Mol Cell Endocrinol 1998;145:81–88 23. Marchington DR, Macaulay V, Hartshorne GM, Barlow D, Poulton J: Evidence from human oocytes for a genetic bottleneck in an mtDNA disease. Am J Hum Genet 1998;63:769–775 24. Nasseri A, Grifo JA: Genetics, age, and infertility. Maturitas 1998;12:189–192 25. Tomas C, Orava M, Tuomivaara L, Martikainen H: Low pregnancy rate is achieved in patients treated with intracytoplasmic sperm injection due to previous low or failed fertilization in in-vitro fertilization. Hum Reprod 1998;13:65–70
