The transcription factor AtDOF4.2 regulates shoot branching and seed ...

Biochem. J. (2013) 449, 373–388 (Printed in Great Britain)

373

doi:10.1042/BJ20110060

The transcription factor AtDOF4.2 regulates shoot branching and seed coat formation in Arabidopsis Hong-Feng ZOU1 , Yu-Qin ZHANG1 , Wei WEI, Hao-Wei CHEN, Qing-Xin SONG, Yun-Feng LIU, Ming-Yu ZHAO, Fang WANG, Bao-Cai ZHANG, Qing LIN, Wan-Ke ZHANG, Biao MA, Yi-Hua ZHOU, Jin-Song ZHANG2 and Shou-Yi CHEN2 State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

Plant-specific DOF (DNA-binding with one finger)-type transcription factors regulate various biological processes. In the present study we characterized a silique-abundant gene AtDOF (Arabidopsis thaliana DOF) 4.2 for its functions in Arabidopsis. AtDOF4.2 is localized in the nuclear region and has transcriptional activation activity in both yeast and plant protoplast assays. The T-M-D motif in AtDOF4.2 is essential for its activation. AtDOF4.2-overexpressing plants exhibit an increased branching phenotype and mutation of the T-M-D motif in AtDOF4.2 significantly reduces branching in transgenic plants. AtDOF4.2 may achieve this function through the up-regulation of three branching-related genes, AtSTM (A. thaliana SHOOT MERISTEMLESS), AtTFL1 (A. thaliana TERMINAL FLOWER1) and AtCYP83B1 (A. thaliana CYTOCHROME P450 83B1). The seeds of an AtDOF4.2-overexpressing plant show a collapse-like

morphology in the epidermal cells of the seed coat. The mucilage contents and the concentration and composition of mucilage monosaccharides are significantly changed in the seed coat of transgenic plants. AtDOF4.2 may exert its effects on the seed epidermis through the direct binding and activation of the cell wall loosening-related gene AtEXPA9 (A. thaliana EXPANSINA9). The dof4.2 mutant did not exhibit changes in branching or its seed coat; however, the silique length and seed yield were increased. AtDOF4.4, which is a close homologue of AtDOF4.2, also promotes shoot branching and affects silique size and seed yield. Manipulation of these genes should have a practical use in the improvement of agronomic traits in important crops.

INTRODUCTION

vulgare), HvSAD (H. vulgare scutellum and aleurone-expressed DOF), HvDOF17 and HvDOF19 control seed germination by affecting the expression of different aleurone hydrolase genes [7–9]. DOF proteins from Arabidopsis have been found to be mediators of many biological processes, including the light response [10], flowering [11], plant growth [12,13], hormone response [14,15], cell-cycle regulation [16], secondary metabolism [17], interfascicular cambium formation and vascular tissue development [18], and seed germination [15,19]. In addition, DOF transcription factors also control other biological processes, such as ammonium assimilation [20], carbohydrate metabolism [21] and fatty acid synthesis [22]. Shoot branching is one of the most important processes during plant growth and development and has a direct relationship with plant biomass and crop yield. Various architectures found in plants are primarily defined by the degree of shoot branching [23,24]. Shoot branching is determined by environmental factors, hormones, developmental signals and genetic factors [25–27]. Mutants with abnormal patterns of shoot branching have been identified in several species, including rice, maize, Arabidopsis, peas and tomatoes [28]. Genes underlying these mutants are classified into three groups according to the stage of meristem development they affect [28,29]. The first group, including PIN1 (PINFORMED1), PID (PINOID), YUC (YUCCA)/SPI1 (SPARSE INFLORESCENCE1), LAX (LAX PANICLE)/BA1

DOF (DNA-binding with one finger) proteins are a group of plantspecific transcription factors. A typical DOF protein consists of a conserved N-terminal DNA BD (binding domain), a divergent C-terminal end for transcriptional regulation and the conjunctive sequences with a possible NLS (nuclear localization sequence) [1]. The N-terminal DNA BD can both interact with other proteins and bind to DNA sequences harbouring an AAAG core motif [2,3]. Unlike other transcription factors such as MYB, WRKY and GT, which may have several DNA BDs, DOF proteins have a single conserved zinc finger DNA BD (DOF domain) in their N-terminal region [1]. The C-terminal end is the variable region that contains the transcriptional regulatory element. The 48 amino acids located in the C-terminus of ZmDOF (Zea mays DOF) 1 have been shown to be responsible for the transactivation activity of the protein. Divergent C-terminal domains may reflect various functions of different DOF proteins [4,5]. Plenty of DOF proteins have been found to participate in different biological processes in several plant species since the first DOF protein ZmDOF1 was determined to be a regulator for the light response in maize [2]. Another two maize DOF proteins, ZmDOF2 and ZmPBF [Z. mays PBF (prolamin boxbinding factor)], are involved in the light response and seed germination respectively [4,6]. In barley, HvPBF (Hordeum

Key words: Arabidopsis, AtDOF4.2, AtDOF4.4, seed trait, shoot branching, transcription factor.

Abbreviations used: AtEXPA9, Arabidopsis thaliana EXPANSIN-A9; BD, binding domain; CaMV, Cauliflower mosaic virus; CYP83B1, CYTOCHROME P450 83B1; AtCYP83B1, A . thaliana CYP83B1; DOF, DNA-binding with one finger; AtDOF, A. thaliana DOF; AtEXP9, A . thaliana EXPANSIN-A9; GAL4, yeast transcription activator Gal4; GFP, green fluorescent protein; GmDOF, Glycine max DOF; LEA, LATE EMBRYOGENESIS ABUNDANT; LEC, LEAFY COTYLEDON; LUC, luciferase; NLS, nuclear localization sequence; PBF, prolamin box-binding factor; Rha, rhamnose; RNAi, RNA interference; RT, realtime; SD/ − His, synthetic defined, histidine dropout; STM, SHOOT MERISTEMLESS; AtSTM, A . thaliana STM; TFL1, TERMINAL FLOWER1; AtTFL1, A . thaliana TFL1; ZmDOF, Zea mays DOF. 1 These authors contributed equally to this work. 2 Correspondence may be addressed to either of these authors (email [email protected] or [email protected]). The microarray data has been deposited into the GEO database under the accession number GSE41682. c The Authors Journal compilation c 2013 Biochemical Society

374

H.-F. Zou and others

(BARREN STALK1), MOC1 (MONOCULM1)/SPA (SMALL PANICLE)/LAS/LS (LATERAL SUPPRESSOR), STM (SHOOT MERISTEMLESS), CUC (CUP-SHAPED COTYLEDON), REV (REVOLUTA), TFL1 (TERMINAL FLOWER1) and RAX (REGULATOR OF AXILLARY MERISTEMS)/BL (BLIND), affects meristem initiation [30–33]. The second group, including MAX (MORE AXILLARY GROWTH), RMS (RAMOSUS), DAD (DECREASED APICAL DOMINANCE), TIL1 (TILLING1), CYP83B1 (CYTOCHROME P450 83B1) and BRC1 (BRANCHED1), affects meristem outgrowth [34– 36]. The third group, including SPS (SUPERSHOOT)/ BUS (BUSHY) and TB1 (TEOSINTE BRANCHED1), affects both meristem initiation and meristem outgrowth [37,38]. However, overexpression of some of these genes led to opposite branching phenotypes compared with their mutants [34]. Different types of transcription factors have been shown to regulate shoot branching [33,39]. AtDOF (Arabidopsis thaliana DOF) 4.2 has also been reported to enhance branching; however, repression of this gene through RNAi (RNA interference) did not affect branching [17]. Seed and silique development is a key process in the lifecycle of higher plants and is controlled by multiple factors [40]. In Arabidopsis, four master regulators have been identified that play roles in seed maturation. These include ABI3, FUS3, LEC (LEAFY COTYLEDON) 2 and LEC1 [40]. The ABI3 regulon has recently been further explored [41]. Le et al. [42] also found seed-specific genes, including transcription factor genes from Arabidopsis. Gene profiling analysis revealed many genes involved in seed development in legumes [43]. The plant hormone ethylene also participates in seed/silique development [44,45]. In addition, miRNAs and DNA methylation may regulate seed development [46,47]. Previously, we found that the soybean genes GmDOF (Glycine max DOF) 4 and GmDOF11 enhanced fatty acid biosynthesis and thousand-seed mass in transgenic Arabidopsis plants [22]. In the present paper we report functional characterization of a siliqueabundant gene AtDOF4.2, which belongs to the Arabidopsis DOF transcription factor family. Transgenic plants overexpressing AtDOF4.2 exhibit an obvious change in shoot branching patterns. The epidermal structure of transgenic seeds was severely affected. The roles of AtDOF4.2 may be achieved through the regulation of AtSTM (A. thaliana STM), AtTFL1 (A. thaliana TFL1) and AtCYP83B1 (A. thaliana CYP83B1) for branching and the alteration of AtEXPA9 (A. thaliana EXPANSIN-A9) for the seed phenotype. The subcellular localization, DNA-binding specificity and motifs for transactivation of AtDOF4.2 were also investigated. A close homologue, AtDOF4.4, also had major roles in shoot branching and seed/silique development. These analyses uncover new roles of the DOF protein in shoot branching and seed formation.

EXPERIMENTAL Plant material and growth conditions

A. thaliana (ecotype Columbia-0, Col-0) was used. A T-DNA insertion mutant dof4.2 (CS813276) was ordered from the Arabidopsis Biological Resource Center. All Arabidopsis lines were grown in a growth chamber at 22 ◦ C with a photoperiod of 16 h/8 h (light/dark) per day.

RNA isolation and gene expression analysis

The roots, stems, leaves, flowers and siliques of 5-week-old Arabidopsis were harvested for RNA isolation using RNAPlant c The Authors Journal compilation c 2013 Biochemical Society

kit for siliques and Trizol reagent (Tiangen Biotech) for other organs. First-strand cDNA was produced using TIANScript RT kit (Tiangen Biotech) and subjected to RT (real-time)PCR analysis with specific primers (Supplementary Table S1 at http://www.biochemj.org/bj/449/bj4490373add.htm). The Arabidopsis ACTIN gene was amplified as a control. The cDNAs produced above were also used for RT quantitative PCR. RT-PCR was performed with a MJ PTC-200 Peltier Thermal Cycler using RealMasterMix kit (SYBR Green, Tiangen Biotech) according to the manufacturer’s protocol. The PCR mixtures were preheated at 95 ◦ C for 2 min, followed by 40 cycles of amplification (95 ◦ C for 10 s, 50–60 ◦ C for 30 s and 68 ◦ C for 30 s). The RT-PCR results were analysed using Opticon MonitorTM analysis software 3.1 (Bio-Rad Laboratories). Subcellular localization of AtDOF proteins in protoplasts and onion epidermal cells

Normal or mutated AtDOF4.2 sequences were cloned into the GFP221 vector to construct a fusion plasmid using specific primers containing BamHI and SalI sites. Mutations were made using a primer-directed site-specific mutagenesis method. A GFP221 plasmid containing a 35S-driven GFP (green fluorescent protein) gene was used as a control. The fusion construct or control plasmid was then introduced into Arabidopsis protoplasts or onion epidermal cells by particle bombardment. Transfected cells were observed under a Leica TCS SP5 microscope. Gel-shift analysis of AtDOF4.2 and AtDOF4.3

The coding sequences for AtDOF4.2 and AtDOF4.3 were cloned into a BamHI/SalI-digested pGEX-6P-1 vector to generate expression plasmids for GST–AtDOF fusion proteins. The fusion proteins were expressed in Escherichia coli strain BL21 cells and purified by glutathione 4B chromatography. The elements used in this experiment are listed in Figures 1(D) and 9(B). Two complementary single-stranded oligonucleotides were annealed in 50 mM NaCl, heated at 70 ◦ C for 5 min and then cooled slowly to room temperature (25 ◦ C). Each annealed element was labelled with [γ -32 P]ATP (∼ 110 TBq/mmol, Amersham) using T4 polynucleotide kinase (Takara) and used as a probe. The competitive experiment was performed by adding an excess of 50× unlabelled probes in addition to the 32 P-labelled probes. Transactivation analysis in yeast cells and Arabidopsis protoplasts

A yeast strain (YRG2) containing the HIS3 (imidazoleglycerolphosphate dehydratase) and LacZ reporter genes was used to analyse transactivation of AtDOF4.2, AtDOF4.3 and AtDOF4.4. Genes were cloned into the DNA BD vector pBD. pBD-AtDOF vectors were introduced into YRG2 cells and the pBD and GAL vectors were used as negative and positive control respectively. The transactivation activity of these proteins were evaluated according to the growth on SD/ − His (synthetic defined, histidine dropout) plates or the activity of β-galactosidase. The transactivation activity was also examined in the Arabidopsis protoplast system. The reporter was a plasmid harbouring firefly LUC (luciferase) gene which was controlled by a modified 35S promoter with 5× the UAS (upstream activating sequence) in it. AtDOF genes were fused to the GAL4 (yeast transcription activator Gal4) DNA BD-coding sequence and constructed into pRT107 to generate effector plasmid pRTBD-AtDOFs. The fusion genes were under the control of 35S promoter. pRT107 vector containing the BD sequence and the

AtDOF4.2 affects branching and seed coat phenotype

BD-VP16 fusion sequence were used as negative and positive control respectively. A pPTRL plasmid that contained a CaMV (Cauliflower mosaic virus) 35S promoter and Renilla LUC, was used as an internal control [48].

375

by RT-PCR analysis using independently isolated RNA samples. The chip data has been deposited into the GEO database under the accession number of GSE41682. Statistical analysis

Generation of transgenic plants

The full-length coding regions of AtDOF4.2, a mutated AtDOF4.2 named AtDOF4.2m and AtDOF4.4 were cloned into the pBIN438 vector by the BamHI/KpnI sites. The expression plasmids were transfected into agrobacterium GV3101 and then transformed into Arabidopsis plants (Col-0) using the floral dip method. Expression of the transgene was examined by RT quantitative PCR or Northern blotting. For inhibition of AtDOF4.4 expression, a 630-bp fragment of AtDOF4.4 was amplified with the primers 5 -gcTCTAGAGAGCTCatggataacttgaatgttttcgct-3 and 5 -acgcGTCGACGGTACCtgattcatgttcatagcgtggttg-3 (upper case letters signify the restriction enzyme sites) and inserted into the pZH01 vector in an inversely oriented manner to generate the RNAi construct. The construct was transfected into GV3101 cells and then transformed into Col-0 or dof4.2 mutant. The lines with no or very low expression of the AtDOF4.4 were selected for analysis. Scanning electron microscopy

For scanning electron microscopy matured Arabidopsis seeds were harvested and dried thoroughly. The seeds were sputtercoated with gold and further visualized using a Hitachi S-3000N scanning electron microscope. Ruthenium Red staining of seed mucilage

Matured seeds were placed in small tubes and shaken in 1 ml 0.01 % Ruthenium Red for 15 min on an orbital shaker with sufficient speed to keep seeds suspended in liquid. Seeds were viewed under a dissection microscope for phenotypic analysis. Extraction of seed mucilage and determination of soluble monosaccharides

Extraction of seed mucilage was performed as follows. Dry seeds (50 mg) were ground and incubated in 0.2 % ammonium oxalate with vigorous shaking for 2 h at 30 ◦ C; insoluble material was removed by centrifugation (15 000 g for 1 min at 25 ◦ C), and the supernatant was precipitated with 5 vol. of ethanol for 3 h. To determine the soluble polysaccharides, 20 μg of myo-inositol was added to the precipitated materials as an inner standard, before they were hydrolysed with 2 M trifluoroacetic acid for 90 min at 121 ◦ C. After centrifugation (15 000 g for 1 min at 25 ◦ C), 10 mg/ml of NaBH4 was added to the supernatant to reduce for 90 min at 4.4 ◦ C, and the reduction reaction was stopped by adding 0.2 ml of acetic acid. The solution was evaporated under a stream of nitrogen. Derivatization to alditol acetates was performed as described by Gibeaut and Carpita [49]. The monosaccharide was determined by GC-MS (Agilent 7890A/5975C). Microarray analysis

Seedlings (2-week-old, aerial part) of Col-0 and AtDOF4.4overexpressing transgenic lines 4.4-1 and 4.4-5 were used for extraction of total RNA and subjected to chip analysis using Agilent Arabidopsis Oligo Microarray (4×44K; ShanghaiBio). Genes with at least a 10-fold expression difference in both the 4.4-1 and 4.4-5 lines above the Col-0 line were further examined

A LSD-t (least significant difference) test of ANOVA was performed to determine the significant differences between sample values using SPSS 11.5. RESULTS

AtDOF4.2 gene expression and protein subcellular localization

Previously, we have demonstrated that GmDOF4 and GmDOF11 from soybeans regulate the biosynthesis of fatty acids and enhance the thousand-seed weight in transgenic Arabidopsis seeds [22]. We further determined whether any DOF genes in Arabidopsis will affect seed-related traits or other processes. A total of 36 DOF genes have been identified in the Arabidopsis genome [1]. Expression of these genes was examined (Supplementary Figure S1 at http://www.biochemj.org/bj/449/bj4490373add.htm) and AtDOF4.2 (TAIR locus At4g21030) was found to be expressed in siliques, but not or only weakly expressed in other organs that were tested (Figure 1A). This gene was further investigated. Previous cluster analysis has revealed that AtDOF4.2 was grouped with AtDOF4.4 (TAIR locus At4g21050), AtDOF4.3 (TAIR locus At4g21040) and AtDOF4.5 (TAIR locus At4g21080) [1], suggesting a close relationship among these proteins. AtDOF4.3, AtDOF4.4 and AtDOF4.5 were also mainly expressed in siliques (Supplementary Figure S1). To localize AtDOF4.2 at the subcellular level, the AtDOF4.2– GFP fusion gene construct and the GFP control plasmid, both driven by the CaMV 35S promoter, were transformed into Arabidopsis protoplasts and onion epidermal cells. Figures 1(B) and 1(C) show that the AtDOF4.2-GFP protein was localized in the nuclei of protoplasts and onion epidermal cells, whereas GFP control was present in both the nuclei and cytoplasm of these cells. We further analysed a putative NLS that usually contains basic amino acids. The protein localization did not change for the K72G or K77G mutants (results not shown). However, the K100G plus K101G mutant of AtDOF4.2Mut–GFP changed localization patterns and green fluorescence was detected in both the nucleus and cytoplasm (Figures 1B and 1C). These results indicate that AtDOF4.2 is a nuclear protein and that K100 plus K101 play important roles in nuclear localization. DNA-binding specificity of AtDOF4.2

Most DOFs bind to the AAAG core motif [1,2]. We investigated whether AtDOF4.2 and AtDOF4.3 can bind to the AAAG motif. Eight double-stranded DNA elements named E1 to E8, each with four tandem repeats of AAAAGT or its mutations, were used in the binding experiments (Figure 1D). Both AtDOF4.2 and AtDOF4.3 can bind to elements E1–E4, which harbour AAAG core sequences, and the addition of non-labelled probes (competitors) significantly reduced the DNA-binding ability, suggesting that both DOF proteins specifically bind to the AAAG core motif (Figure 1D). Nucleotide changes upstream of the core sequence in E1–E4 caused some variations in the binding affinity of AtDOF4.2 and AtDOF4.3, and AtDOF4.2 preferred A or C, whereas AtDOF4.3 preferred A or T at this position (Figure 1D). Substitutions in the core motif in E5–E8 completely abolished the binding activities of both proteins. In addition, the binding c The Authors Journal compilation c 2013 Biochemical Society

376


that AtDOF4.2 and AtDOF4.3 have specific binding affinity for the AAAG element.

Transcriptional activation ability of AtDOF4.2

Figure 1 Gene expression, protein localization and DNA-binding of AtDOF4.2 (A) AtDOF4.2 expression in different organs of Arabidopsis revealed by RT-PCR. Actin was amplified as a control. (B) Subcellular localization of AtDOF4.2-GFP in Arabidopsis protoplasts. Green fluorescence indicates the location of GFP control or GFP fusion proteins. Red fluorescence indicates the positions of chloroplasts. AtDOF4.2Mut has mutations (K100G and K101G) that led to altered distribution. Scale bar, 10 μm. (C) Subcellular localization of AtDOF4.2–GFP in onion epidermal cells. Scale bar, 20 μm. Other indications are as in (B). (D) Gel-shift analysis of AtDOF4.2 and AtDOF4.3. AtDOF4.2 and AtDOF4.3 were incubated with labelled probes (E1–E8) in the presence or absence of an excess of 50× unlabelled probes (competitor). Arrows indicate protein–DNA complexes.

affinity for the AAAG core motif was substantially weaker in AtDOF4.2 than in AtDOF4.3 (Figure 1D). These results indicate c The Authors Journal compilation c 2013 Biochemical Society

The transcriptional activation abilities of AtDOFs were investigated using a yeast assay system. Coding regions of AtDOF genes were cloned into the pBD-GAL4 vector to generate pBDAtDOF, and the fusion plasmids were transformed into yeast strain YRG-2. The growth of transformants containing pBDAtDOF4.2 on selective medium (SD/ − His) and blue staining in an X-gal (5-bromo-4-chloroindol-3-yl β-D-galactopyranoside) assay indicate that the protein has transcriptional activation ability (Figure 2A). AtDOF4.4 also had transcriptional activation activity, whereas AtDOF4.3 did not have this ability (Figure 2A). Similar results were obtained when transcriptional activation was examined in the Arabidopsis protoplast system (Figure 2B). We examined the subdomain or motifs that may be responsible for transcriptional activation in AtDOF4.2. A series of truncations were made (Figure 2C, upper panel) and tested using a protoplast assay system. Deletions in AtDOF4.2-M1 (amino acids 173–194) or AtDOF4.2-M2 (amino acids 137–194) from the C-terminal region led to a complete loss of transactivation activity (Figure 2C), suggesting that this region is required for transactivation. Removal of the N-terminal sequences containing the DOF domain in AtDOF4.2-M3 (amino acids 51–194) or in AtDOF4.2-M4 (amino acids 101–194) did not significantly affect the transactivation activity compared with normal AtDOF4.2 (Figure 2C). Further deletions in AtDOF4.2-M5 (amino acids 118–194) or AtDOF4.2-M6 (amino acids 122–194) resulted in an apparent increase in activation ability. Further removal from the N-terminal end caused a continuous decrease in transactivation activity, and the activity of AtDOF4.2-M9 (amino acids 154– 194) was similar to that of the negative control (Figure 2C). These results indicate that the amino acids 118–153 region may contain motifs important for transcriptional activation in AtDOF4.2. We further compared amino acid sequences of AtDOF4.2, AtDOF4.4 and AtDOF4.3 (Figure 3A). The DD (positions 124 and 14.4) motif was only present in AtDOF4.2, whereas the TMD motif (positions 142–144) was found in AtDOF4.2 and AtDOF4.4 (Figure 3A), both of which possessed transcriptional activation abilities, but not in AtDOF4.3 without transactivation (Figures 2A and 2B). The DD motif in AtDOF4.2-M6 was mutated to GG and the resulting AtDOF4.2-M10 had a reduced transcriptional activation (Figure 3B). Similarly, the TMD motif in AtDOF4.2-M8 was mutated to GGG, and the resulting AtDOF4.2M11 also had reduced activity (Figure 3B). Full-length AtDOF4.2 was also mutated in its DD or TMD motifs. The mutation of DD to GG in AtDOF4.2-M12 decreased the transactivation activity of AtDOF4.2 slightly, whereas the mutation of TMD to GGG in AtDOF4.2-M13 almost completely abolished its activity (Figure 3C). These results indicate that the TMD motif may play a large role in the transcriptional activation of AtDOF4.2. We also investigated the function of the TMD motif in AtDOF4.3 and AtDOF4.4. AtDOF4.4 harboured a TMD motif, whereas AtDOF4.3 did not. The TMD in AtDOF4.4 was mutated to GGG and the resulting AtDOF4.4-MUT almost completely lacked activity, indicating that the TMD motif is essential for transcriptional activation in AtDOF4.4 (Figure 3E). The corresponding amino acids at the same positions in AtDOF4.3 were replaced with TMD. However, this mutation did not significantly alter the activation activity (Figure 3D). All these


Figure 2

377

Transcriptional activation of AtDOFs

(A) Transactivation activity of AtDOF4.2, AtDOF4.3 and AtDOF4.4 in a yeast assay. Transformants harbouring pBD-AtDOFs, the positive control pGAL4 or the negative control pBD were streaked onto YPAD (top row) or SD-His (middle row) to determine growth. LacZ expression was examined by an X-Gal (5-bromo-4-chloroindol-3-yl β-D-galactopyranoside) assay (bottom row). (B) Transactivation activity of AtDOF4.2, AtDOF4.3 and AtDOF4.4 in Arabidopsis protoplasts. VP16 and GAL4DBD were used as positive and negative controls respectively. (C) Schematic representation (upper panel) and transactivation activity (lower panel) of truncated AtDOF4.2. AtDOF4.2-M1 to AtDOF4.2-M9 represent constructs with different truncated versions of AtDOF4.2. Vertical broken lines from the left-hand side to the right-hand side (upper panel) indicate positions of amino acids 50, 100 and 150. The error bars represent the S.D. (n = 4).

results indicate that the TMD motif may be critical for transcriptional activation in both AtDOF4.2 and AtDOF4.4.

AtDOF4.2 increases shoot branching in transgenic plants

To investigate the function of AtDOF4.2, an expression vector harbouring a 35S promoter-driven AtDOF4.2 was transformed

into Arabidopsis plants. Two homozygous lines (4.2-4 and 4.2-8) with higher AtDOF4.2 gene expression were selected for analysis (Figure 4A). A T-DNA insertion mutant dof4.2 (CS813276) without AtDOF4.2 expression was identified and the insertion site was between 153 and 154 bp from the ATG (Figure 4B). The transgenic lines overexpressing AtDOF4.2 (4.2-4 and 4.28) had more shoot branches and exhibited a bushy phenotype compared with Col-0 (Figure 4C). The number of primary and c The Authors Journal compilation c 2013 Biochemical Society

378

Figure 3


Mutations in AtDOF4.2, AtDOF4.3 and AtDOF4.4 affect the transactivation activity

(A) Alignment of AtDOF amino acid sequences. Asterisks indicate positions of mutated residues. Identical residues are shaded in black. (B) Schematic representation of mutations (left-hand panel) and transactivation activity (right-hand panel) of truncated AtDOF4.2. AtDOF4.2-M10, derived from AtDOF4.2-M6, has mutations D124G and D14.4G. AtDOF4.2-M11, derived from AtDOF4.2-M8, has the mutations T142G, M143G and D144G. (C) Schematic representation (left-hand panel) and transactivation activity (right-hand panel) of two mutated full-length AtDOF4.2s. AtDOF4.2-M12 has the mutations D124G and D14.4G. AtDOF4.2-M13 has the mutations T142G, M143G and D144G. (D) Transactivation activity of AtDOF4.3 and its mutant AtDOF4.3-MUT. AtDOF4.3-MUT has the mutations P152T, N153M and H154D at positions corresponding to TMD in AtDOF4.2. (E) Transactivation activity of AtDOF4.4 and its mutant AtDOF4.4-MUT. AtDOF4.4-MUT has the mutations (T150G, M151G and D152G) at the TMD motif. The error bars represent the S.D. (n = 4).

secondary rosette branches (RI and RII) and the secondary cauline leaf branches (CII) in two AtDOF4.2-overexpressing lines were significantly higher than that of Col-0 (Figures 4D, 4E and 4G). However, the number of primary cauline leaf branches (CI) was similar to Col-0 in the 4.2-4 line, but higher than the Col-0 c The Authors Journal compilation c 2013 Biochemical Society

line in the 4.2-8 line (Figure 4F). The dof4.2 did not show a significant difference in shoot branching, except that the number of RII branches may be slightly less than that of the Col-0 line (Figures 4C and 4E). Plant heights and the first internode lengths of two transgenic lines were substantially lower than that of the


Figure 4

379

Overexpression of AtDOF4.2 promotes shoot branching in transgenic plants

(A) AtDOF4.2 expression in various transgenic lines as revealed by Northern blot analysis. The rRNAs are shown as loading controls. (B) Identification of the AtDOF4.2 T-DNA insertion mutant dof4.2 . No AtDOF4.2 expression was found in dof4.2 (right-hand panel). (C) Shoot phenotype in different plants. AtDOF4.2 -overexpression lines 4.2-4 and 4.2-8 show a bushy phenotype. (D) Number of primary rosette branches (RI). (E) Number of secondary rosette branches (RII). (F) Number of primary cauline branches (CI). (G) Number of secondary cauline branches (CII). (H) Plant height of different plant lines. (I) First internode length of different lines. (D–I) **Highly significant differences compared with the Col-0 plants (P < 0.01). Error bars indicate S.D. (n = 32).

Col-0 and dof4.2 lines (Figures 4H and 4I). These results indicate that AtDOF4.2 regulates shoot branching. The effect of AtDOF4.2 on shoot branching is related to its transcriptional activation activity

To investigate whether AtDOF4.2 exerts effects on shoot branching through its transactivation activity, a mutated AtDOF4.2 gene encoding a protein with a TMD to GGG mutation, driven by a 35S promoter, was transformed into Arabidopsis plants. Two transgenic lines (4.2-m-16 and 4.2-m-17) harbouring the mutated gene, with transgene expression comparable with that of AtDOF4.2 in transgenic lines 4.2-4 and 4.2-8, were analysed (Figures 5A and 5B). The lines (4.2-m-16 and 4.2-m-17) harbouring the mutant AtDOF4.2 exhibited a higher number of rosette leaf branches (RI and RII) than Col-0, but a lower number than the transgenic line 4.2-4 overexpressing normal AtDOF4.2 (Figures 5C and 5D). For cauline leaf branching, the 4.2-m-16 and 4.2-m-17 lines had an unexpectedly lower number of CI branches than the Col-0 and the 4.2-4 lines (Figure 5E). The CII branch numbers of the 4.2-m-16 and 4.2-m-17 lines were similar to that of the Col-0 line, but were significantly lower than that of 4.2-4 (Figure 5F). Moreover, the plant heights and first internode lengths of 4.2-m16 and 4.2-m-17 were close to those of the Col-0 line, but higher than those in 4.2-4 (Figures 5G and 5H). These results

indicate that the loss of transcriptional activation significantly affects the roles of AtDOF4.2 in shoot branching.

AtDOF4.2 alters the expression of genes related to branch outgrowth in transgenic plants

Because AtDOF4.2 participated in the shoot branching process, we investigated whether the expression of known branchingrelated genes was changed. Of the genes tested (Supplementary Table S2 at http://www.biochemj.org/bj/449/bj4490373add.htm), only three (AtSTM, AtTFL1 and AtCYP83B1) showed enhanced expression in transgenic lines (4.2-4 and 4.2-8) overexpressing AtDOF4.2 (Figure 6). Expression of the three genes was slightly increased in the 4.2-m-17 line overexpressing mutated AtDOF4.2 (Figure 6). In the dof4.2 mutant, expression of the three genes was reduced (Figure 6). AtSTM encodes a KNOTTED-like protein and plays a role in shoot apical meristem formation [50]. AtTFL1 promotes branching [51]. AtCYP83B1 encodes a cytochrome P450 and affects auxin production and branching [34]. These analyses indicate that AtDOF4.2 may promote shoot branching through the up-regulation of AtSTM, AtTFL1 and AtCYP83B1. The mutation of the TMD motif in AtDOF4.2 or the disruption of AtDOF4.2 in the mutant significantly affected the expression of branching-related genes. c The Authors Journal compilation c 2013 Biochemical Society

380

Figure 5


TMD mutations in AtDOF4.2 affects shoot branching in transgenic plants

(A) Transgene expression in various lines revealed by RT quantitative PCR. 4.2-4 and 4.2-8 are lines overexpressed AtDOF4.2 . 4.2-m-16 and 4.2-m-17 are lines overexpressing mutated AtDOF4.2 with TMD mutations. Mutated AtDOF4.2 lost transactivation activity. (B) Shoot branching phenotype in various transgenic lines. (C) Comparison of primary rosette branches (RI) in various plant lines. (D) Comparison of secondary rosette branches (RII) in the plant lines. (E) Number of primary cauline branches (CI) in the plants. (F) Number of secondary cauline branches (CII) in the plants. (G) Comparison of plant height. (H) Comparison of first internode length in different lines. (C–H) a, b or c, Significant difference between the compared values (P < 0.05). Error bars indicate S.D. (n = 32).

AtDOF4.2 alters cotyledon size and seed coat phenotype in transgenic plants

After seed germination the plant cotyledon size was compared. At different stages the AtDOF4.2-overexpressing lines (4.2-4 and 4.2-8) had large cotyledons compared with the Col-0 line (Figure 7). However, transgenic lines that overexpressed mutatedAtDOF4.2 (4.2-m-16 and 4.2-m-17) showed no significant difference compared with the Col-0 line. These results indicate that AtDOF4.2 increases cotyledon size and that this function is mainly achieved through its transcriptional activation activity. Because AtDOF4.2 was primarily expressed in siliques, we examined whether seed-related phenotypes were changed in AtDOF4.2-transgenic plants. Using scanning electron microscopy the Col-0 and dof4.2 mutant seed coats showed a reticulate appearance owing to the presence of thickened radial cell walls and a raised columella in the centre of each epidermal cell (Figures 8A and 8B). However, transgenic lines 4.2-4 and 4.2-8 exhibited a collapsed profile and the boundaries of seed epidermal cells became ambiguous owing to collapsed cell walls (Figures 8A and 8B). In contrast, the epidermal cells of the seed coat from lines with mutated AtDOF4.2 (4.2-m-16 and 4.2-m-17) were c The Authors Journal compilation c 2013 Biochemical Society

similar to those of the Col-0 line. These results indicate that AtDOF4.2 overexpression causes abnormal seed coats and that transcriptional activation activity of AtDOF4.2 is required for this process.

AtDOF4.2 regulates content of seed coat mucilage

Arabidopsis mutants with abnormal seed coat cell walls usually show defects in mucilage synthesis or mucilage extrusion [52]. Arabidopsis seeds form a gelatinous coating when in contact with water due to mucilage release. This coating can be visualized by staining with Ruthenium Red, a dye that stains negatively charged biopolymers such as pectin and DNA [52]. Most seeds from 4.2-m-17 and Col-0 lines were wrapped with a pink capsule (Figures 8C and 8D). In contrast, only ∼ 40 % of the seeds from the 4.2-4 and 4.2-8 lines were stained (Figure 8C and 8D). These data indicate that the overexpression of AtDOF4.2 disrupts mucilage synthesis and/or mucilage extrusion. To determine whether there were changes in the mucilage content or composition, we measured the monosaccharide content in seed coats from the 4.2-4, 4.2-m-17 and Col-0 lines. Rha


381

Figure 6 Expression of shoot branching-related genes in AtDOF4.2 transgenic plants and the dof4.2 mutant The 4.2-4 and 4.2-8 lines overexpressed AtDOF4.2 . 4.2-m-17 overexpressed mutated AtDOF4.2 . dof4.2 is a mutant of AtDOF4.2 expression. Relative expressions of AtSTM (TAIR locus AT1G64.260), AtTFL1 (TAIR locus AT5G03840) and AtCYP83B1 (TAIR locus AT4G31500) were determined by RT quantitative PCR. Error bars indicate S.D. (n = 4).

(rhamnose) accounted for the majority of the total mucilage, whereas other monosaccharides accounted for only a minor part in all tested lines (Table 1). A dramatic decrease of total mucilage in line 4.2-4 seed coats was noted, whereas no significant changes were found in line 4.2-m-17 seed coats compared with those of Col-0 (Table 1). The reduced mucilage content in line 4.2-4 seed coats was primarily owing to a decrease in Rha content. These results indicate that AtDOF4.2 overexpression affects mucilage content and composition in transgenic seed coats and that these changes rely on the transactivation activity of AtDOF4.2.

AtDOF4.2 enhances AtEXPA9 expression through direct binding to the promoter region

We investigated whether AtDOF4.2 affects seed coats through the regulation of downstream genes. The expression of several genes whose mutants showed defects in seed coat formation was not significantly changed in the transgenic lines compared with the Col-0 line (Supplementary Figure S2 at http://www.biochemj.org/bj/449/bj4490373add.htm). However, expression of AtEXPA9, a member of the Arabidopsis expansin family, increased significantly in the lines (4.2-4 and 4.2-8) overexpressing AtDOF4.2, but only slightly in the 4.2-m-17 line, which overexpressed mutated AtDOF4.2 (Figure 9A). In the dof4.2 mutant, AtEXPA9 expression was reduced (Figure 9A). The expansin family is a group of proteins that induce cell walls to extend, leading to the loosening of cell walls [53]. These results

Figure 7

Overexpression of AtDOF4.2 affects cotyledon size

(A) Seedlings (upper panel) and cotyledons (lower panel) from 5-day-old plants. Transgenic lines overexpressing normal AtDOF4.2 (4.2-4 and 4.2-8) or mutated AtDOF4.2 (4.2-m-16 and 4.2-m-17) were compared. (B) Seedlings (upper panel) and cotyledons (lower panel) from 9-day-old plants. (C) Comparison of cotyledons size of transgenic and Col-0 lines. The areas of 5- and 9-day-old cotyledons are shown. **Significant differences from the Col-0 plants (P < 0.01). Error bars indicate S.D. (n = 32).

indicate that AtEXPA9 may be a putative target of AtDOF4.2 during seed coat development. We found a further 37 DOFbinding elements in the 2.2 kb promoter region of AtEXPA9 (results not shown) and a 45-bp DNA sequence (from − 459 to − 415) in this region, containing five AAAG elements, was selected for DNA-binding analysis. AtDOF4.2 can specifically bind to this region (Figure 9B). These results indicate that AtDOF4.2 can bind to the promoter of AtEXPA9 and enhance its expression. AtDOF4.4 affects shoot branching and silique length

Because AtDOF4.4 and AtDOF4.2 were clustered [1] and both had transcriptional activation activity (Figures 2A and 2B), we examined whether AtDOF4.4 plays any role in plant development. Three lines (4.4-1, 4.4-5 and 4.4-6) that overexpressed AtDOF4.4 were analysed (Figure 10A). AtDOF4.4 transgenic plants showed c The Authors Journal compilation c 2013 Biochemical Society

382

Figure 8


Seed coat phenotypes of various plants

Mutant dof4.2 and lines overexpressing AtDOF4.2 (4.2-4 and 4.2-8) or mutated AtDOF4.2 (4.2-m-16 and 4.2-m-17) were compared with the Col-0 plants. (A) Scanning electron micrograph of seed coat. Scale bar, 40 μm. (B) Scanning electron micrograph of epidermal cells in seed coat. Scale bar, 10 μm. (C) Ruthenium Red staining of seeds. Seeds of transgenic lines 4.2-4 and 4.2-8 showed different staining patterns from those of the 4.2-m-17 and Col-0 line. Scale bar, 500 μm. (D) The percentage of stained seeds in various plants. **Significant difference from Col-0 (P < 0.01). Error bars indicate S.D. (n = 3).

a slightly more severe bushy phenotype than Col-0 and AtDOF4.2overexpressing plants (Figures 4C and 10B). Rosette branching (RI and RII) and secondary cauline leaf branching (CII) were all significantly enhanced compared with the Col-0 line (Figure 10C). However, CI branching was not affected. The plant heights of lines 4.4-1, 4.4-5 and 4.4-6 were decreased compared with the Col-0 line (Figure 10D). Additionally, the silique length and seed yield per plant were reduced in the three transgenic lines (Figures 10E–10G). These results indicate that AtDOF4.4 regulates shoot branching and seed/silique-related traits. Altered gene expression was studied in AtDOF4.4overexpressing plants based on a microarray analysis (GO c The Authors Journal compilation c 2013 Biochemical Society

accession number GSE41682). The genes from the microarray analysis with at least a 10-fold expression difference in both 4.41 and 4.4-5 lines compared with the Col-0 line (Supplementary Table S3 at http://www.biochemj.org/bj/449/bj4490373add.htm) were further examined by semi-quantitative PCR using independently isolated RNAs, and 19 genes were found to be up-regulated and one gene was down-regulated (Figure 10H). Of these, At2S3 encodes a model storage protein (2S albumin gene 3). AtGASA3 is Gibberellin-regulated and accumulates in siliques and seeds. CRU2 and CRU3 are major seed protein 12S globulin cruciferins. AtPER1 (A. thaliana 1-cysteine peroxiredoxin 1) is primarily expressed in embryos and mature seeds and is also


Figure 9

383

AtDOF4.2 promotes AtEXPA9 expression and binds to its promoter

(A) Expression of cell wall loosening-related gene AtEXPA9 . Relative expressions of the gene was determined by RT quantitative PCR in lines overexpressing AtDOF4.2 (4.2-4 and 4.2-8) or mutated AtDOF4.2 (4.2-m-17), and in the dof4.2 mutant. Error bars indicate S.D. (n = 4). (B) AtDOF4.2 binds to the promoter of AtEXPA9 . DNA fragments of the AtEXPA9 gene promoter ( − 459 to − 415) were used as probes and the core elements are underlined.

Table 1 Monosaccharide contents in transgenic seeds overexpressing AtDOF4.2 (4.2-4) or mutated AtDOF4.2 (4.2-m-17) compared with that in Col-0 seeds Results are + − S.E.M. calculated from three independent samples. Ara, arabinose; Fuc, fucose; Gal, galactose; Glc, glucose; Man, mannose; Xyl, xylose. Contents (μg/100 mg of seeds) Sugar

Col-0

4.2-4

4.2-m-17

Rha Fuc Ara Xyl Man Gal Glc Total

625.1 + − 7.3 4.4 + − 0.2 7.6 + − 0.3 28.7 + − 0.5 6.7 + − 0.1 13.9 + − 0.4 7.9 + 0.2 694.2 + − 7.6

425.1 + − 9.3† 3.6 + − 0.1† 8.7 + − 0.7 19.3 + − 0.3† 5.7 + − 0.1† 13.9 + − 0.5 7.0 + 0.1* 483.2 + − 9.6†

636.4 + − 21.1 4.1 + − 0.3 7.4 + − 0.1 28.8 + − 0.1 6.3 + − 0.2 14.1 + − 0.3 7.9 + 0.1 704.9 + − 21.9

*Significantly different from Col-0 (P < 0.05). †Significantly different from Col-0 (P < 0.01).

expressed in meristems and stem branching points. AtOLE2 (A. thaliana oleosin 2) is an oleosin in seeds. At3g15670 encodes a LEA (LATE EMBRYOGENESIS ABUNDANT) 76 homologue. At3g56350 encodes a superoxide dismutase. At1g07645 encodes a desiccation-induced 1VOC superfamily protein. At3g21720 encodes a putative isocitrate lyase. At1g73190 encodes a putative aquaporin TIP3-1. At4g22630 encodes lipid-transfer protein/seed storage 2S albumin-like protein. At2g41260 encodes a putative LEA(M17). At4g21020 encodes a LEA-containing protein. All these genes may contribute to AtDOF4.4 function in shoot branching and seed-related traits. The effects of reduced AtDOF4.2 and AtDOF4.4 expression on shoot branching, silique length and seed yield

Although both AtDOF4.2 and AtDOF4.4 promote shoot branching in overexpression transgenic plants (Figures 4 and 10), the dof4.2 mutant exhibited no change in branching, and the effect of an AtDOF4.4 loss-of-function mutation is not known. We then generated transgenic plants with reduced AtDOF4.4 expression (DOF4.4 RNAi lines 4, 10 and 13) using an RNAi-based approach

(Figure 11A). The AtDOF4.4 RNAi construct was also introduced into dof4.2 mutant to produce plants with reduced expression of both AtDOF4.4 and AtDOF4.2 (dof4.2/DOF4.4RNAi double mutant lines 11, 13 and 16) (Figures 11A and 11B). The branching of these plants was measured, and no significant difference was observed (Supplementary Figure S3 at http://www.biochemj.org/bj/449/bj4490373add.htm). The DOF4.4 RNAi lines and dof4.2/DOF4.4RNAi double mutant lines all had taller inflorescences compared with the Col-0 and dof4.2 lines (Figures 11C and 11D). The silique length and seed yield per plant in these lines were also substantially higher than those of the Col-0 plants (Figures 11E–11G). In the dof4.2 mutant, the silique length and seed yield per plant were increased compared with the Col-0 plants (Figures 11E– 11G). The expressions of putative downstream genes were also examined and a 2S seed storage protein gene (At4g27140) was significantly inhibited in the dof4.2, DOF4.4 RNAi and dof4.2/DOF4.4RNAi lines (Figure 11H). Expression of the other three genes, encoding uncharacterized protein (At1g05510), DNA-binding protein (At2g42940) and glycine-rich protein (At5g35660) was also decreased (Supplementary Figure S4 at http://www.biochemj.org/bj/449/bj4490373add.htm). These results indicate that reduction of AtDOF4.4 and/or AtDOF4.2 enhances silique length and seed yield in Arabidopsis, probably through the regulation of downstream genes. However, branching was not affected by inhibition of these two genes.

DISCUSSION

DOF proteins are plant-specific transcription factors and function in different developmental and physiological processes [1–22]. In the present study AtDOF4.2 and AtDOF4.4 were found to have transcriptional activation ability and participated in shoot branching and seed/silique development. The features of transcription factors are often determined by certain amino acids or motifs. The AtDOF4.2 protein was found to be localized in the nuclear region (Figure 1); however, no apparent NLS was identified in this protein. Interestingly, all the other Arabidopsis DOF proteins have an atypical bipartite NLS with a 17 amino acid-long linker between the flanking c The Authors Journal compilation c 2013 Biochemical Society

384

Figure 10


Phenotypes of AtDOF4.4 -overexpressing plants

(A) AtDOF4.4 expression in various transgenic lines shown by RT-PCR. ACTIN was amplified as a control. (B) Bushy phenotype of transgenic lines (4.4-1, 4.4-5 and 4.4-6) overexpressing AtDOF4.4 . (C) Branches in transgenic plants. RI, RII, CI and CII are as in Figure 4. Error bars indicate S.D. (n = 32). (D) Plant height of different lines. Error bars indicate S.D. (n = 32). (E) AtDOF4.4 -overexpressing plants have short siliques. (F) Comparison of silique length. Error bars indicate S.D. (n = 36). (G) Comparison of seed mass per plant. Error bars indicate S.D. (n = 6). (H) Altered gene expressions in AtDOF4.4-transgenic plants (4.4-1 and 4.4-5) examined by RT-PCR. (C–G) **Significant differences from the Col-0 plants (P < 0.01).

basic regions [54]. Through mutational analyses, two basic amino acids in AtDOF4.2, Lys100 and Lys101 , were found to be essential for its nuclear localization (Figure 1), suggesting a new NLS feature different from those of other proteins. Both AtDOF4.2 and AtDOF4.4 have transcriptional activation activity by yeast assays and protoplast assays. The TMD motifs in the C-terminal region of the two proteins are essential for the transactivation ability, as determined by results of the protoplast assay (Figure 3). However, this motif was not found in two other DOF proteins, AtDOF4.3 and AtDOF4.5, both of which appear to have no transcriptional activation ability (Figure 2 and results not shown). In the transcription factor VP16, a specific phenylalanine (Phe442 ) c The Authors Journal compilation c 2013 Biochemical Society

is essential for its transactivation activity [55]. In maize DOF1, a tryptophan residue in its activation domain is important for transcriptional activation of the target genes [5]. The roles of the TMD motif in AtDOF4.2 were further demonstrated through transgenic analysis. Transgenic plants that overexpressed normal AtDOF4.2 had more rosette branches (RI and RII) and cauline secondary branches (CII) than the Col-0 plants (Figures 4 and 5). However, when the TMD was mutated to GGG, transgenic plants harbouring mutated AtDOF4.2 showed reduced RI, RII and CII branch numbers compared with the transgenic plants with normal AtDOF4.2 (Figure 5). It should be noted that only the CII branch number was reduced to the


Figure 11

385

Phenotypic changes in the dof4.2 mutant, DOF4.4 RNAi and dof4.2/DOF4.4RNAi lines

(A) AtDOF4.4 expression in various lines. Error bars indicate S.D. (n = 4). (B) AtDOF4.2 expression in plant lines. Error bars indicate S.D. (n = 4). (C) Plant growth at the maturation stage. (D) Plant height at the maturation stage. Error bars indicate S.D. (n = 24). (E) Comparison of siliques from various plants. (F) Comparison of silique length. Error bars indicate S.D. (n = 33). (G) Relative seed mass in various plants. Error bars indicate S.D. (n = 14). The seed mass in the Col-0 plants was set to be 1 and the other values relative to 1. (H) Downstream gene expression in plant lines. Error bars indicate S.D. (n = 4). (D, F and G) *Significant differences compared with the Col-0 plants (P < 0.05); **significant differences compared with the Col-0 plants (P < 0.01).

Col-0 plant level (Figure 5F), whereas the RI and RII branch numbers were still higher than that of the Col-0 plants (Figures 5C and 5D). These analyses indicate that the TMD motif may play a large role in CII branching, but have only a partial role in RI and RII branching. Other motifs may also act in

these processes. Additionally, the TMD motif may play a major role in the regulation of cotyledon size, seed coat phenotype and monosaccharide content in seeds because mutation of the motif in AtDOF4.2 caused phenotypes or parameters similar to those in the Col-0 plants (Figures 7 and 8, and Table 1). c The Authors Journal compilation c 2013 Biochemical Society

386


From expression of putative downstream genes, including AtSTM, AtTFL1, AtCYP83B1 and AtEXPA9, it seems that the TMD motif plays a partial role in the regulation of these genes because the mutation of TMD reduced, but did not abolish, their expression in transgenic plants when compared with the expression levels in transgenic plants with normal AtDOF4.2 and the Col-0 plants (Figures 6 and 9). Collectively, the TMD motif may play a major role in some aspects, but only a partial role in other aspects. AtDOF4.4 also has roles in branching and silique-related traits (Figure 10). Whether the TMD motif of this protein has any roles in different processes requires further investigation. Previously, when studying the roles of AtDOF4.2 in phenylpropanoid metabolism, Skirycz et al. [17] found that this gene was highly expressed in the axillary buds of flower stalks and its overexpression resulted in a bushy phenotype. In the present study AtDOF4.2 and its close homologue AtDOF4.4 affect both the primary and secondary branches of rosette leaves and the cauline leaf secondary branches (Figures 4 and 10). A series of genes have been shown to participate in the shoot branching processes by analysis of the phenotypes of their functional deficit mutants, and these mutants always increase the number of primary shoot branches [25,27–29,35]. AtDOF4.2 and AtDOF4.4, however, primarily regulated the secondary shoot branches and only mildly affected the primary shoot branches. It is thus proposed that AtDOF4.2 and AtDOF4.4 may function redundantly to regulate shoot branching processes through alternative mechanisms. It should be mentioned that our dof4.2 mutant appeared to have no strong branching phenotypic change compared with the Col-0 line (Figure 4). This result is consistent with that of Skirycz et al. [17], who reported that knockdown of AtDOF4.2 did not lead to a visible morphological change. Inhibition of AtDOF4.4 in RNAi lines also did not affect the branching phenotype (Supplementary Figure S3). Further knockdown of AtDOF4.4 expression in the dof4.2 mutant did not result in a change in the branching phenotype (Supplementary Figure S3), suggesting that other homologues, e.g. AtDOF4.3 and AtDOF4.5, may also contribute to branching. Alternatively, other mechanisms may be involved in the process. AtDOF4.2 may fulfil its function in transgenic plants through activation of AtSTM, AtTFL1 and AtCYP83B1. AtSTM, a member of the Arabidopsis KNOTTED transcription factor family, was found to be expressed in the apical shoot meristem, lateral shoot meristem and floral meristem. Its mutant stm-1 blocks SAM initiation [50]. AtSTM affects the shoot meristem by regulating the expression of downstream genes. The AtTFL1 gene was found to participate in several stages of stem development. The tfl1-1 mutation causes early flowering and limits the development of normally indeterminate inflorescence by promoting the formation of a terminal floral meristem. The AtTFL1-transgenic plants, in contrast, show extended life phases and highly branched inflorescences [51]. The cytochrome P450 gene AtCYP83B1 encodes a protein at the metabolic branch point in auxin and indole glucosinolate biosynthesis. The knockout mutant of AtCYP83B1 shows strong apical dominance and had only one single inflorescence, whereas the AtCYP83B1-overexpression plant has more shoot branches compared with the wild-type plant [34]. Other unknown genes may also be involved in AtDOF4.2regulated branching processes. Whether AtDOF4.2 regulates these genes though direct binding to their promoters or through indirect mechanisms remains to be further elucidated. Many genes, including regulatory and functional genes, affect the epidermal cell shape of seed coat. Mutants of these genes show defects in the development of seed coat to varying degrees, and mucilage defects are often associated with various abnormal seed coats [52]. The results of the present study show that the c The Authors Journal compilation c 2013 Biochemical Society

AtDOF4.2-overexpressing lines show defects in the cell wall of the seed coat and exhibit a collapsed style of epidermal cells. This phenotype is different from those of the above-reported mutants, suggesting that AtDOF4.2 regulates the development of cell wall in seed coats through different pathways. The collapsed cell wall structures may be related to the reduced mucilage contents in AtDOF4.2 transgenic seed coats (Figure 8 and Table 1). It has been reported that a decrease in the total amount of mucilage could lead to a failure in mucilage extrusion [56]. Moreover, the changes in mucilage components could also lead to defects in mucilage release [52,56]. An increase of Ara (arabinose) in the seed coat would lead to a defect in mucilage extrusion [57]. In the AtDOF4.2 transgenic seed coat, Rha is the major component and was significantly reduced (Table 1). This decrease, together with reductions in other minor components (Table 1), may result in a defect in mucilage extrusion, leading to abnormal seed coats in AtDOF4.2-overexpressing plants. AtDOF4.2-enhanced expression of the expansin gene AtEXPA9 may act through direct binding to the promoter region (Figure 9). Arabidopsis expansins belong to a large group of proteins that are responsible for cell wall loosening and participate in several physiological processes, including cell growth, fruit softening and pollen tube elongation [53]. Higher levels of AtEXPA9 in AtDOF4.2-overexpressing plants may be specifically related to the cell wall collapse observed in the seed coats because epidermal cells in other organs of the transgenic plants were not significantly different from those of the Col-0 line (results not shown). Overexpression of the LeEXP1 gene in tomato plants leads to smaller and more rubbery fruits but normal vegetative organs [58]. In the Zinnia xylem, expansin mRNAs are expressed only in the ends of the cells, which indicates that they may function during targeted secretion of expansins to specific cell walls [53,59]. In addition to branching and seed coat formation, AtDOF4.2 also plays roles in regulation of silique length and seed yield because the dof4.2 mutant had longer siliques and a higher seed yield than the Col-0 plants (Figure 11). However, AtDOF4.2 overexpression appeared to not affect these traits (results not shown). In contrast, AtDOF4.4 overexpression and the RNAi lines showed silique lengths and seed yields that were altered in the opposite direction (Figures 10 and 11), suggesting that AtDOF4.4 may play a major role in the control of seed-related traits. Considering that AtDOF4.4 regulates the expression of many storage protein-related genes and lipidrelated genes (Figures 10 and 11, and Supplementary Figure S4 at http://www.biochemj.org/bj/449/bj4490373add.htm), it is probable that AtDOF4.4 represents a novel master regulator of seed development and controls seed storage reserve accumulation. It should be noted that a reduction in the expression of AtDOF4.4 in the dof4.2 mutant does not further enhance the silique length and seed mass, suggesting that the two genes may act in the same pathway to regulate seed traits. Alternatively, the two proteins may form a complex that affects the seed/silique formation. Other possibilities may also be present. Taken together, both AtDOF4.2 and AtDOF4.4 play roles in shoot branching and seed-related traits. The TMD motif of AtDOF4.2 is essential for transcriptional activation and is largely required for the phenotypic change in AtDOF4.2-overexpressing plants. Manipulation of these genes has potential for use in improving agronomic-related traits in crops. AUTHOR CONTRIBUTION The experiments were carried out by Hong-Feng Zou, Yu-Qin Zhang, Wei Wei, Hao-Wei Chen, Qing-Xin Song, Yun-Feng Liu, Ming-Yu Zhao, Fang Wang and Bao-Cai Zhang.

AtDOF4.2 affects branching and seed coat phenotype Qing Lin, Wan-Ke Zhang, Biao Ma and Yi-Hua Zhou provided tools and analysed the data. Jin-Song Zhang, Shou-Yi Chen and Hong-Feng Zou designed the study, analysed the data and wrote the paper.

FUNDING This work was supported by the National Key Basic Research Projects [grant number 2009CB118402], the National Transgenic Research Project [grant numbers 2011ZX08009003-004 and 2011ZX08009-004] and the National Natural Science Foundation of China [grant number 30925006].

REFERENCES 1 Yanagisawa, S. (2002) The Dof family of plant transcription factors. Trends Plant Sci. 7, 555–560 2 Yanagisawa, S. and Izui, K. (1993) Molecular cloning of 2 DNA-binding proteins of maize that are structurally different but interact with the same sequence motif. J. Biol. Chem. 268, 16028–16036 3 Zhang, B., Chen, W., Foley, R. C., Buttner, M. and Singh, K. B. (1995) Interactions between distinct types of DNA binding proteins enhance binding to ocs element promoter sequences. Plant Cell 7, 2241–2252 4 Yanagisawa, S. and Sheen, J. (1998) Involvement of maize Dof zinc finger proteins in tissue-specific and light-regulated gene expression. Plant Cell 10, 75–89 5 Yanagisawa, S. (2001) The transcriptional activation domain of the plant-specific Dof1 factor functions in plant, animal, and yeast cells. Plant Cell Physiol. 42, 813–822 6 VicenteCarbajosa, J., Moose, S. P., Parsons, R. L. and Schmidt, R. J. (1997) A maize zinc-finger protein binds the prolamin box in zein gene promoters and interacts with the basic leucine zipper transcriptional activator Opaque2. Proc. Natl. Acad. Sci. U.S.A. 94, 7685–7690 7 Diaz, I., Martinez, M., Isabel-LaMoneda, I., Rubio-Somoza, I. and Carbonero, P. (2005) The DOF protein, SAD, interacts with GAMYB in plant nuclei and activates transcription of endosperm-specific genes during barley seed development. Plant J. 42, 652–662 8 Mena, M., Cejudo, F. J., Isabel-Lamoneda, I. and Carbonero, P. (2002) A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol. 130, 111–119 9 Moreno-Risueno, M. A., Diaz, I., Carrillo, L., Fuentes, R. and Carbonero, P. (2007) The HvDOF19 transcription factor mediates the abscisic aciddependent repression of hydrolase genes in germinating barley aleurone. Plant J. 51, 352–365 10 Park, D. H., Lim, P. O., Kim, J. S., Cho, D. S., Hong, S. H. and Nam, H. G. (2003) The Arabidopsis COG1 gene encodes a Dof domain transcription factor and negatively regulates phytochrome signaling. Plant J. 34, 161–171 11 Wei, P. C., Tan, F., Gao, X. Q., Zhang, X. Q., Wang, G. Q., Xu, H., Li, L. J., Chen, J. and Wang, X. C. (2010) Overexpression of AtDOF4.7, an Arabidopsis DOF family transcription factor, induces floral organ abscission deficiency in Arabidopsis. Plant Physiol. 153, 1031–1045 12 Kang, H. G., Foley, R. C., Onate-Sanchez, L., Lin, C. G. T. and Singh, K. B. (2003) Target genes for OBP3, a Dof transcription factor, include novel basic helix-loop-helix domain proteins inducible by salicylic acid. Plant J. 35, 362–372 13 Ward, J. M., Cufr, C. A., Denzel, M. A. and Neff, M. M. (2005) The Dof transcription factor OBP3 modulates phytochrome and cryptochrome signaling in Arabidopsis . Plant Cell 17, 475–485 14 Chen, W. Q., Chao, G. and Singh, K. B. (1996) The promoter of a H2 O2 -inducible Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites. Plant J. 10, 955–966 15 Gabriele, S., Rizza, A., Martone, J., Circelli, P., Costantino, P. and Vittorioso, P. (2010) The Dof protein DAG1 mediates PIL5 activity on seed germination by negatively regulating GA biosynthetic gene AtGA3ox1. Plant J. 61, 312–323 16 Skirycz, A., Radziejwoski, A., Busch, W., Hannah, M. A., Czeszejko, J., Kwasniewski, M., Zanor, M. I., Lohmann, J. U., De Veylder, L., Witt, I. and Mueller-Roeber, B. (2008) The DOF transcription factor OBP1 is involved in cell cycle regulation in Arabidopsis thaliana . Plant J. 56, 779–792 17 Skirycz, A., Jozefczuk, S., Stobiecki, M., Muth, D., Zanor, M. I., Witt, I. and Mueller-Roeber, B. (2007) Transcription factor AtDOF4.2 affects phenylpropanoid metabolism in Arabidopsis thaliana . New Phytol. 175, 425–438 18 Guo, Y., Qin, G. J., Gu, H. Y. and Qu, L. J. (2009) Dof5.6/HCA2, a Dof transcription factor gene, regulates interfascicular cambium formation and vascular tissue development in Arabidopsis . Plant Cell 21, 3518–3534 19 Gualberti, G., Papi, M., Bellucci, L., Ricci, L., Bouchez, D., Camilleri, C., Costantino, P. and Vittorioso, P. (2002) Mutations in the Dof zinc finger genes DAG2 and DAG1 influence with opposite effects the germination of Arabidopsis seeds. Plant Cell 14, 1253–1263

387

20 Kumar, R., Taware, R., Gaur, V. S., Guru, S. K. and Kumar, A. (2009) Influence of nitrogen on the expression of TaDof1 transcription factor in wheat and its relationship with photo synthetic and ammonium assimilating efficiency. Mol. Biol. Rep. 36, 2209–2220 21 Tanaka, M., Takahata, Y., Nakayama, H., Nakatani, M. and Tahara, M. (2009) Altered carbohydrate metabolism in the storage roots of sweetpotato plants overexpressing the SRF1 gene, which encodes a Dof zinc finger transcription factor. Planta 230, 737–746 22 Wang, H. W., Zhang, B., Hao, Y. J., Huang, J., Tian, A. G., Liao, Y., Zhang, J. S. and Chen, S. Y. (2007) The soybean Dof-type transcription factor genes, GmDof4 and GmDof11, enhance lipid content in the seeds of transgenic Arabidopsis plants. Plant J. 52, 716–729 23 Schmitz, G. and Theres, K. (1999) Genetic control of branching in Arabidopsis and tomato. Curr. Opin. Plant Biol. 2, 51–55 24 Aguilar-Martinez, J. A., Poza-Carrion, C. and Cubas, P. (2007) Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds. Plant Cell 19, 458–472 25 Leyser, O. (2003) Regulation of shoot branching by auxin. Trends Plant Sci. 8, 541–545 26 Shani, E., Yanai, O. and Ori, N. (2006) The role of hormones in shoot apical meristem function. Curr. Opin. Plant Biol. 9, 484–489 27 Lin, H., Wang, R., Qian, Q., Yan, M., Meng, X., Fu, Z., Yan, C., Jiang, B., Su, Z., Li, J. and Wang, Y. (2009) DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 21, 1512–1525 28 McSteen, P. (2009) Hormonal regulation of branching in grasses. Plant Physiol. 149, 46–55 29 Ward, S. P. and Leyser, O. (2004) Shoot branching. Curr. Opin. Plant Biol. 7, 73–78 30 Gallavotti, A., Zhao, Q., Kyozuka, J., Meeley, R. B., Ritter, M., Doebley, J. F., Pe, M. E. and Schmidt, R. J. (2004) The role of barren stalk1 in the architecture of maize. Nature 432, 630–635 31 Li, X. Y., Qian, Q., Fu, Z. M., Wang, Y. H., Xiong, G. S., Zeng, D. L., Wang, X. Q., Liu, X. F., Teng, S., Hiroshi, F. et al. (2003) Control of tillering in rice. Nature 422, 618–621 32 Gallavotti, A., Yang, Y., Schmidt, R. J. and Jackson, D. (2008) The relationship between auxin transport and maize branching. Plant Physiol. 147, 1913–1923 33 Komatsu, K., Maekawa, M., Ujiie, S., Satake, Y., Furutani, I., Okamoto, H., Shimamoto, K. and Kyozuka, J. (2003) LAX and SPA: major regulators of shoot branching in rice. Proc. Natl. Acad. Sci. U.S.A. 100, 11765–11770 34 Bak, S., Tax, F. E., Feldmann, K. A., Galbraith, D. W. and Feyereisen, R. (2001) CYP83B1, a cytochrome P450 at the metabolic branch paint in auxin and indole glucosinolate biosynthesis in Arabidopsis . Plant Cell 13, 101–111 35 Zou, J. H., Zhang, S. Y., Zhang, W. P., Li, G., Chen, Z. X., Zhai, W. X., Zhao, X. F., Pan, X. B., Xie, Q. and Zhu, L. H. (2006) The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J. 48, 687–696 36 Stirnberg, P., Furner, I. J. and Leyser, H. M. O. (2007) MAX2 participates in an SCF complex which acts locally at the node to suppress shoot branching. Plant J. 50, 80–94 37 Tantikanjana, T., Yong, J. W. H., Letham, D. S., Griffith, M., Hussain, M., Ljung, K., Sandberg, G. and Sundaresan, V. (2001) Control of axillary bud initiation and shoot architecture in Arabidopsis through the SUPERSHOOT gene. Genes Dev. 15, 1577–1588 38 Takeda, T., Suwa, Y., Suzuki, M., Kitano, H., Ueguchi-Tanaka, M., Ashikari, M., Matsuoka, M. and Ueguchi, C. (2003) The OsTB1 gene negatively regulates lateral branching in rice. Plant J. 33, 513–520 39 Muller, D., Schmitz, G. and Theres, K. (2006) Blind homologous R2R3 Myb genes control the pattern of lateral meristem initiation in Arabidopsis . Plant Cell 18, 586–597 40 Baud, S., Dubreucq, B., Miquiel, M., Rochat, C. and Lepiniec, L. (2008) Storage reserve accumulation in Arabidopsis : metabolic and developmental control of seed filling. Arabidopsis Book 6, 1–24 41 Monke, G., Seifert, M., Keilwagen, J., Mohr, M., Grosse, I., Hahnel, U., Junker, A., Weisshaar, B., Conrad, U., Baumlein, H. and Altschmied, L. (2012) Toward the identification and regulation of the Arabidopsis thaliana ABI3 regulon. Nucleic Acids Res. 40, 8240–8254 42 Le, B. H., Cheng, C., Bui, A. Q., Wagmaister, J. A., Henry, K. F., Pelletier, J., Kwong, L., Belmonte, M., Kirkbride, R., Horvath, S. et al. (2010) Global analysis of gene activity during Arabidopsis seed development and identification of seed-specific transcription factors. Proc. Natl. Acad. Sci. U.S.A. 107, 8063–8070 43 Jones, S., Gonzalez, D. O. and Wodkin, L. O. (2010) Flux of transcript patterns during soybean seed development. BMC Genomics 11, 136 44 Wuriyanghan, H., Zhang, B., Cao, W. H., Ma, B., Lei, G., Liu, Y. F., Wei, W., Wu, H. J., Chen, L. J., Chen, H. W. et al. (2009) The ethylene receptor ETR2 delays floral transition and affects starch accumulation in rice. Plant Cell 21, 1473–1494 45 Zhang, B., Chen, H. W., Mu, R. L., Zhang, W. K., Zhao, M. Y., Wei, W., Wang, F., Yu, H., Lei, G., Zou, H. F. et al. (2011) NIMA-related kinase NEK6 affects plant growth and stress response in Arabidopsis . Plant J. 68, 830–843 46 Zemach, A., Kim, M. Y., Silva, P., Rodrigues, J. A., Dotson, B., Brooks, M. D. and Zilberman, D. (2010) Local DNA hypomethylation activates genes in rice endosperm. Proc. Natl. Acad. Sci. U.S.A. 107, 18729–18734 c The Authors Journal compilation c 2013 Biochemical Society

388


47 Song, Q. X., Liu, Y. F., Hu, X. Y., Zhang, W. K., Ma, B., Chen, S. Y. and Zhang, J. S. (2011) Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing. BMC Plant Biol. 11, 5 48 Ohta, M., Ohme-Takagi, M. and Shinshi, H. (2000) Three ethylene-responsive transcription factors in tobacco with distinct transactivation functions. Plant J. 22, 29–38 49 Gibeaut, D. M. and Carpita, N. C. (1991) Tracing cell-wall biogenesis in intact-cells and plants: selective turnover and alteration of soluble and cell-wall polysaccharides in grasses. Plant Physiol. 97, 551–561 50 Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996) A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis . Nature 379, 66–69 51 Ratcliffe, O. J., Amaya, I., Vincent, C. A., Rothstein, S., Carpenter, R., Coen, E. S. and Bradley, D. J. (1998) A common mechanism controls the life cycle and architecture of plants. Development 125, 1609–1615 52 Penfield, S., Meissner, R. C., Shoue, D. A., Carpita, N. C. and Bevan, M. W. (2001) MYB61 is required for mucilage deposition and extrusion in the Arabidopsis seed coat. Plant Cell 13, 2777–2791 53 Cosgrove, D. J. (2000) Loosening of plant cell walls by expansins. Nature 407, 321–326 Received 10 January 2011/20 October 2012; accepted 24 October 2012 Published as BJ Immediate Publication 24 October 2012, doi:10.1042/BJ20110060

c The Authors Journal compilation c 2013 Biochemical Society

54 Krebs, J., Mueller-Roeber, B. and Ruzicic, S. (2010) A novel bipartite nuclear localization signal with an atypically long linker in DOF transcription factors. J. Plant Physiol. 167, 583–586 55 Cress, W. D. and Triezenberg, S. J. (1991) Critical structural elements of the Vp16 transcriptional activation domain. Science 251, 87–90 56 Western, T. L., Young, D. S., Dean, G. H., Tan, W. L., Samuels, A. L. and Haughn, G. W. (2004) MUCILAGE-MODIFIED4 encodes a putative pectin biosynthetic enzyme developmentally regulated by APETALA2, TRANSPARENT TESTA GLABRA1, and GLABRA2 in the Arabidopsis seed coat. Plant Physiol. 134, 296–306 57 Arsovski, A. A., Popma, T. M., Haughn, G. W., Carpita, N. C., McCann, M. C. and Western, T. L. (2009) AtBXL1 encodes a bifunctional β-D-xylosidase/α-L-arabinofuranosidase required for pectic arabinan modification in Arabidopsis mucilage secretory cells. Plant Physiol. 150, 1219–1224 58 Brummell, D. A., Harpster, M. H., Civello, P. M., Palys, J. M., Bennett, A. B. and Dunsmuir, P. (1999) Modification of expansin protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening. Plant Cell 11, 2203–2216 59 Im, K. H., Cosgrove, D. J. and Jones, A. M. (2000) Subcellular localization of expansin mRNA in xylem cells. Plant Physiol. 123, 463–470

Biochem. J. (2013) 449, 373–388 (Printed in Great Britain)

doi:10.1042/BJ20110060

SUPPLEMENTARY ONLINE DATA

The transcription factor AtDOF4.2 regulates shoot branching and seed coat formation in Arabidopsis Hong-Feng ZOU1 , Yu-Qin ZHANG1 , Wei WEI, Hao-Wei CHEN, Qing-Xin SONG, Yun-Feng LIU, Ming-Yu ZHAO, Fang WANG, Bao-Cai ZHANG, Qing LIN, Wan-Ke ZHANG, Biao MA, Yi-Hua ZHOU, Jin-Song ZHANG2 and Shou-Yi CHEN2 State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

Figure S1

Expression of AtDOF genes in different organs of Arabidopsis shown by RT-PCR

Figure S2 Expressions of genes related to seed coat formation in Col0, transgenic plants overexpressing AtDOF4.2 (4.2-4, 4.2-8) or transgenic plants overexpressing TMD-mutated AtDOF4.2

1

These authors contributed equally to this work. Correspondence may be addressed to either of these authors (email [email protected] or [email protected]). The microarray been deposited into GEO database under the accession number GSE41682. 2


H. F. Zou and others

Figure S3 Shoot branching in various plant lines including Col-0, dof4.2 mutant, DOF4.4 RNAi lines with AtDOF4.4 suppression, and dof4.2/DOF4.4RNAi lines with suppression of both the AtDOF4.2 and AtDOF4.4 genes Error bars indicate S.D. (n = 15).


AtDOF4.2 affects branching and seed coat phenotype Table S1

Primers of 36 AtDOF genes

F, forward; R, reverse.

Figure S4 Downstream gene expressions in dof4.2, DOF4.4 RNAi and dof4.2/DOF4.4 RNAi plants Error bars represent the S.D.

Primer name

Locus

Primer sequence (5 →3 )

At Dof1.1 F AtDof1.1 R AtDof1.2 F AtDof1.2 R AtDof1.3 F AtDof1.3 R AtDof1.4 F AtDof1.4 R AtDof1.5 F AtDof1.5 R AtDof1.6 F AtDof1.6 R AtDof1.7 F AtDof1.7 R AtDof1.8 F AtDof1.8 R AtDof1.10 F AtDof1.10 R AtDof2.1 F AtDof2.1 R AtDof2.2 F AtDof2.2 R AtDof2.3 F AtDof2.3 R AtDof2.4 F AtDof2.4R AtDof2.5 F AtDof2.5 R AtDof3.1 F AtDof3.1R AtDof3.2 F AtDof3.2 R AtDof3.3 F AtDof3.3 R AtDof3.4 F AtDof3.4 R AtDof3.5 F AtDof3.5R AtDof3.6 F AtDof3.6 R AtDof3.7 F AtDof3.7R AtDof4.1 F AtDof4.1 R AtDof4.2 F AtDof4.2 R AtDof4.3 F AtDof4.3 R AtDof4.4 F AtDof4.4 R AtDof4.5 F AtDof4.5 R AtDof4.6 F AtDof4.6 R AtDof4.7 F AtDof4.7R AtDof5.1 F AtDof5.1R AtDof5.2 F AtDof5.2 R AtDof5.3 F AtDof5.3 R AtDof5.4 F AtDof5.4 R AtDof5.5 F AtDof5.5 R AtDof5.6 F AtDof5.6 R AtDof5.7 F AtDof5.7 R AtDof5.8 F AtDof5.8 R

AT1G07640

TGGCAACAACCAAGCTCAC CCAAATAGTCTGCGGAGGC AGCCCTCCTGGTTCTGATA GTCTCCTCGGTCTGGTCAA TACCACATGCCCGTCTACT TTCTCGTCGTTGTTGTCTA CTTCTATCGGGTCTATTCG TCACAACAGTTACCTCGTA AACATTCAACGCCAACATC ACTTCTCCGAGGCAACAAT CCGTTACTGGACTCAAGGT ACTCATAACCCATAGAACCTC CCGTCGCTGAGAAACCTGA CCCAAGCCATGCCTCCTCA GGTGAAGCAGCCGCTACTAAA GAGTGCGGGACGAAAGTAC ACGCTAGTTTCTACCCTGTC TCCCTTTGTCGTTGTCTTC GATCCACTTCAGAACCCTT CACAATACCCAAATACAGG GAATAAGAAGGGTAAATCCG AGAAGATAACCACGATGATCC CAAGAAGCCACAATAGCCG GCACAGCACCAACCATACG TACAGCCTCACTCAACCACG CTTACCTCTAGCCGCAGAA TTCCTCGTCGTCTCCTGTT ACCTATAACCTCACCCTAC CTCACAGCCTCGTCACTTT ATACCTCTAACCACCTTCG CGGCAAATCATTCCCAACG CACCTCCGCCATACCTCGT AAAGGTCTCAAACGGTGCT GGAATGACCTGGTAGGGTT ACTCTTCTTCCTCCTCTGTTT CCAATAACCATAGCCTCCA AACCGCTAATTCTGGCAACC CGGAGGTAAAGGACCACTT TACCTCCATCACAACAAGC CCCTCCATTGTCAAGAACC ACTACAGTCTCACGCAACC GGTTTAGGGATTATTCAGT TAATGACCTCAGCCTATCC TAATCTGTCCTTGCTCCTT GGTTTCTCAAATGATCTTG GCAACTTGTGTTCATCTTTGT TTGGTGGGAGTAGTCGTGC CTGGTTTAGTAGCGGATCG GAGTTTGTTCGATCTTTTGAC TGATTCATGTTCATAGCGTGG TTTCAGCCACGATACTTCT ACCACCATACCATTGTTTA GATTAGGACCAACTTCACTG TCTTCTTCCACCTCTTCCA CAAGTGTCCGAGATGTGATT GATTGAAGTTGGAACGGAGC GCAACGACCAATACCACCA CCACCTTCGTCACCTCCTC AACAGTCAGCCCGTTACCA CTGCTCTTGCGACGACTTG TACAGTCTCACTCAGCCTCG ACCTTCCATACAAACCCTG GCTTCGTCGGTTATTCCAG ATACCCTAAACTTGGCAAC CCAACTTCACATTACCACCAT CTGCTTCTGCTCTGCCACT CCAACATCGTTACCGCCAATA CCCTAAAGATGCCCTCCGT ATTCATCCAAATTCTTCCCTC CCTCGTTCGCTGCCTTTGA TATTCCTCTGCCGCTACCA AAAACCAGAACCCGAACCA

AT1G21340 AT1G26790 AT1G28310 AT1G29160 AT1G47655 AT1G51700 AT1G64620 AT1G69570 AT2G28510 AT2G28810 AT2G34140 AT2G37590 AT2G46590 AT3G21270 AT3G45610 AT3G47500 AT3G50410 AT3G52440 AT3G55370 AT3G61850 AT4G00940 AT4G21030 AT4G21040 AT4G21050 AT4G21080 AT4G24060 AT4G38000 AT5G02460 AT5G39660 AT5G60200 AT5G60850 AT5G62430 AT5G62940 AT5G65590 AT5G66940


H. F. Zou and others Table S2

Primers of 42 branching-related genes

Table S2

F, forward; R, reverse.

Primer name

Primer name

Locus

Primer sequence (5 →3 )

PINF PINR PIDF PIDR YUC1F YUC1R YUC2F YUC2R YUC4F YUC4R YUC6F YUC6R LASF LASR CUC1F CUC1R CUC2F CUC2R CUC3F CUC3R REVF REVR RAX1F RAX1R RAX2F RAX2R RAX3F RAX3R MAX1F MAX1R MAX2F MAX2R MAX3F MAX3R MAX4F MAX4R BRC1F BRC1R BUD1F BUD1R BRC2F BRC2R AMP1F AMP1R ARGOSF ARGOSR AXR1F AXR1R AXR2F AXR2R AXR3F AXR3R AXR6F AXR6R BPF BPR CALF CALR CKI1F CKI1R EMF1F

AT1G73590

CTGGTCCCTCATTTCCTTC CAAACGGTACTATTCCTTGC CGGCGACTATGTTTGAGCT TGACGACGGAAGAAGGAAT GGAGCAAAGTTTATGGATGG CTGCACATATTCCTGGTGG CATGTGGCTAAAGGGAGTG TTAACAATGTTGAGGACGAG AAACTCCCGTTCTTGATGT TAAGCCAATCGGGTACATT GCTTGTTGACCGTTTCCTT TTGATGCTCCACTAATCCC ACGGTGGTTCGGTAAGGAG TGCCAGCCAAGAAACAAAG AAGCGGCGTAGTTAGTAGA GATGATCCCAAATCCAGAA CCTGTTTCTCCACTGTCCCTA ACCGACCTTTGACTCATTCTC CTAACCAACTTCCCATCAC AACCCAACAGACCATAACT AGCGACGACTCGGTACTAAA AAGGCAAGCAAGCAAATCC CTCGGACAGCAACAACAAC AGATGAACCTGAACCACCC GGGAATAATGTTGTTGAGT TAATCTTCCATCACTACCG TTTTGCGACCAAGAAGATG GTGGAGGCTCCTGAGAACA CAAGGGAAACTGCTAAAGA GGATGAAAGCGTATGGATG TTTTGACGCCATTACCTAT GAATCTTTCCCATAAACTCA TCTAAACGGGTGGAACAAG GACCACGACAATGTAACCA GCTCAACGACCTTGTAACTT TTGGCTCTTGCTATTTCTTC AGCCAAGTGAATCGGAGTT TGATGCTGCTCAATGGAAT AGACATCAAACCTGCGAATC AAAGGGTGACCGAGAAGC TGAGACCTCGGAAACAATT CTCATCCACCGTTGCTATT CGCATCAGAGGGAATAAT GTGTTTGTTTCATAAATGG CAAGAGTTACGGCGGAGTT AGCAGCATAAACGGAGGC ATGTGGTTTCTGCCTTTG CTCTGTTTCAAGCCAATG TACGAGGACAAAGATGGT GGTGATAGCCACATACAAT GACTATGTTCCCTCTTATG CGATACCACTTATCCTTT GAGCAACTTAGCCGAATG TGAGCCAACCACTTCCAT GCACCACGCAGCTCTGTA CTCAAACTCCCCGAACGA ACGCCGCTTGAATAGACT CATTGCTCCCCGAAATAC TGCCAAATGCCAGAAATG GCTGCGTGCTGTCTACTT TCCTGAACCTGGGAATGT

AT2G34650 AT4G32540 AT4G13260 AT5G11320 AT5G25620 AT1G55580 AT3G15170 AT5G53950 AT1G76420 AT5G60690 AT5G23000 AT2G36890 AT3G49690 AT2G26170 AT2G42620 AT2G44990 AT4G32810 AT3G18550 AT1G18350 AT1G68800 AT1G68800 At3g54720 At3g59900 At1g05180 At3g23050 At1g04250 At4g02570 At4g08150 At1g26310 At2g47430 At5g11530

Received 10 January 2011/20 October 2012; accepted 24 October 2012 Published as BJ Immediate Publication 24 October 2012, doi:10.1042/BJ20110060


EMF1R ERF ERR ERA1F ERA1R LFYF LFYR MPF MPR PNHF PNHR SEUF SEUR SPS1F SPS1R STMF STMR TFL1F TFL1R TIR1F TIR1R CYP83B1F CYP83B1R

Continued Locus

At2g26330 At5g40280 At5g61850 At1g19850 At5g43810 At1g43850 At1g16410 At1g62360 At5g03840 At3g62980 AT4G31500

Primer sequence (5 →3 ) CCCTCTGCCTCAGTATCT TGCTATCGGAACAACCAC TTAAAGATTCTCCTCCTAAC GACACTCCTCCTTTGACTC TTCCCATACATTAGCAACAA ACGGAGGTAGTGGTTTGG TTATGTAACTCGCTCCTGATT TGCGTAAGGTGCATAAGG GGTCTCAAATCGGAACAA CAGCGTATTATGCTCATC CCGAACTACAAGCAAACAACCAAAC AGCCGTGATATTGTGCTT CCTGATGATGTGCCCTAA ACGCCTTGTTTCTTTCTC TTATTATGAAGTGACGGAG CCAGAGGAAACGGCATTG ATACCGAGAACCATAGATT TTCTTCTGTTTCCTCCAA AACCTATGTATCCCTATGC CTGAATGTGGAAGTCATCG TGTACCTCGTTTCTTTGTC CTTGCACCAACGAAACAC ATTAAAGGGACCCGAATA