Inflammation ( # 2015) DOI: 10.1007/s10753-015-0262-6
ORIGINAL ARTICLE
Toxoplasma gondii Infection Promotes Neuroinflammation Through Cytokine Networks and Induced Hyperalgesia in BALB/c Mice Hossein Mahmoudvand,1 Naser Ziaali,1 Hamed Ghazvini,2 Saeideh Shojaee,3 Hossein Keshavarz,3 Khadijeh Esmaeilpour,2 and Vahid Sheibani2,4
Abstract—We hypothesized that in Toxoplasma gondii infection, communication among immune cells promotes neuroinflammation through cytokine networks and induces pain sensitivity under conditions of neuropathic pain. The animal model of Toxoplasma infection was established by the intraperitoneal inoculation of 20–25 tissue cysts from Tehran strain of T. gondii to BALB/c mice. Amitriptyline (20 mg/ kg, i.p., 1/day) administrated to animals for 7 days before behavioral tests. Pain behavioral tests including tail flick, hot plate, and formalin test were evaluated in all the groups. The mRNA levels of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 were examined by real-time PCR. Results revealed that T. gondii induce hyperalgesia in the infected mice, whereas amitriptyline showed a promising effect against the hyperalgesia induced by Toxoplasma infection. The mRNA levels of the aforementioned cytokines significantly (P < 0.05) increased in the infected mice compared to the uninfected ones. Obtained findings suggested that T. gondii infection could promote neuroinflammation through cytokine networks and induced hyperalgesia in BALB/c mice, whereas amitriptyline as an analgesic drug reverses them. KEY WORDS: Toxoplasma gondii; neuroinflammation; amitriptyline; pain; cytokine.
INTRODUCTION Toxoplasma gondii is a neurotropic parasite that is considered one of the world’s most successful pathogens. This parasite has remarkable transmissibility and has permanently infected a wide range of warm-blooded animals and approximately one third of the world’s human population [1]. Normally, humans can be infected by three main routes of transmission: (i) ingestion of tissue cysts in raw or 1
Research Center for Tropical and Infectious Diseases, Kerman University of Medical Sciences, Kerman, Iran 2 Neuroscience Research Center, Neuropharmacology Institute, Kerman University of Medical Sciences, Kerman, Iran 3 Department of Medical Parasitology & Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran 4 To whom correspondence should be addressed at Neuroscience Research Center, Neuropharmacology Institute, Kerman University of Medical Sciences, Kerman, Iran. E-mail:
[email protected]
undercooked infected meat, (ii) ingestion of food or water contaminated with sporulated oocysts shed in the feces of an infected cat, and (iii) congenitally, vertical transmission from mother to fetus across the placenta when the mother is formerly infected through one of the two previously mentioned routes during pregnancy [2]. The clinical symptoms of T. gondii infections are different from asymptomatic to serious illness affecting lymph nodes, the eyes, and the central nervous system (CNS). After an acute infection, tachyzoites can escape from the immune system, leading to the formation of tissue cysts containing bradyzoites, especially in the CNS [3]. During latent infection in the CNS, T. gondii cysts can influence neuronal cell biology, including neurotransmitter synthesis and signal transduction [4, 5]. Pain is a major problem in clinic and a common cause to seek physician consultation. According to the World Health Organization, over one fifth of the world population has experienced some degree of chronic pain [6]. Basically,
0360-3997/15/0000-0001/0 # 2015 Springer Science+Business Media New York
Mahmoudvand, Ziaali, Ghazvini, Shojaei, Esmaeelpour, and Sheibani pain can be divided into nociceptive and neuropathic pain. Nociceptive pain results from direct activation of pain nerve fibers, either due to chemical or mechanical mediators. Neuropathic pain refers to pain that is generated or sustained by the conditions that damage the nervous system, including various direct nerve injuries and diseases such as diabetes, alcohol abuse, zoster, HIV, Lyme disease, or conditions involving the central nervous system [7]. The hyperalgesia was characterized by lowered pain thresholds and enhanced magnitude of pain to normally painful stimuli. To develop novel therapeutic strategies, an improved understanding of the mechanisms that drive chronic pain is required. Growing evidence indicates that several types of immune cells play crucial roles in chronic neuroinflammation associated with neuropathic pain [8–10]. Neuronal damage induces the migration of immune cells, such as macrophages, neutrophils, and T lymphocytes (T cells), and these cells release inflammatory cytokines [e.g., interleukin (IL)-1β] and chemokines [e.g., tumor necrosis factor (TNF)-α], triggering chronic neuroinflammation following peripheral nerve injury and contributing to the development of neuropathic pain [11]. It is well known that parasites elicit robust innate and TH1-adaptive immune responses in the CNS, where the expression of inflammatory cytokines has both protective and pathological effects [12, 13]. While vital for restricting parasite replication and spread, inflammatory responses can cause bystander injury of uninfected neurons and can additionally influence neurotransmitter functions and synaptic transmission [14–16]. We hypothesized that in T. gondii infection, communication among immune cells promotes neuroinflammation through cytokine networks and induces pain sensitivity under conditions of neuropathic pain. This study aims to evaluate the relationship between T. gondii infection and pain sensitivity in mice model. Moreover, several studies have demonstrated the efficacy of antidepressants in animal models or clinical trials, thus confirming their usefulness in the treatment of pain, particularly neuropathic pain [17–20]. Thus, as secondary objective of this study, we hypothesized whether administration of amitriptyline has a protective role on hyperalgesia induced by T. gondii in BALB/c mice.
12:12-h light/ dark cycle at 21±2 °C and were handled according to standard protocols for the use of laboratory animals. During the tests, the temperature of the room and humidity were controlled. For the experiments, the animals were selected randomly into four groups: non-infected m i c e ( c o n t r o l ) , i n f e c t e d b y T. g o n d i i ( T G ) , T. gondii+amitriptyline (TG+Am) (20 mg/kg, i.p, 1/day), and control+amitriptyline (control+Am) (20 mg/kg, i.p, 1/day). Amitriptyline (Sigma-Aldrich, USA) was dissolved in saline and administered to the animals for 7 days before pain behavioral tests. Each group consisted of three subgroups (six per each), and each mouse was used only once. Parasite The Tehran strain of T. gondii which was kindly provided by Prof. Keshavarz of Tehran University of Medical Sciences (Tehran, Iran) was used throughout the experiment. Tehran strain of T. gondii infected mice chronically and lacks the acute infectivity of other strains. It was maintained by intraperitoneal inoculation of cysts (15–20 cysts) from brain tissue of infected BALB/c mice every 3 months. Animal Model of Toxoplasma Infection In this study, animal model of Toxoplasma infection was established as described previously elsewhere [21]. Brain homogenized suspension in saline was prepared from the mice infected with tissue cysts of T. gondii 3 months earlier. Then, 0.5 ml of brain suspension containing 20–25 tissue cysts was inoculated intraperitoneally to each of male BALB/c mice. After 2 months, all mice were tested for anti-T. gondii antibodies by serological tests. Serological Tests In order to confirm Toxoplasma infection in tested mice, collected serum samples were examined for antiT. gondii IgG antibody via the modified agglutination test (MAT) using a commercial kit (Toxoscreen DA, Biomérieux, Lyon, France) in accordance with the manufacturer’s instructions and starting at a 1/20 dilution. Sera showing an agglutination titer of 1/20 or higher were considered positive and were end-titrated using twofold dilutions.
MATERIALS AND METHODS Pain Behavioral Experiments Animals Seventy-two male BALB/c mice (6–8 weeks old) weighing from 18 to 24 g were obtained from the Animal Breeding Stock Facility of Razi Institute of Iran (Karaj, Iran). Animals were housed in a colony room with a
Three months after the establishment of animal model of Toxoplasma infection, the pain behavioral experiments were scored by trained observers blind to experimental conditions. The experiments were performed between 8:00 a.m. and 3:00 p.m.
Toxoplasma gondii infection induces hyperalgesia Tail Flick Test Thermal pain threshold of all animals in each test group was evaluated using tail flick test based on the method described elsewhere [22]. Briefly, the animal withdraws its tail when exposed to the concentrated burning light on the middle one third of the tail, after a while (latency time). Light intensity of the tail flick apparatus (Sparco, Iran) was adjusted to make a 2 to 4 s latency time in the intact animal. A cutoff time of 10 s was considered to prevent any possible tissue damage. Latency time was recorded thrice with 15-min interval for each set of the tail flick test; the mean was considered as a thermal pain threshold (tail flick latency). Hot Plate In this test, pain sensitivity of all animals in each test group was evaluated by using an apparatus (LE710 model, Lsi LETICA, Spain) that contained a plate with the diameter of 19 cm and a Plexiglas wall with height of 30 cm. Plate temperature was adjusted to 55±0.2 °C. Response time to thermal pain was considered as the time between test onset and licking front paw or jumping (maximum cutoff was considered 60 s) [22]. Formalin Test Twenty microliters of a dilute solution of formalin (2.5 % v/v) was injected subcutaneously under the plantar surface of the right hind paw of each mouse. Then, the mice were moved to an observation chamber with a mirror at its bottom to make the observation of paw licking easier. Formalin-induced pain was scored in blocks of 5 min every 15 s during 45 min using the following scoring system. The injected paw is not favored, 0; the injected paw has little or no weight on it, 1; the injected paw is elevated and is not in contact with any surface, 2; and the injected paw is licked, bitten, or shaken, 3. Two distinct periods of licking activity were identified: the early response (neurogenic phase) and the late (inflammatory phase) one that were recorded during 0–5 and 15–45 min, respectively [23]. Analysis of Cytokine mRNA Expression by Real-Time PCR Since cytokines, signaling molecules of the immune system, have been implicated as a contributing factor for pain, the mRNA levels of TNF-α, IL-1β, and IL-6 were examined in T. gondii-infected BALB/c mice by quantitative real-time PCR. Under deep anesthesia, the animals were sacrificed and their brains removed. Total RNAs from
brain tissue samples were isolated using RNeasy kits (QIAGEN, Hilden, Germany); all samples were reverse transcribed using RT premix kit (Intron, Sungnam, Korea) according to the manufacturer’s protocol. The resulting complementary DNA (cDNA) was subjected either to conventional PCR amplification or real-time PCR. Real-time PCR was performed using the Rotor-Gene Q detection system (QIAGEN, Hilden, Germany), and SYBR green was used to detect amplification products, as described previously elsewhere [24]. The reaction conditions used were as follows: initial denaturation at 95 °C for 10 min and 40 amplification cycles [denaturation at 95 °C for 10 s, annealing at 56 °C for 30 s, and elongation at 72 °C for 30 s], followed by one cycle at 72 °C for 5 min. The housekeeping gene encoding β-actin was used as a normalization control. The ΔΔCt method was used to quantify the expression of four selected target genes. Primer sequences used for TNF-α, IL-1β, IL-6, and βactin are shown in Table 1. Statistical Analysis Obtained results are expressed as the mean±SEM. Data analysis was carried out by using SPSS statistical package version 17.0 (SPSS Inc., Chicago, IL, USA). One-way ANOVA with Tukey’s post hoc test was used to assess differences between experimental groups. In addition, P1/20. Figure 1 Table 1. Sequences of Primers Used for Real-Time PCR in the Present Study Amplicon
Primers
Sequence (5′–3′)
Size (bp)
IL1-β
F R F R F R F R
AACCTGCTGGTGTGTGACGTTC CAGCACGAGGCTTTTTTGTTGT ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG GTGACGTTGACATCCGTAAAGA GCCGGACTCATCGTACTCC
78
IL-6 TNF-α β-actin
129 89 245
Mahmoudvand, Ziaali, Ghazvini, Shojaei, Esmaeelpour, and Sheibani
Fig. 1. Tissue cysts of T. gondii Tehran strain isolated from the brain of infected mice (×10 and ×40). a Periodic acid–Schiff (PAS) stain, b hematoxylin and eosin staining, c Giemsa staining.
also shows tissue cysts of T. gondii Tehran strain isolated from the brain of infected mice.
with TG group (P < 0.01) but not compared with control and control + Am groups.
Tail Flick Test
Hot Plate
As shown in Fig. 2, significant difference was observed in the tail flick latency measured among the four groups of study. The results demonstrated that the thermal pain threshold significantly (P < 0.001) decreased after Toxoplasma infection in BALB/c mice in comparison with other groups. In the TG + Am group, tail flick latency was significantly increased compared
In mice with T. gondii infection, a significant decrease in reaction time was observed in TG (P
