to the decoy approach - NCBI

Nucleic Acids Research, 1994, Vol. 22, No. 15 3069-3074

Sequence-specific interaction of ae g-anomeric doublestranded DNA with the p50 subunit of NFxB: application to the decoy approach Hiroaki Tanaka*, Patrick Vickart1, Jean-Remi Bertrand, Bernard Rayner2, FranQois Morvan2, Jean-Louis Imbach2, Denise Paulin1 and Claude Malvy Laboratoire de Biochimie-Enzymologie, INSERM U140, CNRS URA147, Institut Gustave Roussy, rue Camille Desmoulins, 94805 Villejuif Cedex, 'Institut Pasteur, 25 rue du Docteur Roux, 75015 Paris and 2Laboratoire de Chimie Bio-Organique, CNRS UA488, Universite des Sciences et Techniques du Languedoc, 34060 Montpellier cedex, France Received May 3, 1994; Revised and Accepted July 5, 1994

ABSTRACT The potential use of a* 1-anomeric duplex oligonucleotides to inhibit transcription factor activity by the decoy approach is investigated in this report. Indeed, several a* 3-anomeric heteroduplexes display a sequence-specific interaction with the p50 subunit of the transcription factor NFxB. Used in a decoy approach, these duplexes interact strongly enough with this transcription factor to modulate the expression of a reporter gene, under the control of NFxB. However, all the a j3,-anomeric heteroduplexes do not interact with the p50 subunit; the sequence of the chirally natural ,3-anomeric strand may explain the different recognition properties of the protein. The analysis of the appropriate 3-anomeric sequences is consistent with a preferential interaction of the p50 subunit with one strand of double-stranded DNA.

INTRODUCTION ai-anomeric DNA is a chirally modified DNA (1) well known for its ability to hybridize specifically to the a- or j-anomeric complementary sequence (2) and its resistance to nucleases (3,4). Because of these features, a-anomeric DNA has been studied during recent years as a potential modulator of genetic expression, essentially in the antisense approach (4,5) which has been extensively studied during the last decade (6-8 for reviews). However, since RNase H does not degrade RNA hybridized to an a-anomeric DNA (9), a-antimessengers are usually directed at targets which are RNase H (10) independent (5,11). When forming a duplex, a-anomeric nucleotides induce singular structures (12,13). In particular, a ,B-anomeric heteroduplexes are parallel, whereas natural duplexes and at * a-anomeric duplexes are antiparallel (2). We have studied the interaction of these duplexes with the p50 subunit of the transcription factor NFxB which binds to DNA in a sequence-specific manner (14). *To whom correspondence should be addressed

An aspecific interaction between c* ,B-anomeric DNA and the reverse transcriptase of the Moloney murine leukemia retrovirus has been described (15). In this report, we show that two out of four possible a ,B3-anomeric heteroduplexes interact in a sequence-specific manner with the p50 subunit of NFxB. Furthermore, the affinity of the p50 subunit for these duplexes is high enough to modulate cellular genetic expression under the control of NFxB. It is noteworthy that decoy phosphorothioate duplexes possessing the NFxB recognition sequence inhibit HIV-1 LTR expression (16). Since few data are available on the toxicity of phosphorothioate derivatives (17), ax* 3 heteroduplexes can be potential candidates for the exploitation of decoy oligonucleotides in pharmacology. It is unclear why only two ca ,B-anomeric heteroduplexes interact with the p50 subunit of NFxB, but our findings indicate that this interaction correlates with the choice of the sequence of the ,B-anomeric strand. ax -3-anomeric DNA heteroduplexes provide an original model for the study of DNA -protein interaction and suggest asymmetric roles for the strands which form the natural DNA duplex recognized by the p50 subunit.

MATERIALS AND METHODS Oligodeoxynucleotide synthesis The a- and 3-anomeric oligonucleotides were synthesized in solid phase according to the phosphoramidite method on an Applied Biosystems model 381-A automated DNA synthesizer. The methylphosphoramidite and the cyanoethylphosphoramidite methods were used for the synthesis of a- and ,B-anomeric DNA respectively (18). Detritilated oligonucleotides were purified by HPLC. The sequence of the different synthesized oligonucleotides is as follows: Y-anomeric: a, 5' GGGGCTTTCCGCTGGGGCTTTCC 3' a25'GGAAAGCCCCAGCGGAAAGCCCC3' a3 5' CCCCGAAAGGCGACCCCGAAAGG 3' a4 5' CCTTTCGGGGTCGCCTTTCGGGG 3'

3070 Nucleic Acids Research, 1994, Vol. 22, No. 15 3-anomeric:

5' GGGGCTTTCCGCTGGGGCTTTCC 3'

25' GGAAAGCCCCAGCGGAAAGCCCC3' 03 5' CCCCGAAAGGCGACCCCGAAAGG 3' 04 5' CCTTTCGGGGTCGCCTTTCGGGG 3'

We adopted as a model sequence the decoy phosphorothioate duplex which inhibits efficiently HIV-1 replication (16). This sequence has two NFxB recognition sequences derived from the long terminal repeat of HIV-1. We replaced them by 5'GGGGCTTTCC3' which is recognized by NFxB in the vimentin promoter (19).

Purification of the fusion protein p50-GST The p50 subunit of NFxB, coupled to glutathione-S-transferase and expressed in E.coli was purified, as previously described (21). The plasmid construction was a kind gift from Pr A.Israel (Institut Pasteur, Paris). This construction does not allow the cleavage of the glutathion-S-transferase. Purification was followed by dialysis against Buffer L (Hepes pH8 7.5mM, NaCl 35mM, MgCl2 1mM, EDTA 0.05mM, DTT 0.5mM) at 4°C. Aliquots were then stored at -20°C and used within one month. Duplex formation a- or ,B-anomeric oligonucleotides were radiolabeled with ['y_32P] ATP (3000Ci/mmol, Amersham) by T4 polynucleotide kinase (Biolabs). Samples were then extracted with TE-saturated chloroform-isoamylic alcohol (24:1 v/v) and diethylether. Residual ATP was then eliminated on a Sephadex G25 column. Double-stranded oligonucleotides were formed at a final concentration of 1O00,M in TE pH8 by heating at 95°C for 5 min and cooling slowly down to room temperature. Were obtained eight duplexes (Table 1). Melting temperature determination Tm determination was performed in quartz cells at a concentration of 1,M for each strand of oligonucleotide in TE. Measurements werel made with a UVIKON 941 thermostated spectrophotometer coupled to a IBM PC compatible microcomputer. Tm was estimated as the maximum of the derivative of the optical density curve by the temperature (21), using a software (GraphPadInPlot) for the treatment of mathematical data.

Gel retardation assay and in vitro competition 20pmol radiolabeled duplex and 1.5/tg p50-GST were incubated in 1O,u Buffer L at room temperature for 15min. Longer incubation does not affect the binding efficiency (data not shown). No marker dye was added to the sample. The product was analysed on a native 6% polyacryamide 0.5% TBE gel under an 8V.cm-1 electric field for two hours at room temperature. The acrylamide/bis acrylamide ratio is 19/1. Autoradiography was then performed with dried gel. In order to compare the affmities of the different duplexes, constant amounts of labeled Al' (2 were first added to increasing amounts of non-labeled duplex. The mixture was then incubated with 2yg p50-GST in Buffer L in a final volume of 15,ud. Sample analysis was performed with the same protocol, as described above. Determination of equilibrium dissociation constants The KD value

was

determined

using

Scatchard

plot analysis

as

described (22). Duplexes (31*(2, (2c a4 and c1l,03 were radiolabeled as described above. Variable amounts (0.5-3.0

pmol) were incubated with 0.5ytg of p50-GST in the final volume of 50y1 and analysed by gel retardation assays. Gels were dried and band intensities were evaluated by Phosphorlmager (Molecular Dynamics). Linear regression was performed by a software for mathematical applications (Freelance Graphics version 4.0, Lotus Depelopment Corporation). CAT assay HeLa cells were grown in DMEM complemented with 10% foetal calf serum under 5% CO2. pVimCAT241 is a plasmid construction which expresses chloramphenicol acetyl-transferase in eukaryotic cells under the control of NFxB (21). Exponentially growing HeLa cells in 35mm dishes were transfected by the calcium phosphate method (23) with 5Ag plasmid and 0.2itg or 0.07yg tested duplex. CAT activity was analysed, as previously described, 48 hours later (24).

RESULTS The p50 subunit of NFxB recognizes ao *3 heteroduplexes in a sequence-specific manner Gel shift assays wee performed in order to detect interaction between the purified p50 subunit of NFxB and the oligonucleotides. This protein preparation provided only one band when analyzed by SDS -PAGE followed by the Coomassie Blue staining (data not shown). The eight single strands (CZL.a4,31A4) and the eight duplexes were screened. The latter included 2 ox * caanomeric duplexes (alca2 and C3Ca4, antiparallel), 2 X-3anomeric duplexes ((1(2 and O34, antiparallel) and 4 a,anomeric heteroduplexes ((13 a3, (2' a4, C1 (3 and (a2 -04 parallel). One retarded band, with only the (1 (32 natural duplex and the a4 (32 and ca1 3 heteroduplexes, was observed (Figure la). The single-stranded oligonucleotides were not recognized by p50. No sequence-specific interaction was detected with both a * a-anomeric double-stranded oligonucleotides (Ca Ia2 and a3'Ca4). In the case of the oa (3-anomeric heteroduplexes, only two of four possible combinations were recognized by the p50 subunit of NFxB. It is noteworthy that only one retarded band was observed, although the oligonucleotides possess two sequences recognized by NFxB. A plausible explanation is that the binding is not cooperative. As we have an excess of DNA in the binding reaction, only one site is occupied by a p50-GST dimer.

The duplexes are thermodynamically stable To verify whether the different duplexes were thermodynamically stable, their melting temperature was measured (Table 1). In all cases, the melting temperature was above 40°C. The duplexes were therefore stable under the experimental conditions (i.e. room temperature). Duplex formation can also be verified in a polyacrylamide electrophoresis assay which shows that duplexes migrate more slowly than single-stranded oligonucleotides (Figure lb). Thus, when no retarded band is detected in the lane, we think it may be due to a weak interaction between the duplexes and the protein and not because duplexes are destabilized and thus prevent protein interaction during incubation and/or migration. Natural (3-( duplex interacts slightly more strongly with p50-GST than modified ca ( duplexes To visualize the difference of affinity of duplexes with purified p50-GST, KD constants were determined (Figure 2). The natural

Nucleic Acids Research, 1994, Vol. 22, No. 15 3071

a

r-

_Retarded band

L

--_

A

C

B

A

i

I

I+

"-

[complex]/[oligo] 8

V

_.Z duplexFree'MI Am

Free

b

[complex] (nM)

B

4;

Figure 1. (a) Gel-shift assay. All the duplexes include two NFxB recognition sequences and are 32P-radiolabeled. Three duplexes display a retarded band ( 1I 023 lanes A; 2 - a4, lanes B; Cal (3, lanes C). Lanes +: incubation products with the purified p50 subunit of NFxB. Lanes -: control incubation without protein. (b) Comparison between the migration rate of single and double-stranded oligonucleotides. A single-stranded 13-anomeric oligonucleotide (132) iS 32P_ radiolabeled and submitted to the hybridization conditions (see Material and Methods) with different single-strand non-radiolabeled oligonucleotides. C: 132 single-strand alone. Cb: 132 plus the complementary ,B-anomeric strand (i81). The migration rate is decreased. NCca: 132 plus a non-complementary 13-anomeric strand (cal). The migration rate is not affected. Ca: 132 plus the complementary a-anomeric strand (a4). The migration rate is decreased.

[complex] (nM)

C

Table 1. Duplexes Tm, sequences and interaction with the p50 subunit of NFxB Sequence

Duplex Tm (°C)

B1

58.7

832 B2

53.6

04 0f2

Recognition by pS0

B 5' GGGGCTTTCCGCTGGGGCTTTCC 3' B3 3' CCCCGAAAGGCGACCCCGAAAGG 5'

Yes

B 5' GGAAAGCCCCAGCGGAAAGCCCC 3' 5' CCTTTCGGGGTCGCCTTTCGGGG 3'

Yes

5' GGAAAGCCCCAGCGGAAAGCCCC 3' B 5' CCTTTCGGGGTCGCCTTTCGGGG 3'

No

a

43.1

B4

a

60.5

a

5' GGGGCTTTCCGCTGGGGCTTTCC 3' 0 3' CCCCGAAAGGCGACCCCGAAAGG 5'

No

51.7

B 5' CCCCGAAAGGCGACCCCGAAAGG 3' B 3' GGGGCTTTCCGCTGGGGCTTTCC 5'

No

54.8

a

5' GGGGCTTTCCGCTGGGGCTTTCC 3' B 5' CCCCGAAAGGCGACCCCGAAAGG 3'

Yes

B1 03

54.3

B 5' GGGGCTTTCCGCTGGGGCTTTCC 3' a 5' CCCCGAAAGGCGACCCCGAAAGG 3'

No

a3

66.6

0 5' CCCCGAAAGGCGACCCCGAAAGG 3' 0 3' GGGGCTTTCCGCTGGGGCTTTCC 5'

No

a1

02 B3

84

01 83

04

Since all Tm were higher than 400C, all duplexes were stable at room temperature (i.e. experimental conditions). There is no obvious correlation between the recognition by p50 and the Tm.

5

10

15

20

[complex] (nM) Figure 2. Determination of equilibrium dissociation constants between purified p50-GST and natural and modified duplexes. Natural (013-,2) and modified

(123Ca4 and a1 13) duplexes characterized by the gel retardation assay as recognizing p50-GST were 32P-radiolabeled. Variable amount of them were incubated with a constant amount of purified p50-GST and analysed on native polyacrylamide gel. The KD values were determined using a Scatchard plot analysis. (A) Natural duplex 031 32. KD=3.3xlO-9 M. (B) Heteroduplex 132 *a4. KD=2.0x 10-8 M. (C) Heteroduplex a1 *,3 KD= 1.3 x 10-8 M. Initial p5O-GST concentration is approximatively estimated to 24nM (the x value for Y=°). 0102 natural duplex KD value is 16- to 25-fold higher than those of

12 a4 and a1-$3 heteroduplexes.

3072 Nucleic Acids Research, 1994, Vol. 22, No. 15

C

B

A

Inhibition (%) 120 1

-n r---- ~ 1 2 3 4 56

1 2 3 4 5 6 LLLJ L LL

1 2 3 4 5 6

WLLJII LJLi

100

1iLi L!_ 80

60

D 1 2 3 4 5 6 Li

LJ L_i

LI

E

40

1 2 3 4 5; 6 Li Li L

20

wI_IIII

ltl-IL2

912*a4 *0.3pM

Figure 3. Competition binding analysis with different duplexes. Natural-anomeric DNA possessing the NFxB recognition sequence (i8 (,02) was 32P-radiolabeled and used in the gel-shift assay with the purified p50 subunit of NFxB. Increasing amounts of the non-radiolabeled duplexes were added: the lanes with an number Only the retarded bands are n correspond to the competitor excess of 2"represented here. (A) natural-anomeric competitor (( I-$ 2). (B) a (3-anomeric competitor (22 *a4)- (C) ac* (-anomeric competitor (a1 (3). (D) a * -anomeric control (a2-04)-.(E) natural-anomeric control ((33*4). .

013 * 2 duplex interacts with p50-GST with a KD of 3.3x10-9M. The modified (2*a4 and ar*63 duplexes respectively display KD of 2.0 and 1.3 x 10-8M. The natural (31'02 duplex has an affinity for p50-GST approximatively 20-fold higher than the (2'a4 and CQj33 ones. We noted that the p50-GST concentration appears to be near to 24nM, corresponding to the x value for y=0 in the graphs. This value is low, considering that we used 0.5,ug of p50-GST, which is a 76kDa protein forming a 152kDa homodimer, in a final volume of 50y1A: the corresponding value would therefore be 66nM. We analysed gel used for retardation assay by silver staining (25) to visualize the bands of protein (data not shown). We observed two bands corrresponding to monomer and dimer. Their intensity was roughly equivalent. Compared to the autoradiography, the retarded band was approximatively superposable on the dimer. These data suggests that only dimers interact with oligonucleotides. a(3, heteroduplexes act as decoys in the competition assay To demonstrate that the 32 *a4 and a1 (33 heteroduplexes interact strongly enough with the purified p50 subunit of NFxB to be able to act as decoys, an in vitro competition assay was performed (Figure 3). We found that an increase in non-radiolabeled (32 *C4 and cxl (3 heteroduplexes decreased the intensity of the retarded band which corresponded to the complex formed by p50 and the radiolabeled (31 (32 natural-anomeric duplex. A strong decrease in the intensity of the retarded band only occurred with the duplexes which interacted with the p50 subunit of NFxB in the gel-shift assay. These data support a decoy mechanism. However, the (-anomeric duplex appeared to be 2- to 4-fold more efficient than the ac (-anomeric heteroduplexes in this assay, indicating that the natural duplex has a higher affinity for the p5O subunit than the a (3-anomeric heteroduplexes. This is consistent with the KD values of different duplexes, although kinetic parameters must be taken into account in this competition

al*.3

13.64

a214

LZO.lpM

Figure 4. Inhibition of the NFxB activity by the oligonucleotides. Co-transfection of HeLa cells was performed with both duplexes and pVim241CAT, a plasmid which expresses the CAT (chloramphenicol acetyl transferase) gene under the control of NFxB. CAT activity was analysed 48h after the transfection and compared to the CAT activity of the cells transfected by the plasmid alone. Duplex concentrations, 0.31tM and 0. I1tM, correspond respectively to the molar ratio of 1 plasmid to 100 duplexes and 1 plasmid to 30 duplexes. Results represent the mean the standard deviation (n=3).

experiment. A 64-fold excess was sufficient to inhibit almost completely binding of the p50 subunit to the radioactive substrates, for all duplexes recognized by the p50 subunit in the gel-shift assay. However, a slight aspecific effect was observed with control duplexes. Gene expression under the control of NFxB is inhibited by decoy a*( heteroduplexes Lilienbaum et al. showed the importance of NFxB in the activation of the expression of the vimentin gene (21,26). In particular, pVim241CAT possesses a truncated vimentin promoter. The deletion of the NFxB sequence in this plasmid reduces the expression of chloramphenicol acetyl transferase to a very low level in many human cell lines, including HeLa. We have studied the ability of the different duplexes to inhibit CAT expression by co-transfecting pVim24lCAT and the five duplexes tested. Such co-transfections did not disturb cell growth when cell numbers were counted and cell morphology appeared to be normal (data not shown). Results are shown in Figure 4. The three duplexes ((1-32, (2- a4 and (33) recognized by the p50 subunit of NFxB trigger about 90% inhibition when co-transfection is performed with the ratio of 102 duplexes to one plasmid (0.3,uM duplex) and at least 40% inhibition occurs with the ratio of 30 duplexes to one plasmid (0. l,uM duplex). As expected, the control duplexes ((3 (4 and c 2-34), which were not recognized by the p50 subunit of NFxB in the previous electrophoresis assays, displayed less than 20% inhibition of CAT expression even with the cotransfection ratio of 102 duplexes to one plasmid (0.3/tM duplex). As a high level of inhibition was only observed with the three duplexes recognized by the p50 subunit of NFxB ((i132s, (23CN4 and a1 (33) in the previous electrophoresis assays, we strongly suggest that inhibition is due to a decoy mechanism. a1

Nucleic Acids Research, 1994, Vol. 22, No. 15 3073

DISCUSSION We have described the sequence-specific interaction between the a$ (3-anomeric oligonucleotides and the p50 subunit of NFxB. Considering the KD values, their affinity for purified p50-GST were 16- to 25-fold lower when compared to the natural duplex. We investigated their ability to inhibit NFxB activity in a decoy approach. In fact, the same duplexes which form retarded bands with the purified p50 subunit in the gel-shift assay, are able to trap the subunit in the competition assay and inhibit CAT expression in the cellular test, which is consistent with the decoy approach mechanism. This observation is an extension of earlier studies conducted in our laboratory (15), which demonstrated a sequenceaspecific interaction between the reverse transcriptase of the Moloney murine leukemia virus (MoMLV) and duplexes formed with a-anomeric DNA and (-anomeric RNA. Since RNase H does not degrade RNA hybridized to an atanomeric DNA (9), ca-oligonucleotides do not appear to be appropriate for the antisense approach. However, ca -( heteroduplexes are new agents able to modulate gene expression in a decoy strategy (27). The target, NFxB, deserves attention for several reasons. Efficient inhibition of HIV-1 replication was obtained using decoy phosphorothioate oligonucleotides directed against NFxB (16), and tumor regression in mice was observed with antisense oligonucleotides anti-NFxB (28). The value of ca 3-heteroduplexes as potential pharmacological agents (29) will be determined once the results of studies on the toxicity of modified oligonucleotides have been obtained. The possibility of transporting these heteroduplexes into the cells is another essential point worth studying and work is in progress. The calcium phosphate co-transfection method has been chosen for the cellular assay. It is highly probable that each precipitate particle is formed by both the plasmid and the duplexes at a constant ratio and that cells expressing the CAT gene also contain the duplex oligonucleotides. Another advantage with this method is that precipitate formation is likely to protect the oligonucleotides from degradation in the culture medium and in the cells. It therefore appears relevant to study the efficiency of oligonucleotides. However, oligonucleotide protection by precipitate formation suppresses the major advantage of the aanomeric modification of the DNA, i.e. its resistance to degradation in the culture medium. In the in vitro competition and the cellular test of CAT activity inhibition, natural DNA did indeed appear to be more efficient than the ao (3-anomeric oligonucleotides in both cases. This result seems to be normal since the (3-anomeric duplexes were recognized by the p50 subunit with a higher affinity than the ca 3-anomeric heteroduplexes, but we suspect that modified DNA is probably more advantageous under more severe conditions of degradation. (3-anomeric The reason why only two of four possible heteroduplexes interact with the p50 is unclear. Previous studies established that NFxB induces DNA bending and contacts its recognition site in the major groove (30,31), but these data did not provide clear interpretation for the binding ability of different a (3heteroduplexes. There is neither no obvious correlation between interaction potency and the Tm which is a thermodynamic parameter. Here we propose a model based on asymmetric roles of the strands which constitute the sequence recognized by NFxB. Indeed we found that the a-anomeric duplexes were not recognized by the p50 subunit. A similar result was obtained with another sequence-specific DNA binding

protein, EcoRI, which did not recognize a * a-anomeric oligonucleotides (J.R.Bertrand, personal communication). In addition to these results, previous works showing the resistance of a-anomeric oligonucleotides to nucleases (3) suggest that this kind of DNA is poorly recognized by proteins. However, two ac * -anomeric heteroduplexes do interact with the p5O subunit, although they contain an a-anomeric strand. We suggest that the (-anomeric strand, which constitutes the duplex, plays an essential role in binding activity. In fact, all duplexes containing the (32 strand (0102 and 02 a4) interact with the p5O subunit of NFxB. Since the single-stranded (2 does not interact with the p5O subunit, it needs duplex conformation to display the binding property. Even though the a-anomeric oligonucleotide does not directly interact with the protein, it should be able to bear its complementary (3-anomeric strand in a favorable helix structure and thus be indirectly necessary for the interaction. It may appear odd that a1l(33 is recognized by the p5O subunit even though it does not contain the (2 strand. However, it should be recalled that the a* (-anomeric duplexes are parallel whereas the natural duplexes are antiparallel. DNA binding proteins are usually able to distinguish the 5' -3' orientation in natural duplexes. In our study, the natural-anomeric sequence 13- (2 was recognized by the p5O subunit in the gel-shift assay, whereas the ,3' 3,4 duplex, obtained by inversion of the 5' -3' orientation, did not interact with the protein. It is not easy to imagine NFxB effectuating such a distinction if the duplex is in the unnatural parallel configuration. We did however obtain a1(33 when we inversed the 5'-3' orientation of (2 (a4 which is the other a (3-anomeric heteroduplex recognized by the p5O subunit (Table 1). The 5' -3' distinction in the a * (3anomeric heteroduplexes by DNA-binding proteins is therefore a point which deserves further investigations. Physico-chemical studies and molecular modelization are in progress to test these hypotheses. Beyond their potential utility as artificial regulators of gene expression, a (3-anomeric heteroduplexes are new means of studying DNA -protein interaction.

ACKNOWLEDGEMENTS We thank Pr Alain Israel for the plasmid construction for the p5O-GST purification, Pr Jacques Paoletti for scientific and technical advice for the measurement of the Tm, M.Masafumi Tanaka for the electrophoresis bands scanning by PhosphorImager and Ms Lorna Saint Ange for editing the manuscript. This work was supported by the Institut de Formation Superieure Biom6dicale (IFSBM), Association de Recherche sur le Cancer (ARC) and a grant from the Agence Nationale de Recherche sur le SIDA (ANRS), Coordinate Action for Oligonucleotides.

a

a

-

REFERENCES 1. Uhlmann, E. and Peyman, A. (1990) Chemical Reviews, 90, 544-584. 2. Morvan, F., Rayner, B., Imbach, J.L., Chang, D.K. and Lown, J.W. (1986) Nucleic Acid Research 14, 5019-5035. 3. Thenet, S., Morvan, F., Bertrand, J.R., Gautier, C. and Malvy, C. (1988) Biochimie 70, 1729-1732. 4. Cazenave, C., Chevrier, M., Thuong, N.T. and Helne, C., (1987) Nucleic Acid Research 15, 10507-10521. 5. Bertrand, J.R., Imbach, J.L., Paoletti, C. and Malvy, C. (1989) B.B.R.C 164, 311-318. 6. Helene, C. (1991) European Journal of Cancer 27, 1466-1471. 7. Cohen, J.S. (1991) Pharnac. Ther. 52, 211-225.

3074 Nucleic Acids Research, 1994, Vol. 22, No. 15 8. Goodchild, J. (1991) Antisense research and Developement 1, 361-364. 9. Gagnor, C., Bertrand, J.R., Thenet, S., Lemaitre, M., Morvan, F., Rayner, B., Malvy, C., Lebleu, B., Imbach, J.L. and Paoletti, C. (1987) Nucleic Acids Research 15, 10419-10436. 10. Minshull, J. and Hunt, T. (1987) Nucleic Acids Research 16, 6433-6451. 11. Kole, R., Shukla, R.R. and Ahktar, S. (1991) Advanced Drug Delivry Reviews 6, 271-286. 12. Paoletti, J., Bazil, D., Morvan, F., Imbach, J.L. and Paoletti, C. (1989) Nucleic Acids Research 17, 2693-2704. 13. Lancelot, G., Guesnet, J.L. and Vovelle, F.(1989) Biochemistry 28, 7871 -7878. 14. Kieran, M., Blank, V., Logeat, F., Vandeckerckhove, J., Lottspeich, F., Le Bail, O., Urban, M.B., Kourilsky, P., Baeuerle, P.A. and Israedl, A. (1990) Cell 62, 1007-1018. 15. Bloch, E., Lavignon, M., Bertrand, J.R., Pognan, F., Morvan, F., Malvy, C., Imbach, J.L. and Paoletti C. (1988) Gene 72, 349-360. 16. Bielinska, A., Shivdasani, R.A., Zhang, L. and Nabel, G.J. (1990) Science 250, 997-1000. 17. Agrawal, S., Temsamani, J. and Tang, J.Y. (1991) Proc.Nad.Acad.Sci. USA 88, 7595-7599. 18. Morvan, F., Leonetti, J.P. and Imbach, J.L. (1988) Nucleic Acid Research 16, 833-847. 19. Lilienbaum, A., Duc Dudon, M., Alexandre, C., Gazzolo, L. and Paulin, D. (1989) Journal of Virology 64, 256-263. 20. Smith, D.B., Johnson, K.S. (1988) Gene 67, 31-40. 21. Petersheim, M. and Turner, D.H. (1983) Biochemistry 22, 256-263. 22. Meisterernst, M., Gander, I. and Winnaker, E.L. (1988) Nucleic acids research 16, 4419-4435. 23. Chen, C. and Okayama, H. (1987) Molecular and Cellular Biology 7, 2745-2752. 24. Gorman, C.M., Moffat L.F. and Howard, B.H. (1982) Molecular and Celluar Biology 2, 1044-1051. 25. Blum, H., Beier, H. and Gross, H.J. (1987) Electrophoresis 8, 93-99. 26. Lilienbaum, A. and Paulin, D. (1993), J.Biol.Chem. 268, 2180-2188. 27. Clusel, C., Ugarte, E., Enjolras, M., Vasseur, M. and Blumenfeld, M. (1993) Nucleic Acids Research 21, 3405-3411. 28. Higgins, K.A., Perez, J.R., Coleman, T.A., Dorshkind, K., McComas, W.A., Sarmiento, U.M., Rosen, C.A. and Narayanan, R. (1993) Proc.Natl.Acad.Sci. USA 90, 9901-9905. 29. Helene, C. and Toulrnd, J.J. (1990) Biochemica et Biophysica Acta. 1049, 99- 125. 30. Schreck, R., Zorbas, H., Winnacker, E.L. and Baeuerle, P.A. (1990) Nucleic Acids Research 18, 6497-6502. 31. Thanos, D. and Maniatis, T. (1992) Cell 71, 777-789.