uncorrected proof

Virus Research xxx (2017) xxx-xxx

Contents lists available at ScienceDirect

Virus Research

PR OO F

journal homepage: www.elsevier.com

The HBx gene of hepatitis B virus can influence hepatic microenvironment via exosomes by transferring its mRNA and protein Neetu Rohit Kapoora⁠ , Radhika Chadhaa⁠ , Saravanan Kumarb⁠ , Tenzin Choedona⁠ , Vanga Siva Reddyb⁠ , Vijay Kumara⁠ ,⁠ ⁎⁠ a b

Virology Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India Plant Transformation Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India

ABSTRACT

Keywords: Hepatitis B virus HBx protein Exosome Hepatic stellate cells Liver disease Neutral sphingomyelinase2

The cellular secretory vesicles known as ‘exosomes’ have emerged as key player in intercellular transport and communication between different eukaryotic in order to maintain body homeostasis. Many pathogenic viruses utilize exosome pathway to efficiently transfer bioactive components from infected cells to naïve cells. Here, we show that HBx can tweak the exosome biogenesis machinery both by enhancing neutral sphingomyelinase2 activity as well as by interacting with exosomal biomarkers such as neutral sphingomyelinase2, CD9 and CD81. The nano particle tracking analysis revealed enhanced secretion of exosomes by the HBx-expressing cells while confocal studies confirmed the co-localization of HBx with CD9 and CD63. Importantly, we observed the encapsulation of HBx mRNA and protein in these exosomes besides some other qualitative changes. The exosomal cargo secreted by HBx-expressing cells had a profound effect on the recipient hepatic cells including creation of a milieu conducive for cellular-transformation. Thus, the present study unfolds a novel role of HBx in intercellular communication by facilitating horizontal transfer of viral gene products and other host factors via exosomes in order to support viral spread and pathogenesis.

UN CO RR EC TE D

ARTICLE INFO

1. Introduction

Exosomes are nano-sized particles shed in the extracellular milieu by most cells. Exosomes are present in nearly all body fluids and are known to carry various bioactive molecules including proteins, DNA, mRNAs, and non-coding RNAs (reviewed in Braicu et al., 2015; Colombo et al., 2014). These molecules are specifically sorted and loaded in exosomes during its biogenesis (Dreyer et al., 2016; Trajkovic et al., 2008). Exosomes are now recognized as a new class of intercellular communicators that allow horizontal transfer of information to recipient cells by virtue of their cargo both in health and disease (reviewed in Ratajczak and Ratajczak, 2016; Regev-Rudzki et al., 2013; Schorey et al., 2015; Tkach and Théry, 2016). For example, exosomes derived from hepatocytes are able to drive the cellular machinery to

produce sphingosine-1-phosphate in target hepatocytes resulting in cell proliferation and liver regeneration (Nojima et al., 2016). Besides, an active communication between stromal and parenchymal cells holds the key for maintenance of tissue homeostasis which when perturbed can create a microenvironment conducive for diseased conditions (Syn et al., 2016). Likewise, the hepatic stellate cells (HSCs) that are known to contribute towards hepatic fibrosis, are activated by neighbouring parenchymal, non-parenchymal or hepatic immune cells via a paracrine mechanism (Greuter and Shah, 2016). The hepatic fibrosis subsequently progresses to irreversible liver cirrhosis and/or hepatocellular carcinoma. Increasing evidence suggests that exosomes also play a critical role in cancer development and metastasis by modulating the genetic and epigenetic events related to cancer (Melo et al., 2014; Soung et al., 2016). The altered production of exosomes and aberrant exosomal contents could reflect the pathological state of the body.

Abbreviations: PBS, phosphate buffer saline; EGFR, epidermal growth factor; αSMA, α smooth muscle actin; TGFβ, transforming growth factor β; col1a, collagen 1A; col3A, collagen 3A; MBP, maltose binding protein; BSA, bovine serum albumin; D2O, deuterium oxide; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; DMSO, dimethyl sulfoxide; ng, nanogram; EDTA, ethylenediaminetetraacetic acid. ⁎ Corresponding author at: International Centre for Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, New Delhi 110067, India. Email address: [email protected] (V. Kumar) https://doi.org/10.1016/j.virusres.2017.08.009 Received 8 April 2017; Received in revised form 2 August 2017; Accepted 21 August 2017 Available online xxx 0168-1702/ © 2017.

N.R. Kapoor et al.


tion media 24 h post transfection. LX-2 cells were a kind gift from Dr. Scott Friedman (Mount Sinai School of Medicine, New York, NY) and were maintained in DMEM supplemented with 2% FBS. The HBx expression plasmid, X0 and the vector control (pSG5) have been described earlier (Kumar et al., 1996). The expression and purification of Maltose-binding protein (MBP) and recombinant HBx protein (X0-MBP) are described elsewhere (Sidhu et al., 2014). pGFP-HBx was procured from Addgene (Addgene plasmid #24931). The nSMnase2 expression plasmid was a kind gift from Dr. Takahiro Ochiya (Kosaka et al., 2010).

PR OO F

Therefore, the biologically active cargo of exosomes could be a potential source of circulating biomarkers and therapeutics (Ko et al., 2016; Schey et al., 2015; Sheridan, 2016). Exosomes and cell-to cell communication are also reported to be play an important role in immune regulation and antiviral response during viral infection (Alenquer and Amorim, 2015). Human pathogenic viruses such as human immunodeficiency virus-1 (Madison and Okeoma, 2015; Wiley, 2006), human papillomavirus (Honegger et al., 2013) and members of herpes virus family such as human herpes virus (Mori et al., 2008), herpes simplex virus (Kalamvoki and Deschamps, 2016) and Epstein-Barr virus (Canitano et al., 2013) have been shown to use exosomal secretory pathways in disease pathogenesis and viral spread. Exosomes derived from the blood of hepatitis C virus (HCV)-infected patients have been shown to carry viral RNA and host proteins Ago2 and HSP90 which facilitate viral transmission to naïve cells and remains unaffected in the presence of neutralising antibodies (Bukong et al., 2014; Ramakrishnaiah et al., 2013). However, HCV replication can be inhibited by using exosomes isolated from interferon-stimulated liver endothelial cells suggesting transfer of some antiviral activity through exosomes (Giugliano et al., 2015). It has been observed that interferon-alpha stimulated liver cells secrete exosomes that can attenuate hepatitis B virus (HBV) replication (Li et al., 2013). Further, the core protein of HCV can enhance the crosstalk between hepatocytes and stromal environment via exosomes by activating TGFβ signalling pathway (Benzoubir et al., 2013) while exosomal microRNAs derived from hepatic tumour cells can regulate healthy liver cells by autocrine and paracrine mechanisms (Kogure et al., 2011). However, the role of exosomes in HBV life cycle and associated liver diseases is poorly understood. Chronic infection with HBV is a major cause of liver fibrosis, eventually leading to cirrhosis and hepatocellular carcinoma (HCC). The pleiotropic HBx protein of HBV is known to abet oncogenic activities by multiple mechanisms including stimulation of host genes, mitogenic signalling, and interference with cell cycle, proteasomal machinery, ribosome biosynthesis (reviewed in Kumar and Sarkar, 2004; Slagle and Bouchard, 2016). Besides, HBx is reported to regulate the neighbouring hepatic cells by paracrine mechanisms (Martín-Vílchez et al., 2008). However, there is no evidence suggesting the involvement of HBx in exosome biogenesis or alteration of its molecular cargo. Now we show that both HBx mRNA and protein get encapsulated in exosomes and shed in the extracellular milieu. The exosomal cargo secreted by the HBx-expressing cells is qualitatively as well as quantitatively different. Further, these exosomes can induce proliferative signalling in HSCs which may contribute towards HBV-associated liver diseases.

2.3. Confocal microscopy

UN CO RR EC TE D

Huh7 cells were seeded and transfected with pGFP-HBx on 8 well chambered slides (SPL Life Sciences, Korea). Media was aspirated after 48 h and cells were washed once with 1 x PBS and fixed with 4% paraformaldehyde. Permeabilization was done with 0.1% triton X-100 in 1 x PBS at RT followed by blocking with 10% serum in PBS. Cells were incubated with primary antibody against CD81 or CD63 at a dilution of 1:250 in blocking solution followed by secondary Alexa fluor 594 goat anti mouse IgG (H + L) (Molecular probes, Life Technologies, USA). The slides were mounted in ProLong Gold anti-fade reagent with DAPI (Molecular Probes, Life Technologies, USA) and images were captured at 60 x magnification in Nikon A1R confocal microscope and images were processed and co-localisation coefficient was derived using NIS elements AR version 3.0 (Nikon, Japan). 2.4. Exosome isolation and purification Exosomes were isolated from conditioned media as described by Kosaka et al. (2010). Briefly, cells were cultured in 1 x DMEM (Gibco BRL) with 10% FBS for 24 h post transfection. Cells were washed twice with large volumes of 1 x PBS [137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2⁠ HPO4 and 1.47 mM KH2⁠ PO4) in H2⁠ O, pH adjusted to 7.4] and then were maintained in 1 x Advanced medium (Gibco BRL) for 48–72 h. The conditioned media from the cell lines was collected and spun at 2000 × g for 15 min at room temperature (RT) and then at 12,000 × g for 35 min at RT. The medium was filtered through a 0.22 μ filter and then ultra-centrifuged at 110,000g for 70 min at 4 °C. The pellets was washed with 1 x PBS followed by ultracentrifugation as above. The final exosome pellet was re-suspended in either 1 x PBS or Assay buffers and its protein content was measured by Bradford assay. The exosomes were also isolated using Total Exosome Isolation Solution (TEIS) (Invitrogen, Carlsbad, California) as per manufacturer’s instructions. Briefly, after the filtration, the conditioned medium was mixed with TEIS in 2:1 ratio and left overnight at 4 °C with gentle agitation. The sample was then spun at 10000 x g for 60 min at 4 °C and the supernatant was discarded. The pellets was re-suspended in 1xPBS followed by spin once again as above. The final pellet was re-suspended either in 1xPBS or in 500 μl of Trizol reagent (Ambion, Life Technologies, USA) as per the experimental requirements.

2. Materials and methods

2.1. Antibodies and chemicals

Antibodies against CD63 was procured from BD Biosciences, while antibodies against CD81, PCNA, pAkt, Alix, nSMnase2, HBx, and GAPDH were obtained from Santa Cruz Biotechnology (USA). Antibodies against CD9, c-Met and αSMA were from EMD Millipore (USA) whereas 10 nm colloidal gold-conjugated Protein A was purchased from Genetix Biotech, India. RNase A and yeast tRNA (both 10 mg/ml) and DNAse I (1 unit/μl) were procured from Thermo Fisher Scientific, USA.

2.5. Sucrose cushion purification Floatation of exosomes on sucrose cushion was essentially done as described by Théry et al. (2006). Briefly, the exosome pellet collected after ultracentrifugation step as described above, was suspended in ∼28 ml of 1xPBS and was gently overlaid on a 4 ml cushion of Tris/ Sucrose/D2⁠ O in a pollyallomer tube and spun in SW 32 rotor (Beckman Coulter, USA) at 1,10,000 x g for 70 min at 4°C. The tube was punctured from the side with a syringe fitted with 18 gauge needle and ∼3.5 ml of the Tris/sucrose/D2⁠ O cushion was collected. The sample volume was made up to 11 ml and spun again under same conditions

2.2. Plasmids, cell culture and transfection

Huh7 cells were kindly provided by Dr Aleem Siddiqui (University of Colorado, Denver). The cultures were maintained and transfected as described earlier (Kapoor et al., 2013). Cells were put in exosome isola

2

N.R. Kapoor et al.


in a SW41 rotor. The pellet obtained after this spin was collected and re- suspended in appropriate assay buffers.

hasten nucleic acid precipitation. The final RNA pellet was re-suspended in nuclease free water and quantified by Nanodrop. Total exosomal RNA (50 ng) was used to quantify HBx mRNA by TaqMan assay.

2.6. Incubation of hepatic stellate cells with exosomes

2.10. Treatment of exosomal RNA with RNAse a and DNase I

PR OO F

LX-2 cells were seeded in 12 well plates. After 24 h, cells were thoroughly washed with 1 x PBS to remove any serum-associated exosomes and incubated in Advanced media for next 24 h. Cells were then incubated with purified exosomes (∼1 μg protein) for 24 h and the harvested for western blot or qRT-PCR analysis.

Total exosomal RNA (∼500 ng) was treated with 10 μg of RNAse A for 30 min at 37 °C. Following incubation the enzyme was inactivated by addition of RNAse Inhibitor (40units/μL). For DNase I treatment, exosomal RNA preparation was incubated with 1 unit of DNAse I for 10 min at 37 °C. The reaction was inactivated by addition of 50 mM EDTA followed by heating at 65 °C for 10 min.

2.7. Western blotting and immuno-precipitation Exosome samples or cells lysates were denatured by boiling in 4 x Laemmli buffer. Non reducing conditions were used for anti-CD63 and anti-CD81 antibodies. Equalised amount of total cell lysates were analysed by WB as described earlier (Kapoor et al., 2013). For immunoprecipitation, exosome pellets obtained after ultracentrifugation were re-suspended in 1xPBS supplemented with BSA (2 mg/ ml) and incubated with anti-CD9 antibody at 4 °C overnight. The vesicles bound to the antibody were then collected by further incubation 4 °C for 2 h with 50% slurry of protein A/G (1:1) agarose beads. The beads were washed twice with 1xPBS supplemented with BSA (2 mg/ ml) followed by a final wash of 1xPBS. The beads were either suspended in 2 x Laemmli buffer (0.1% 2-mercaptoethanol, 0.0005% bromophenol blue, 10% Glycerol, 2% SDS (electrophoresis-grade), 63 mM Tris-HCl (pH 6.8)) for analysis by western blotting or solubilised in 1 ml Trizol for RNA isolation.

2.11. Taqman based quantification of RNA

UN CO RR EC TE D

RNA isolated from cells or exosomes was quantified by Nanodrop and equal amount of RNA from each sample was subjected to quantification by qRT PCR coupled cDNA synthesis using SuperScript III Platinum One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, California). The reaction mix was prepared following manufacturer’s instructions. Briefly, mastermix was composed of 1 x final concentration of reaction mix with ROX, SSIII RT/Platinum Taq Mix, and 0.2uM each of Forward (ACCTCTCTTTACGCGGACTC) and Reverse primer (AAGACCTTGGGCAAGAAGTG) along with FAM-TAMRA coupled Taqman probe (CGTCGCATGGAGACCACCGT). The mastremix was added to the RNA sample and contents were mixed followed by brief centrifugation. PCR was carried out in 96-well plates using Step One Plus Real Time PCR thermal cycling block (Applied Biosystems, USA). The qRT-PCR steps involved initial incubation at 55 °C for 20 min and denaturation of 95 °C for 2 min, followed by 40 cycles of PCR at 95 °C for 30 s (denaturation), 55 °C for 30 s (annealing) and 60 °C for 30 s (extension). The threshold cycle (Ct) values were noted and normalised with total input RNA. Each sample was done in duplicate and each experiment was validated at least thrice.

2.8. Cellular RNA isolation and quantitative real-time PCR (SYBR green approach)

Total RNA isolation, reverse transcription and qRT PCR have been described previously (Kapoor et al., 2013). Actin or GAPDH were used as internal control. Quantitative PCR was carried out in 96-well plates using Step One Plus Real Time PCR thermal cycling block (Applied Biosystems, USA). All reactions were done in triplicate. Analysis was performed with the ΔΔCt method (Schmittgen and Livak, 2008). Primers sequences are as follows: Rab27a Forward (TGGGAGACTCTGGTGTAGGG) Reverse (AGGTGGATTCTCTGGCCTCT); Rab27b Forward (GTTCCGGAGTCTCACCACTG) Reverse (TGCAGTTGGCTCATCCAGTT); nSMnase2 Forward (GCGTTTCTCGGCTTTCTCTTC) Reverse (TTCCATTCACTGAGCAGGGC); Actin Forward (ACCAACTGGGACGACATGGAGAAA) Reverse (TAGCACAGCCTGGATAGCAACGTA); EGFR Forward (CGGGACATAGTCAGCAGTG) Reverse (GCTGGGCACAGATGATTTTG); αSMA Forward (GTTTCCGCTGCCCAGAGA) Reverse (TGGTGCCCCCTGATAGGA); TGFβ Forward (CACGTGGAGCTGTACCAGAA) Reverse (CAACTCCGGTGACATCAAAA); Col1A Forward (AGGAAGGGCCACGACAAAG) Reverse (CCCGGTGACACATCAAGACA); Col3A Forward (GGCTACTTCTCGCTCTGCTTCA) Reverse (CGGATCCTGAGTCACAGACACA); p21 Forward (AAGACCATGTGGACCTGTCACTGT) R (GAAGATCAGCCGGCGTTTG); cyclin E Forward (GTTATAAGGGAGACGGGGAG) Reverse (TGCTCTGCTTCTTACCGCTC); cyclophilin A Forward (GACTGAGTGGTTGGATGGCA) Reverse (TCGAGTTGTCCACAGTCAGC).

2.12. Measurement of neutral sphingomyelinase2 enzyme activity The nSMnase2 activity was determined in cell lysates using Amplex Red Sphingomyelinase Assay kit (Molecular Probes, Invitrogen, Carlsbad, CA) as per manufacturer’s instructions. The reaction was carried out using total cell extracts for 30–60 min at 37 °C and fluorescence data was measured in a fluorescence micro plate reader using excitation at 530 nm and emission 590 nm. The total protein was equalised and average activity per microgram (activity/μg) was calculated. The effect of HBx on nSMNase2 activity was also determined in the presence of purified recombinant HBx (X0-MBP) and MBP (Sidhu et al., 2014). 2.13. Immuno gold labelling and transmission electron microscopy The exosome samples were labelled with anti CD63 antibody and Protein A conjugated to 10 nm colloidal gold particle using protocol described in Théry et al. (2006). Briefly, the exosomal pellet was re-suspended in 2% Paraformaldehyde and adsorbed on a 400 mesh copper grid with a carbon-coated Formvar support followed by blocking with BSA. The grids were labelled with anti CD63 antibody followed by 10 nm colloidal gold protein A. After several washes with distilled water grids were stained with 1% uranyl acetate and viewed under the 120 kV mode of transmission electron microscope (Tecnai 12BioTWIN, FEI Netherlands). Photomicrographs were digitally recorded using a Megaview II (SIS, Germany) digital camera. Image analysis was carried using Analysis II (Megaview, SIS, Germany).

2.9. Isolation of total RNA from exosomes

Exosomal pellet collected after centrifugation was re-suspended in Trizol Reagent and RNA was isolated following manufacturer instructions. tRNA (1 μg) was added to the samples along with isopropanol to

3

N.R. Kapoor et al.


65 min, 45% to 100% B for 1 min and 100% B for 10 min. The column eluents were directed to a Proteineer fc fraction collector (Bruker Daltonics, Germany)) and fractions were spotted every 10 s onto Pre-spotted anchor chip 384/96 (PAC) target plates. Measurements were performed using an Ultraflex III MALDI TOF/ TOF instrument (Bruker Daltonics, Germany), in the positive ion reflector mode. The instrument parameters for acquisition and analysis were set as described by Kumar et al. (2013). The final mass spectra were produced by averaging 1500 laser shots. The Peptide Mass Fingerprint (PMF) pattern of the tryptic peptides were further annotated using Flexanalysis software (version 3.0). For MS/MS based sequencing and identification of protein from the peptide, the parameters as reported earlier (Sidhu et al., 2014) were used during acquisition and analysis. Briefly, the precursor peptide ions were fragmented in positive mode using the LIFT.lft method (Bruker Daltonics, Germany). Fragmented peptides were analysed and annotated using Flexanalysis (version 3.0) and were subjected to database search using Biotools (version 3.2). The database search parameters were set as: enzyme – Trypsin; taxonomy – unrestricted; fixed modifications-carbamidomethyl (C); variable modifications – oxidation (M); no restriction on protein mass; allowed up to 1 missed cleavage. The fragment masses (tandem mass spectrum, MS/MS) were searched in NCBInr database with MS tolerance of ±100 ppm and MS/MS tolerance of ±0.75 da. The following criteria were used for identification: (i) significance threshold was set to achieve p < 0.05; and (ii) peptides with individual ion score >45 were only considered for protein identification.

2.14. Nanoparticle tracking analysis

PR OO F

Exosome sample was diluted in filtered distilled water and injected in NANOSIGHT™ NS500 equipped with NTA version 2.3 analytical software (Nanosight Ltd., Wiltshire, UK) as per standard procedure recommended by the manufacturer. A batch report of 5 independent readings was generated. Distilled water served as a negative control. 2.15. In vitro translation of exosomal RNA Total RNA isolated from exosome preparation as described above was in vitro translated using TNT coupled Reticulocyte lysate systems (Promega Corporation, USA) following manufacturer’s instruction. Briefly 100 ng of Exosomal RNA was mixed with Rabbit reticulocyte lysate and amino acid mix (provided in the kit). The reaction was incubated at 30 °C for 90 min The reaction mix was boiled with 4 x LB and loaded on a 17% SDS PAGE gel. The band of interest was excised from the gel after commassie brilliant blue staining and was processed further for in gel digestion as MS analysis as described below. 2.16. Mass spectometry (MS) analysis of exosomal proteins

UN CO RR EC TE D

Total protein isolated after ultracentrifugation of conditioned media was re-suspended in 1xPBS and boiled in 4 x Laemmli buffer. The samples were resolved on a 17% SDS PAGE followed by staining with commassie brilliant blue for 1 h. The gel was thoroughly de stained till the bands became clear. The protein bands of interest were identified and excised from the gel (Fig. S1d). The protein bands of interest from more than one lane were excised, pooled and further subjected to in-gel digestion followed by mass spectrometry based protein identification as described below.

2.19. MTT assay

LX-2 cells seeded at 70% confluency in 6 well cell culture dishes were incubated with Exosomes for 24 h. Post incubation, cells were washed with 1 x PBS followed by incubation in 1X phenol red free DMEM (Gibco BRL) with 200 μl of MTT reagent (Stock 1 mg/ml) for 30–45 min. Cells were washed with 1 x PBS and Formazan crystals were solubilised in 1 ml DMSO. The absorbance was read at 560 nm. The mean absorbance values of three experiments were expressed as percentage of viability in relative to control.

2.17. In gel digestion for MS analysis

The excised protein bands from the SDS-PAGE were subjected to tryptic digestion as described by Shevchenko et al. (2006). Briefly, the gel pieces were rinsed with H2⁠ O and equilibrated with 100 mM ammonium bicarbonate (NH4⁠ HCO3⁠ ) for 20 min at room temperature (RT) with gentle agitation followed by washing with 1:1 NH4⁠ HCO3⁠ and acetonitrile (ACN) and dehydration with 100% ACN for 20 min at RT. After discarding the ACN solution, gel pieces were air dried. The protein sample in the gel was reduced with 10 mM dithiothreitol in 50 mM NH4⁠ HCO3⁠ for 45 min at 56°C followed by alkylation with 50 mM iodoacetamide in 50 mM NH4⁠ HCO3⁠ for 30 min in dark at RT. The gel pieces were rinsed briefly with 1:1 NH4⁠ HCO3⁠ and ACN solution and dehydrated with 100% ACN for 20 min followed by air drying. The gel pieces were incubated with Trypsin (Promega) at a final concentration of 10–15 ng/μl in 25 mM NH4⁠ HCO3⁠ , pH 8.0 for 16 h at 37°C. The peptides were extracted twice with 50 μl of 1% trifluroacetic acid (TFA) in 60% ACN and the extracts were pooled and vacuum dried.

2.20. Trypan blue exclusion assay LX-2 cells incubated with exosomes for 24 h were trypsinized and centrifuged at 800 x g for 5 min to collect the cell pellet. The pellet was re suspended in a DMEM and mixed with 0.4% solution of Trypan blue in a ratio of 1:1. Live and dead cells were counted on a Neubauer chamber under 10 x magnification using Nikon ECLIPSE TE 2000-S inverted microscope microscope. Atleast 10 random fields were counted for each sample. The experiment was repeated thrice. The percentage of live and dead cells was plotted compared to the control. 2.21. Statistical analysis

2.18. Nano-LC MALDI TOF/TOF based protein identification

The statistical significance of results was calculated with Student’s t-test. A p-value of 2 fold) in the enzyme activity (Fig. 1d). The enhancement in enzyme activity was comparable to that induced either by tumour necrosis factor alpha (Moylan et al., 2014) (data not shown) or after enforced expression of nSMNase2 or using a more oncogenic HBx mutant X15 (Supplementary Fig. S1b) (Kumar et al., 1996). The regulatory role of HBx on nSMnase2 activity was further confirmed in vitro using recombinant HBx-MBP fusion protein (X0-MBP) (Sidhu et al., 2014). As compared to MBP control, there was a marked increase in the enzyme activity (p < 0.05) in the presence of X0-MBP (Fig. 1e). Further, the levels of Rab GTPases Rab27a and Rab27b that participate in exosome secretion (Ostrowski et al., 2010), were found to be up-regulated in hepatoma cells in the presence of HBx (Fig. 1f). Under these conditions, there was a marked increase in the exosomal surface markers such as CD63, CD9, CD81 and Alix without much change in their total cellular content (Fig. 1g). Interestingly, HBx co-localized with CD81 (Pearson’s correlation, 0.7 and Mander’s overlap, 0.92) and CD63 in the cell (Pearson’s correlation, 0.3 and Mander’s overlap, 0.7) suggesting some physiological significance of these interactions (Fig. 1h). The interaction of exosomal biomarkers with HBx was further confirmed by co-immunoprecipitation which showed specific pull-down of CD9, CD81 and nSMnase2 proteins (Supplementary Fig. S1c). Thus, the preceding data strongly suggested that viral HBx can tweak the exosomal machinery in their target cells.

3.3. Exosome-bound HBx mRNA can express viral protein

To show whether HBx mRNA encapsulated within exosomes can express HBx protein, we performed in vitro translation of the total RNA isolated from exosomes derived from the HBx-expressing and control cells and analysed the gene products by mass spectrometry. The presence of unique peptide fingerprints corresponding to HBx polypeptide confirmed that the HBx mRNA entrapped inside exosomes could express the viral protein (Table 1, Supplementary Fig. S2 and Table S1). However, RNA isolated from control cells did not express HBx protein (Supplementary Table S1a). 3.4. Intercellular transport of HBx protein via exosomes

UN CO RR EC TE D

Taking into account the specific interaction of HBx protein with nSMnase2, CD9 and CD81 and its co-localisation with CD9 and CD63 (Fig. 1), we also looked for the presence of HBx protein in exosomes. As our effort to detect HBx by western blotting of exosomes was unsuccessful, owing perhaps to the presence of trace amounts of entrapped HBx protein, we next analysed gel-extracted protein samples from exosomes for mass spectrometry (Supplementary Fig. S1d). The mass spectrometry data confirmed the presence of unique peptides corresponding to HBx protein and thus, the presence of HBx in exosomes (Table 1, Supplementary Fig. S3 and Table S2). As expected, control exosomes did not show any signatures of HBx protein (Supplementary Table S2a). 3.5. HBx can stimulate HSCs via exosomes Since stimulation of HSCs via paracrine regulation is central to maintenance of liver homeostasis (Yin et al., 2013), we wondered if exosomes derived from the HBx-expressing cells would alter the physiology of HSCs. To test this, exosome was isolated from the HBx-expressing hepatoma cells was overlaid on the human hepatic stellate cell line, LX-2 and the markers of its activation and growth promoting factors were analysed by western blotting. As shown in Fig. 3a, there was a marked increase in the levels of growth factor receptor c-Met and proliferative signalling molecules pAkt and PCNA. Besides, the levels of alpha-smooth muscle actin (αSMA), a hallmark of fibrosis, was also up-regulated in LX-2 cells. However, HSCs treated with exosomes derived from control or vector transfected cells, did not exhibit a similar activation profile. Thus, the positive effect of HBx exosomes on stellate cells appears due to the presence of HBx mRNA and protein rather than their increased number in exosomal preparations. Further, we analysed the expression of genes related to the HSC activation and fibro-genesis such as αSMA, Col1A, Col 3A and TGFβ in LX2 cells by qRT-PCR. We observed that the exosomes derived from HBx-expressing cells stimulated the expression of these genes suggesting a paracrine regulation of quiescent HSCs via exosomes (Fig. 3b). Increase in the transcripts of Cyclin E and EGFR genes suggested a role of exosomes in cell proliferation. Additionally, transcript levels of cyclophilin A, a marker of inflammation and carcinogenesis, were found ⁠ af1, a cell cyto be up-regulated (∼2.5 fold) whereas the levels of p21W cle inhibitor, were down-regulated (Fig. 3b). Interestingly, the treatment of LX-2 cells with conditioned media from the HBx-expressing cells led to a drastic increase in proliferation rate of these cells as determined by Trypan blue staining and MTT assay (Supplementary Figs.

3.2. HBx mRNA is transported in exosomes

The onco-proteins of DNA tumour viruses such as LMP-1 of Epstein Barr virus can use exosomal route to horizontally transfer their mRNA (Pegtel et al., 2010). Therefore, we asked if HBV can also engage exosomes to spread its gene products from an infected cell to adjacent naïve cells. We used TaqMan-based quantitative Real Time-PCR (qRT-PCR) to show the presence of HBx mRNA in exosomes. Exosomes isolated from the HBx-expressing cells were purified on a sucrose cushion to remove any adherent contaminating molecules and the RNA content was analysed by qRT-PCR. As shown in Fig. 2a, increased levels of HBx mRNA (p < 0.05) were found in these vesicles. The presence of HBx mRNA was further detected in exosomes isolated through total exosome isolation solution (Fig. 2b) as well as in exosomes immune-precipitated with anti-CD9 antibody (Fig. 2c). To demonstrate that the HBx mRNA was encapsulated inside the vesicles, the exosomal preparations were treated with RNase A or DNase I prior to RNA isolation and its quantification. Interestingly, treatment with RNase A (Fig. 2d) or DNase I (Fig. 2e) did not reduce the mRNA levels suggesting their entrapment inside exosomes and consequent protection from nuclease digestion. Furthermore, treatment of total exosomal RNA with DNase I also did not decrease the HBx mRNA levels and ruled out the possibility of any contaminating HBx expression plasmid in the samples (Fig. 2f). These data clearly establish that the HBx mRNA is specifically packaged inside the exosomal vesicles and unlikely to be an artefact of HBx overexpression in cells. The exosomal association of HBx mRNA was further confirmed in exosomes

5


UN CO RR EC TE D

PR OO F

N.R. Kapoor et al.

Fig. 1. Exosome biogenesis and nSMnase2 activity in the presence of HBx. (a) Exosomes derived from vector control (pSG5) or X0- transfected Huh7 cells were counted by Nanoparticle tracking analysis. Fold change in particle number was determined from 5 independent observations. (b) Exosomes were immuno-gold labelled for anti-CD63 and visualized by transmission electron microscopy. Scale bar: 100 nm. Cell lysates from Vector or HBx-transfected cells with were analysed for nSMnase2 transcripts by qRT-PCR (c), nSMNase2 enzymatic activity (d) or for Rab27a, Rab27b and EGFR mRNAs by qRT-PCR (f). Actin mRNA served as internal control for panel c & f. (e) cell lysates were incubated with increasing amount of in vitro purified X0-MBP or MBP and the nSMnase2 enzyme activity was measured. (g) Western blotting (WB) for exosomal markers in total cell lysates (left) or purified exosomes (right) from Huh7 cells transfected with either Vector or HBx. GAPDH served as internal control. (h) Huh7 cells transfected with HBx-GFP (Green) were fluorescently labelled with anti-CD81 (Red) antibody and analysed by confocal microscopy. Asterisks, p < 0.05 demonstrates statistical significant difference from vector control. The data is representation of three independent experiments.

6


UN CO RR EC TE D

PR OO F

N.R. Kapoor et al.

Fig. 2. Encapsulation of HBx mRNA in exosomes: Exosomes derived from equal number of Huh7 cells transfected with Vector or HBx expression plasmid and: (a) purified on sucrose cushion, (b) isolated using total exosome isolation solution, or (c) isolated by immunoprecipitation with anti CD9 antibody. Total RNA was isolated and the HBx mRNA was quantified by Taqman based qRT-PCR. Ct values were normalised with total input RNA as per standard procedure and plotted as relative HBx levels. Exosomes purified on sucrose cushion were: (d) treated with RNAse A or (e) DNase I and the level of HBx transcript was measured by qRT-PCR. (f) RNA isolated from exosomes was further treated with DNase I prior to HBx mRNA quantification as above. (g) Exosomal RNA isolated from HepG 2 or HepG 2.2.15 cells were analysed for the presence of HBx mRNA using Taqman based qRT-PCR. The relative HBx mRNA levels were determined normalisation against input RNA. *⁠ , p < 0.05 demonstrates statistical significant difference from control. #, p > 0.05 suggesting no statistical difference from control. The data is representation of three independent experiments. Table 1 Detection of HBx protein in exosomes.

Sample ID

Accession Number NCBInr

HBx mRNA from Exosomes (In vitro translation)

gi|59443

HBx protein from Exosomes

gi|59443

Theoritical Molecular weight (kDa)

Observed mass (m/z)

% Sequence Coverage

MS/MS Peptides sequenced (Ion score)$⁠

MOWSE score

X ORF [Hepatitis B virus]

17118

907.5070

21%

K.VFVLGGCR.H (64)

251

X ORF [Hepatitis B virus]

17118

24%

R.LYCQLDPSR.D (67) R.GLPVCAFSSAGPCALR.F (121) R.LYCQLDPSR.D (57)

111

Protein ID [Source]

1151.5609 1662.8859 1151.4418 1471.6451 1662.6654

R.DVLCLRPVGAESR.G (54) R.GLPVCAFSSAGPCALR.F (85)

Exosomes isolated from HBx expressing cells were resolved in a 17% SDS-PAGE followed by in-gel tryptic digestions and samples were subjected to Nano-LC MALDI TOF/TOF-based protein identification. The protein identification details and sequence of unique peptides corresponding to HBx obtained through MS/MS are shown. Total RNA isolated from exosomes was in vitro translated and the tryptic fragments were subjected to Nano-LC MALDI TOF/TOF-based protein identification as above. Protein ID, Protein name as mentioned in NCBInr database; Theo Mol wt, Theoretical molecular weight; m/z, mass/charge (M + H)+; MS/MS, tandem mass spectrometry; Ion score, Individual ion score (peptide score); $, Annotated MS/ MS spectra are shown in Suppl. Fig. S2 and S3 .

S4a and S4b). Thus, these data suggest that exosomes derived from the HBx-expressing cells carry biologically active HBx mRNA and protein that can stimulate proliferative signalling pathways in HSCs.

to transfer pathogens to their reservoirs in order to support latency. Therefore, the altered signatures of exosomal cargo could determine the fate of an infection and disease progression (Braicu et al., 2015; Colombo et al., 2014). HBV is well known to cause acute and chronic liver disease in humans including HCC. The HBx protein of HBV not only plays a critical role in viral life cycle (Lucifora et al., 2011), but is also implicated in the development of HCC where paracrine regulation of hepatic cells by HBx could play an important role (Martín-Vílchez et al., 2008). Therefore, the present study was aimed at elucidating the

4. Discussion

Hypoxic tumor cells are known to produce enhanced levels of exosomes in order to facilitate angiogenesis and tumorigenesis (Park et al., 2010). Besides, exosomes can elicit immune response as well as serve 7


PR OO F

N.R. Kapoor et al.

UN CO RR EC TE D

Fig. 3. Stimulation of hepatic stellate cells by HBx via exosomes: LX2 cells were treated for 24 h, with either plain media or exosomes (∼1 μg) derived from equal number of Vector or HBx expressing cells. The cell lysates were: (a) analysed by western blotting for growth promoting factor c-Met or proliferating signalling molecules such as pAkt and PCNA, or (b) for ⁠ af1) by qRT-PCR. In panel a, expression of genes involved in cell proliferation and fibrogenesis (e.g., aSMA, TGF-beta, Collagen 1A, Collagen 3A, cyclin E, EGFR, Cyclophilin A and p21W the protein expression levels were quantified by densitometry and shown below each panel. *⁠ , p < 0.05 demonstrates statistical significant difference from control.

role of HBx in intercellular communication via exosomes that may impact liver homeostasis. We observed a significant increase in exosome number secreted by the HBx-expressing hepatoma cells. Viral HBx not only interacted and co-localised with key biomarkers of exosomes but also induced the activity of nSMnase2, a key enzyme involved in exosome biogenesis, leading to increased production of exosomes (Fig. 1). Further, there was a marked increase in nSMnase2 activity in the presence of a biologically active X15 mutant of HBx (Supplementary Fig. S1b) which correlated with aggressive tumour development in a transgenic mouse model of HCC (Singh and Kumar, 2003). The interaction of HBx with nSMnase2 could induce some allosteric change in the latter or facilitate its phosphorylation leading to increased enzymatic activity. However, the role of ROS for increased nSMnase2 activity is not ruled out. Since, increased expression of signal transducer tetraspanins are known to correlate with increased malignancy, invasive potential and metastasis of tumour cells (Hemler, 2014), the enhancement in tetraspanins like CD9 and CD81 in exosomes alongside growth factors (Figs. 1g and 3) reiterated the role of HBx in tumorigenesis. The present study also provided evidence for alterations in the exosomal cargo in the presence of HBx as evident from packaging of HBx mRNA and protein in these vesicles (Supplementary Fig. S2, Fig. S3 and Table 1). The viral mRNA was specifically encapsulated in exosomes rendering it insulated from any nuclease attack (Fig. 2). The encapsulation of viral mRNA in exosomes also hints at a possible a non-canonical receptor-independent mode of HBV transmission by which virions could evade immune surveillance and perhaps cause viral latency. Further, the presence of HBV in non-permissive cells could relate to exosome-mediated viral transmission in order to serve as viral reservoirs from which viruses can be reactivated at a later stage thereby setting stage for chronic infection (Lai et al., 1996; Seifer et al., 1990). The transfer of viral components, in this case HBx mRNA and protein, also points towards the existence of an alternate mechanism whereby the cellular transformation and pathophysiological changes can be brought about in non-permissive cells such as HSCs through transfer of host or viral oncogenic factors via exosomes. This mechanism may also play a significant role in acute HBV infections characterised by active

viral replication. During acute infection, exosomes could be involved in immune activation through transfer of viral antigens to immune cells and thus, expedite viral clearance. Though our data provides evidence for active transport of viral components and antigens via exosomes, this observation requires confirmation in a clinical setting. In this regard, a recent study in the sera of chronic hepatitis B patients confirmed the presence of both HBV nucleic acids and HBV proteins in exosomes. It was postulated that these exosomes could have a role in viral transmission and dysfunction of natural killer cells (Yang et al., 2016). Moreover keeping in view, the indispensable role of HBx in viral replication and secretion of complete HBV virion (Lucifora et al., 2011) it is tempting to speculate a role of HBx in HBV packaging and egress owing to its role in exosome biogenesis and secretion. Furthermore, our observation that the HBx mRNA entrapped in exosomes could be translated into HBx protein as evident from our MS studies (Table 1, Supplementary Figs. S2,S3 and Supplementary Tables S1,S2) strongly suggest that the viral components transported via exosomes retain biological activity which could alter the property of recipient cells . 5. Conclusions

The data presented here clearly establishes that viral HBx is capable of overtaking the host exosomal biogenesis machinery. It modulates the exosomal signature to carry biologically active viral components which can alter the physiology of neighbouring liver cells otherwise not exposed to the virus. Such exosome-dependent intercellular communication would allow virus to modulate the tissue microenvironment obviating the need of physical presence of the virus. Besides, exosomal modulation by HBx may be clinically relevant as identification of viral components in exosomes derived from patient sera can be used to derive important information about the stage and grade of disease. Conflicts of interest The authors declare no conflict of interest.

8

N.R. Kapoor et al.


Acknowledgements

(Eds.), Handbook of Experimental Pharmacology. Springer-Verlag, Berlin, pp. 377–407. Kumar, V., Jayasuryan, N., Kumar, R., 1996. A truncated mutant (residues 58–140) of the hepatitis B virus X protein retains transactivation function. Proc. Natl. Acad. Sci. U. S. A. 93, 5647–5652. Kumar, S., Kumar, K., Pandey, P., Rajamani, V., Padmalatha, K.V., Dhandapani, G., Kanakachari, M., Leelavathi, S., Kumar, P.A., Reddy, V.S., 2013. Glycoproteome of elongating cotton fiber cells. Mol. Cell. Proteomics 12, 3677–3689. Lai, K.N., Ho, R.T., Tam, J.S., Lai, F.M., 1996. Detection of hepatitis B virus DNA and RNA in kidneys of HBV related glomerulonephritis. Kidney Int. 50, 1965–1977. Li, J., Liu, K., Liu, Y., Xu, Y., Zhang, F., Yang, H., Liu, J., Pan, T., Chen, J., Wu, M., Zhou, X., Yuan, Z., 2013. Exosomes mediate the cell-to-cell transmission of IFN-α-induced antiviral activity. Nat. Immunol. 14, 793–803. Lucifora, J., Arzberger, S., Durantel, D., Belloni, L., Strubin, M., Levrero, M., Zoulim, F., Hantz, O., Protzer, U., 2011. Hepatitis B virus X protein is essential to initiate and maintain virus replication after infection. J. Hepatol. 55, 996–1003. Madison, M.N., Okeoma, C.M., 2015. Exosomes: implications in HIV-1 pathogenesis. Viruses 7, 4093–4118. Martín-Vílchez, S., Sanz-Cameno, P., Rodríguez-Muñoz, Y., Majano, P.L., Molina-Jiménez, F., López-Cabrera, M., Moreno-Otero, R., Lara-Pezzi, E., 2008. The hepatitis B virus X protein induces paracrine activation of human hepatic stellate cells. Hepatology 47, 1872–1883. Melo, S.A., Sugimoto, H., O'Connell, J.T., Kato, N., Villanueva, A., Vidal, A., Qiu, L., Vitkin, E., Perelman, L.T., Melo, C.A., Lucci, A., Ivan, C., Calin, G.A., Kalluri, R., 2014. Cancer exosomes perform cell-independent microRNA biogenesis and promote tumorigenesis. Cancer Cell 26, 707–721. Mori, Y., Koike, M., Moriishi, E., Kawabata, A., Tang, H., Oyaizu, H., Uchiyama, Y., Yamanishi, K., 2008. Human herpesvirus-6 induces MVB formation, and virus egress occurs by an exosomal release pathway. Traffic 9, 1728–1742. Moylan, J.S., Smith, J.D., Wolf Horrell, E.M., McLean, J.B., Deevska, G.M., Bonnell, M.R., Nikolova-Karakashian, M.N., Reid, M.B., 2014. Neutral sphingomyelinase-3 mediates TNF-stimulated oxidant activity in skeletal muscle. Redox Biol. 2, 910–920. Nojima, H., Freeman, C.M., Schuster, R.M., Japtok, L., Kleuser, B., Edwards, M.J., Gulbins, E., Lentsch, A.B., 2016. Hepatocyte exosomes mediate liver repair and regeneration via sphingosine-1-phosphate. J. Hepatol. 64, 60–68. Ostrowski, M., Carmo, N.B., Krumeich, S., Fanget, I., Raposo, G., Savina, A., Moita, C.F., Schauer, K., Hume, A.N., Freitas, R.P., Goud, B., Benaroch, P., Hacohen, N., Fukuda, M., Desnos, C., Seabra, M.C., Darchen, F., Amigorena, S., Moita, L.F., Thery, C., 2010. Rab27a and Rab27b control different steps of the exosome secretion pathway. Nat. Cell Biol. 12, 19–30. Park, J.E., Tan, H.S., Datta, A., Lai, R.C., Zhang, H., Meng, W., Lim, S.K., Sze, S.K., 2010. Hypoxic tumor cell modulates its microenvironment to enhance angiogenic and metastatic potential by secretion of proteins and exosomes. Mol. Cell Proteomics 9, 1085–1099. Pegtel, D.M., Cosmopoulos, K., Thorley-Lawson, D.A., van Eijndhoven, M.A., Hopmans, E.S., Lindenberg, J.L., de Gruijl, T.D., Würdinger, T., Middeldorp, J.M., 2010. Functional delivery of viral miRNAs via exosomes. Proc. Natl. Acad. Sci. U. S. A. 107, 6328–6333. Ramakrishnaiah, V., Thumann, C., Fofana, I., Habersetzer, F., Pan, Q., de Ruiter, P.E., Willemsen, R., Demmers, J.A., Stalin Raj, V., Jenster, G., Kwekkeboom, J., Tilanus, H.W., Haagmans, B.L., Baumert, T.F., van der Laan, L.J., 2013. Exosome-mediated transmission of hepatitis C virus between human hepatoma Huh7.5 cells. Proc. Natl. Acad. Sci. U. S. A. 110, 13109–13113. Ratajczak, M.Z., Ratajczak, J., 2016. Horizontal transfer of RNA and proteins between cells by extracellular microvesicles: 14 years later. Clin. Transl. Med. 5, 7. Regev-Rudzki, N., Wilson, D.W., Carvalho, T.G., Sisquella, X., Coleman, B.M., Rug, M., Bursac, D., Angrisano, F., Gee, M., Hill, A.F., Baum, J., Cowman, A.F., 2013. Cell-cell communication between malaria-infected red blood cells via exosome-like vesicles. Cell 153, 1120–1133. Schey, K.L., Luther, J.M., Rose, K.L., 2015. Proteomics characterization of exosome cargo. Methods 87, 75–82. Schorey, J.S., Cheng, Y., Singh, P.P., Smith, V.L., 2015. Exosomes and other extracellular vesicles in host-pathogen interactions. EMBO Rep. 16, 24–43. Seifer, M., Heermann, K.H., Gerlich, W.H., 1990. Replication of hepatitis B virus in transfected nonhepatic cells. Virology 179, 300–311. Sheridan, C., 2016. Exosome cancer diagnostic reaches market. Nat. Biotechnol. 34, 359–360. Shevchenko, A., Tomas, H., Havlis, J., Olsen, J.V., Mann, M., 2006. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 1, 2856–2860. Sidhu, K., Kumar, S., Reddy, V.S., Kumar, V., 2014. Mass spectrometric determination of disulfide bonds in the biologically active recombinant HBx protein of hepatitis B virus. Biochemistry 53, 4685–4695. Singh, M., Kumar, V., 2003. Transgenic mouse models of hepatitis B virus-associated hepatocellular carcinoma. Rev. Med. Virol. 13, 243–253. Slagle, B.L., Bouchard, M.J., 2016. Hepatitis B virus x and regulation of viral gene expression. Cold Spring Harb. Perspect. Med. 6, a021402. Sokolova, V., Ludwig, A.K., Hornung, S., Rotan, O., Horn, P.A., Epple, M., Giebel, B., 2011. Characterisation of exosomes derived from human cells by nanoparticle tracking analysis and scanning electron microscopy. Colloids Surf. B: Biointerfaces 87, 146–150. Soung, Y.H., Nguyen, T., Cao, H., Lee, J., Chung, J., 2016. Emerging roles of exosomes in cancer invasion and metastasis. BMB Rep. 49, 18–25.

PR OO F

This research was supported by a young investigator award to Neetu Rohit Kapoor (SB/FTS/LS-181/2012) from Department of Science and Technology, Govt. of India and extramural research grants to Vijay Kumar from Council of Scientific and Industrial Research, Govt. of India [Grant No. 27(0277)/12/EMR-II] and Department of Science and Technology, Government of India [Grant No. SR/S2/JCB-80/2012]. We are thankful to Dr Takahiro Ochiya and Nobuyoshi Kosaka (NCCRI, Tokyo, Japan) for helpful discussion and sharing protocols for exosome isolation. The technical assistance by Ravinder Kumar and Confocal microscopy work by Purnima Kumar is gratefully acknowledged. We also wish to thank Prof. Harpal Singh, IIT, New Delhi for allowing us to use the Nanosight facility. Dr Kaveri Sidhu is thanked for providing purified samples of recombinant MBP and X0-MBP proteins. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.virusres.2017.08.009. References

UN CO RR EC TE D

Alenquer, M., Amorim, M.J., 2015. Exosome biogenesis, regulation, and function in viral infection. Viruses 7, 5066–5083. Benzoubir, N., Lejamtel, C., Battaglia, S., Testoni, B., Benassi, B., Gondeau, C., Perrin-Cocon, L., Desterke, C., Thiers, V., Samuel, D., Levrero, M., Bréchot, C., Bourgeade, M.F., 2013. HCV core-mediated activation of latent TGF-β via thrombospondin drives the crosstalk between hepatocytes and stromal environment. J. Hepatol. 59, 1160–1168. Braicu, C., Tomuleasa, C., Monroig, P., Cucuianu, A., Berindan-Neagoe, I., Calin, G.A., 2015. Exosomes as divine messengers: are they the Hermes of modern molecular oncology?. Cell Death Differ. 22, 34–45. Bukong, T.N., Momen-Heravi, F., Kodys, K., Bala, S., Szabo, G., 2014. Exosomes from hepatitis C infected patients transmit HCV infection and contain replication competent viral RNA in complex with Ago2-miR122-HSP90. PLoS Pathog. 10, e1004424. Canitano, A., Venturi, G., Borghi, M., Ammendolia, M.G., Fais, S., 2013. Exosomes released in vitro from Epstein-Barr virus (EBV)-infected cells contain EBV-encoded latent phase mRNAs. Cancer Lett. 337, 193–199. Colombo, M., Raposo, G., Théry, C., 2014. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu. Rev. Cell Dev. Biol. 30, 255–289. Dreyer, F., Baur, A., 2016. Biogenesis and functions of exosomes and extracellular vesicles. Methods Mol. Biol. 1448, 201–216. Giugliano, S., Kriss, M., Golden-Mason, L., Dobrinskikh, E., Stone, A.E., Soto-Gutierrez, A., Mitchell, A., Khetani, S.R., Yamane, D., Stoddard, M., Li, H., Shaw, G.M., Edwards, M.G., Lemon, S.M., Gale Jr., M., Shah, V.H., Rosen, H.R., 2015. Hepatitis C virus infection induces autocrine interferon signaling by human liver endothelial cells and release of exosomes, which inhibits viral replication. Gastroenterology 148, 392–402. Greuter, T., Shah, V.H., 2016. Hepatic sinusoids in liver injury, inflammation, and fibrosis: new pathophysiological insights. J. Gastroenterol. 51, 511–519. Hemler, M.E., 2014. Tetraspanin proteins promote multiple cancer stages. Nat. Rev. Cancer 14, 49–56. Honegger, A., Leitz, J., Bulkescher, J., Hoppe-Seyler, K., Hoppe-Seyler, F., 2013. Silencing of human papillomavirus (HPV) E6/E7 oncogene expression affects both the contents and the amounts of extracellular microvesicles released from HPV-positive cancer cells. Int. J. Cancer 133, 1631–1642. Kalamvoki, M., Deschamps, T., 2016. Extracellular vesicles during Herpes Simplex Virus type 1 infection: an inquire. Virol. J. 13, 63. Kapoor, N.R., Ahuja, R., Shukla, S.K., Kumar, V., 2013. The HBx protein of hepatitis B virus confers resistance against nucleolar stress and anti-cancer drug-induced p53 expression. FEBS Lett. 587, 1287–1292. Ko, J., Carpenter, E., Issadore, D., 2016. Detection and isolation of circulating exosomes and microvesicles for cancer monitoring and diagnostics using micro-/nano-based devices. Analyst 141, 450–460. Kogure, T., Lin, W.L., Yan, I.K., Braconi, C., Patel, T., 2011. Intercellular nanovesicle-mediated microRNA transfer: a mechanism of environmental modulation of hepatocellular cancer cell growth. Hepatology 54, 1237–1248. Kosaka, N., Iguchi, H., Yoshioka, Y., Takeshita, F., Matsuki, Y., Takeshita, F., Matsuki, Y., Ochiya, T., 2010. Secretory mechanisms and intercellular transfer of microRNAs in living cells. J. Biol. Chem. 285, 17442–17452. Kumar, V., Sarkar, D.P., 2004. Hepatitis B virus X protein: structure-function relationships and role in viral pathogenesis. In: Triezenberg, J., Kaufman, J., Gossen, M.

9

N.R. Kapoor et al.

Virus Research xxx (2017) xxx-xxx Wiley, R.D., 2006. Gummuluru S: Immature dendritic cell-derived exosomes can mediate HIV-1 trans infection. Proc. Natl. Acad. Sci. U. S. A. 103, 738–743. Yang, Y., Han, Q., Hou, Z., Zhang, C., Tian, Z., Zhang, J., 2016. Exosomes mediate hepatitis B virus (HBV) transmission and NK-cell dysfunction. Cell Mol. Immunol. 14, 465–475. Yin, C., Evason, K.J., Asahina, K., Stainier, D.Y., 2013. Hepatic stellate cells in liver development, regeneration, and cancer. J. Clin. Invest. 123, 1902–1910.

UN CO RR EC TE D

PR OO F

Syn, N., Wang, L., Sethi, G., Thiery, J.P., Goh, B.C., 2016. Exosome-mediated metastasis: from epithelial-mesenchymal transition to escape from immunosurveillance. Trends Pharmacol. Sci. 37, 606–617. Théry, C., Amigorena, S., Raposo, G., Clayton, A., 2006. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr. Protoc. Cell Biol.(Chapter 3: Unit 3.22). Tkach, M., Théry, C., 2016. Communication by extracellular vesicles: where we are and where we need to go. Cell 164, 1226–1232. Trajkovic, K., Hsu, C., Chiantia, S., Rajendran, L., Wenzel, D., Wieland, F., Schwille, P., Brügger, B., Simons, M., 2008. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 319, 1244–1247.

10