Vascular endothelial growth factor is ... - Wiley Online Library

Accepted Article

PROF. LIJUN HOU (Orcid ID : 0000-0002-7043-9612)

Article type

: Original Article

VEGF is neuroprotective against ischemic brain injury by inhibiting scavenger receptor A expression on microglia

Zheng Xu, Kaiwei Han, Jigang Chen, Chunhui Wang, Yan Dong, Mingkun Yu, Rulin Bai, Chenguang Huang, Lijun Hou*

Neurosurgery Research Institution of Shanghai, Department of Neurosurgery in Chang Zheng Hospital, Second Military Medical University, Shanghai, 200003, China.

*Correspondence should be addressed to Lijun Hou ([email protected]). Neurosurgery Research Institution of Shanghai and Department of Neurosurgery in Chang Zheng Hospital, Second Military Medical University, 415 Fengyang Road, Shanghai, 200003, China. Telephone: +862181885681.

Abbreviations used:

VEGF, Vascular endothelial growth factor; MCAO,

middle

cerebral artery occlusion; SR-A, Scavenger receptor Class A; qPCR, quantitative real-timePCR; IP, Immunoprecipitation; mNSS, modified neurological severity scores; LPS, This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/jnc.14108 This article is protected by copyright. All rights reserved.

Accepted Article

lipopolysaccharide; OGD, Oxygen and glucose deprivation; IF, Immunofluorescence; NF-κB, Nuclear factor-kappaB; IL, Interleukin.

Keywords: VEGF, VEGFR1, SR-A, microglia; ischemic brain injury. No conflicts of interest exist Abstract Vascular endothelial growth factor (VEGF) is a secreted mitogen associated with angiogenesis. VEGF has long been thought to be a potent neurotrophic factor for the survival of spinal cord neuron. However, the role of VEGF in the regulation of ischemic brain injury remains unclear. In the study rats were subjected to MCAO (middle cerebral artery occlusion) followed by intraperitoneal injection of VEGF165 (10 mg/kg) immediately after surgery and once daily till the day 10, and the expression of target genes was assayed using qPCR, western blot and immunofluorescence, and the role of VEGF165 in regulating ischemic brain injury was assayed. We found that VEGF165 significantly inhibits MCAO-induced upregulation of Scavenger receptor Class A (SR-A) on microglia in a VEGFR1-dependent manner. VEGF165 inhibits lipopolysaccharide (LPS)-induced expression of proinflammatory cytokines IL-1β, TNF-α and iNOS in microglia. More important, the role of VEGF165 in inhibiting neuroinflammation is partially destroyed by SR-A overexpression. SR-A further destroys the protective role of VEGF165 in ischemic brain injury. These data suggest that VEGF165 suppresses neuroinflammation and ischemic brain injury by inhibiting SR-A expression, thus offering a new target for prevention of ischemic brain injury.

This article is protected by copyright. All rights reserved.

Accepted Article

Introduction Ischemic brain injury often leads to persisting functional deficits in the affected patients and is one of the leading causes of death worldwide (Shi et al. 2011, Kidwell et al. 2001). Cerebral ischemia is a complex pathological process that can cause irreversible brain injury, and involves multiple mechanisms such as free-radical generation (Moro et al. 2005), oxidative stress (Akpinar et al. 2016), neuronal apoptosis and neuroinflammation mediated by activated microglia (Kim et al. 2007).

Neuroinflammation has been shown to play an

important role in different brain diseases such as Parkinson (Tansey & Goldberg 2010), Alzheimer's disease (Eikelenboom et al. 2002) and cerebral ischemic stroke (Iadecola & Alexander 2001, del Zoppo et al. 2000). Emerging studies showed that inhibition of inflammatory response contributes to decrease infarct size and neurological deficit following ischemia injury (Villa et al. 2003). Currently, the suitable therapy for inhibiting inflammatory injury following cerebral ischemia has been limited because the pathological mechanisms causing neuroinflammation remain unclear. Revealing the underlying mechanisms for the development of neuroinflammation is indispensable for developing effective therapeutic interventions for the treatment of ischemic brain injury. Vascular endothelial growth factor (VEGF) is a secreted mitogen associated with angiogenesis and revascularization (Ferrara & Davis-Smyth 1997, Hicklin & Ellis 2005). Earlier studies showed that angiogenesis and vascular remodeling play a pivotal role in the pathophysiology of chronic inflammatory diseases and may be essential for the persistence of the condition (Doige & Furneaux 1975, Guo et al. 2016). Protection by VEGF has also been demonstrated in MCAO models of stroke (Greenberg & Jin 2013). Topical application of


Accepted Article

VEGF to the cortical surface in rat brain reduces ischemic damage after transient ischemia (Hayashi et al. 1998). On the contrary, intraventricular infusion of an anti-VEGF antibody increases infarct volume after focal cerebral ischemia in rats (Bao et al. 1999). These results, together with other studies, suggest that VEGF is neuroprotective against ischemic brain injury. Scavenger receptor A (SR-A, also known as the macrophage scavenger receptor) plays regulatory roles in lipid metabolism, atherogenesis and other metabolic processes (Kelley et al. 2014). Emerging studies reveal the roles of SR-A in the regulation of innate immunity, inflammatory response, sepsis and ischemic injury (Kelley et al. 2014). Xu et al reported that SR-A expression is upregulated in brain tissue after MCAO (Xu et al. 2012). SR-A–/–mice subjected to MCAO show a less brain damage compared with WT mice. SR-A knockout results in a decrease of microglia/macrophage M1 activation with preservation of M2 markers (Xu et al. 2012). The role of SR-A in cerebral ischemia/reperfusion injury was also assayed. Lu et al demonstrated that deletion of SR-A results in a less cerebral damage (smaller infarct size) after ischemia and suppresses cerebral and systemic inflammatory response when compared with WT mice with cerebral ischemia/reperfusion (Lu et al. 2010). Based on above findings, we tested the hypothesis that VEGF is neuroprotective against ischemic brain injury by regulating SR-A expression. We demonstrated that VEGF165inhibits MCAO-induced upregulation of SR-A on microglia in vivo and in vitro. VEGF165 contributes to inhibit LPS-induced expression of proinflammatory cytokines by regulating SR-A. VEGF165 treatment also reduces infarct volume after ischemic brain injury by the mediation of SR-A.


Accepted Article

Materials and methods Reagents The recombinant VEGF165 was purchase from Biovision (Milipitas, CA, USA). The VEGF is a double, non-glycosylated, polypeptide containing 164 amino acids and having a molecular mass of 38.4 kDa. The antibodies used in the study include SR-A (sc-20444, Santa Cruz Biotechnology, CA, USA, RRID: AB_2148524), Iba1 (ab15690, Abcam, CA, USA, RRID: AB_2224403), GFAP (ab7260, Abcam, RRID: AB_305808), NeuN (ab177487, Abcam, RRID: AB_2532109) and β-actin (A5114, Sigma, RRID: AB_2335679). Enzyme-linked immunosorbent assay (ELISA) kits for IL-1β, TNF-α and iNOS were obtained from R&D Systems (Minneapolis, MN, USA). Recombinant adenovirus containing SR-A (AdSR-A) was obtained from GenePharma (Shanghai, China). The SR-A-specific siRNAs (sc-40188) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The

VEGF165-specific

siRNA

(sense

strand

sequence:

5′-AUGUGAAUGCAGACCAAAGAATT-3′) was synthesized from GenePharma as previously

described

(Castro-Rivera

et

al.

2004).

Lipopolysaccharide

(LPS)

was purchased from Sigma (St. Louis, MO, USA). The Trizol reagent, the M-MLV Reverse Transcriptase kit and Oligo(dT)18 primer was purchased from Invitrogen (Invitrogen, Carlsbad, CA). All other chemicals were from Sigma unless indicated otherwise. Drug administration The experimental protocol was approved by the Institutional Animal Careand Use Committee of the Second Military Medical University. Adult male Sprague-Dawley rats (weight, 280 ±10 g) were purchased from the Chinese Academy of Sciences (Shanghai,


Accepted Article

China), and maintained in a pathogen-free facility with a constant humidity and temperature at 12 h/12 h light/dark cycle with free access to food and water. The rats were randomly assigned into 3 groups (7 rats /group): Sham group, MCAO group and VEGF group (VEGF treatment after MCAO). Rats in VEGF group were given an intraperitoneal injection of VEGF165 (10 mg/kg) immediately after surgery and once daily till the day 10. Researchers (Kaiwei Han and Jigang Chen) blinded to the group assignment performed neurobehavioral tests, infarct volume assessment, and cell counting.

Animal models of ischemia stroke The animals were subjected to pMCAO (permanent middle cerebral artery occlusion) as previously described (Shi et al. 2011, Zhou et al. 2011). Briefly, before the operation to induce MCAO, animals were anesthetized with intraperitoneal injection of 5% choral hydrate (350 mg/kg). Then the right common carotid artery, external carotid artery and internal carotid artery were exposed through a midline cervical incision. A piece of 4/0 monofilament nylon suture with its tip slightly rounded by gently heating was inserted through the right internal carotid artery to the base of the middle cerebral artery, thus occluding blood flow to the cortex and striatum. Sham control animals were subjected to similar operations to expose the carotid arteries without occlusion of the middle cerebral artery. The total brains were quickly removed, and the total mRNA and protein were further isolated for qPCR and western blot analysis.


Accepted Article

Cell culture and treatment Rat BV2 microglial cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, Carlsbad, CA, USA) with 10% FBS (GIBCO, Carlsbad, CA) and 100 μg/mL penicillin-streptomycin (GIBCO). Mixed glial cultures were isolated from cortex of Sprague-Dawley rats as previously described (Vairano et al. 2001, Zhou et al. 2011). Primary microglial cultures were obtained from mixed cultures of cortical glial cells. Microglial cells were detached from the astrocytes monolayer by gentle shaking. Primary microglial cells were plated in 96-well plates at a density of 1.5 ×105 cells/cm2 using DMEM-F12 containing 10% FBS and antibiotics. This method acquired ~98% Iba1-positive microglial cells (Vairano et al. 2001, Zhou et al. 2011). Microglial cells were treated with VEGF165 (80ng/mL), siVEGF (50 nM), Ad-SRA (Multiplicity of infection = 5), LPS (0.5ng/μl), siSR-A (50 nM), and then the total mRNA and protein was isolated for qPCR and western blot analysis.

RNA extraction and quantitative real-time PCR (qPCR) Total RNA was extracted from brain tissues or microglial cells using Trizol reagent according to the manufacturer’s instruction. The reverse-transcription (RT) reactions were performed using an M-MLV Reverse Transcriptase kit and Oligo(dT)18 primer. qPCR was carried out using a standard SYBR Green PCR kit (Toyobo, Osaka, Japan) protocol on Applied Biosystems 7300 Real Time PCR system (Applied Biosystems, Foster City, CA). β-actin was used as aninternal control. Primer sequences of qPCR as follows: SR-A, forward


Accepted Article

primer

(AGATGACAGAGAATCAGAGGC),

(AACACAAGGAGGTAGAGAGCA);

TNF-a,

reverse

primer

forward

primer

(GCCCTGGTATGAGCCCATG),reverse primer (CGGACTCCGTGATGTCTAAG); iNOS, forward

primer

(CAGCACAGAGGGCTCAAAG),

primer(GCACCCAAACACCAAGG);

IL-1β,

forward

reverse primer

(GAAACAGCAATGGTCGGG), reverse primer (GACACGGGTTCCATGGTG).

Immunoprecipitation (IP) Cells were lysed in kinase lysis buffer (New England Biolabs, MA, USA) and lysates were incubated with anti-VEGFR1 antibodies (13687-1-AP, 1:500, Proteintech). IP was carried out as previously described (Lee et al. 2007). Western blot analysis After quantification of the protein samples using Micro BCA™ Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA), equivalent amounts of total protein (60 µg) were electrophoresed through a 12% SDS-polyacrylamide gel, and then electro-transferred to PVDF membranes (Bio-Rad, CA, USA). The blots were incubated overnight at 4°C with the indicated

antibodies

(SR-A,

sc-20444,

1:500,

Santa

Cruz;

VEGFR1

pTyr1213,

AP55933PU-N, 1:800, OriGene; VEGFR1, 13687-1-AP, 1:1000, Proteintech), and then incubated with a goat anti-rabbit/mouseHRP-conjugated secondary antibody (1:5000, Santa Cruz Biotechnology). Protein signals were visualized using a chemiluminescence substrate (Thermo Scientific, CA, USA). The intensity of the selected bands was quantified using Image J software (National Institutes of Health, Bethesda, MD).


Accepted Article

Immunofluorescence (IF) Mouse brain tissues embedded in paraffin were sectioned into 3 μm-thick slices. The slices were then deparaffinized in xylene and antigen-retrieved by microwave. The slices were incubated with indicated primary antibodies (SR-A, sc-20444, 1:200; Iba1, ab15690, 1:100; NeuN, ab177487, 1:500; GFAP, ab7260, 1:500) after blocking in 5% normal goat serum and permeabilizing in 0.5% Triton X-100 in PBS. The slices were rinsed thrice in PBS and then incubated with FITC-conjugated goat anti-goat IgG (20μg/ml, Boster Biological Technology, CA, USA) or Cy3-conjugated goat anti-rabbit IgG (20μg/ml, Boster Biological Technology) for 1 h. Fluorescence was observed using a FluoView™ FV1000 confocal microscope (Olympus, Tokyo, Japan).

ELISA IL-1β, TNF-α and iNOS levels in microglial cells were assayed after stimulation with LPS (0.5ng/μl) or VEGF plus SR-A as previously described (Shi et al. 2011). Plates were read using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA) at a 450 nm wavelength.

Cerebral infarct assessment Rats were perfused with heparinized PBS (0.05M) followed by ice-cold 15% sucrose in PBS, and brains were excised, sectioned and stained with 2% 2,3,5-triphenyltetrazolium chloride (TTC, Amresco, USA) for 10 min at 37oC. The TTC-negative areas which appeared pale were defined as infarct regions, while the normal regions appeared red. Infarct volume


Accepted Article

was measured in each slice and summed using computerized planimetry (PC-based image tools software).

Neurologic severity scores Neurologic deficits of rats were carried out at 1, 4, 7, 10 and 14 days after MCAO by the modified neurological severity scores (mNSS) as previously described (Li et al. 2016, Chen et al. 2001). The mNSS composes tests of motor function, gait, balance and reflex, and is widely used to assess the neurological function of MCAO mice. The neurologic function was graded 0–14 scores (0, no neurologic deficit; 14, maximal deficit). The assessment was conducted in triplicate and performed by investigators who blinded to the treatment and groups.

Oxygen and glucose deprivation (OGD) model Primary microglial cells were exposed to the OGD procedure according to the method described previously (Domin et al. 2016).

Statistical analysis In order to obtain 80% power in our in vivo studies, we conducted a power-analysis using our historical data to detect a statistically significant difference of 20% in one single functional test and determined to use 6–8 mice per group when feasible. All data are expressed as mean ± standard deviation (SD) from at least three separate experiments. Averaged data were compared using unpaired Student’s t test, non-parametric test or one-way


Accepted Article

ANOVA, followed by the Scheffé test. A p value of less than 0.05 was deemed statistically significant.

Results VEGF165 inhibits MCAO-induced expression of SR-A To investigate the underlying mechanism of VEGF in the regulation of ischemic brain injury, we re-analyzed a recently published microarray dataset (GSE58720) to identify the differentially

expressed

genes

associated

with

VEGF

in

MCAO

rats.

Bioinformatic analysis reveals that SR-A (macrophage scavenger receptor 1) is upregulated following MCAO, whereas VEGF treatment inhibits MCAO-induced upregulation of SR-A (Supplementary Figure.S1 and Supplementary Table.S1). Here we further investigate the role of SR-A in ischemic brain injury because SR-A plays important roles in regulating cerebral inflammatory responses (Xu et al. 2012).

The differential expression of SR-A from microarray experiments was validated using qPCR in the study. Rats were subjected to MCAO followed by treatment with VEGF165. As shown in Figure.1A, SR-A mRNA level is markedly increased after MCAO, whereas VEGF165 treatment significantly decreases the MCAO-induced upregulation of SR-A in rats by about 50%. The protein level of SR-A was further assayed in rats of sham operation, MCAO alone and VEGF-treating groups. Figure.1B showed that the protein expression of SR-A is upregulated after MCAO, whereas VEGF165 treatment markedly inhibits MCAO-induced protein expression of SR-A.


Accepted Article

VEGF165 inhibits SR-A expression on microglia in a VEGFR1-dependent manner Previous studies showed that SR-A is preferentially expressed on macrophages (Kelley et al. 2014). As the resident macrophage cells, microglial cells have also been shown to express SR-A (Zhang et al. 2014, Tichauer & von Bernhardi 2012). Microglia-mediated inflammatory responses play an important role in brain injury in ischemia (Jin et al. 2010, Kuang et al. 2014). Therefore, we next investigated whether VEGF165 regulates SR-A expression on microglia. To identify in which kind of brain cells SR-A mainly expressed after MCAO,

double

immunofluorescence

staining

was

carried

out

for

SR-A

and

a microglial marker (Iba-1), an astrocytic marker (GFAP) and a neuron marker (NeuN). As shown in Figure.2A, increased accumulation of SR-A is observed in Iba-1-positive cells after MCAO compared with the sham group, whereas VEGF165 treatment inhibits SR-A expression on microglia. GFAP or NeuN-positive cells that also are positive for SR-A can be rarely found in the overlapped images (Figure.2A). To further verify whether VEGF165 regulates SR-A expression in microglia, BV2 microglial cells were treated with VEGF165 and the expression of SR-A was assayed. Figure.2B and C showed that VEGF165 treatment results in a marked decrease of SR-A expression at the mRNA and protein level. On the contrary, knockdown of VEGF165 increases SR-A expression at the mRNA andprotein level (Figure.2D and E). Furthermore, VEGF165 attenuates the OGD-induced upregulated of SR-A in cultured primary microglia (Figure.2F). There results suggest that VEGF165 inhibits the ischemia-induced upregulation of SR-A in vitro and in vivo.


Accepted Article

VEGF is involved in the essential biology of endothelial cells by acting through its two tyrosine kinase receptors, VEGFR1 and VEGFR2 (Yamamoto et al. 2016, Gram et al. 2015). Previous studies reported that VEGFR1 is expressed in the brain and upregulated after brain ischemia (Plate et al. 1999, Hai et al. 2003). We next investigated whether VEGFR1 mediates VEGF165-induced inhibition of SR-A. Following VEGF165 treatment, total cell extracts

were

immunoprecipitated

with

an

anti-VEGFR1

antibody

followed

by

immunoblotting with an anti-phosphotyrosine antibody. Figure.3A showed that VEGF165 stimulation induces the activation of VEGFR1 in the BV2cells. We next assayed whether VEGFR1 blockade could abolish the inhibitory effect of VEGF165 on the expression of the SR-A. VEGFR1 neutralizing antibody treatment almost completely abolishes the inhibitory effect of VEGF165 on the expression of SR-A in cultured primary microglia, indicating that the role of VEGF165 is mediated by VEGFR1 (Figure.3B). VEGFR1 antibody markedly upregulates the mRNA and protein expression of SR-A in BV2 cells (Figure.3C-E). In an addition, as shown in Figure.3F, VEGFR2 neutralizing antibody does not affect the inhibitory effect of VEGF165 on the expression of SR-A in BV2 cells. These results demonstrate that VEGF165 negatively regulates SR-A expression in a VEGFR1-dependent manner in microglia.

Upregulated SR-A results in an increased neuroinflammatory response Recent evidence points to the important roles of SR-A in inflammation and ischemic injury (Kelley et al. 2014). Here we demonstrated that the expression of SR-A on microglia is dysregulated after ischemic stroke and microglia-mediated inflammatory responses play an


Accepted Article

important role in ischemic brain injury (Weinstein et al. 2010). Therefore we next investigated whether abnormal expression of SR-A is involved in neuroinflammatory response. SR-A was overexpressed in microglial cells and SR-A-overexpressed microglial cells were stimulated with LPS, and then the proinflammatory cytokines levels were assayed. As shown in Figure.4A-C, forced expression of SR-A significantly increases LPS-induced expression of proinflammatory cytokines IL-1β, TNF-α and iNOS in BV2 cells. Importantly, SR-A knockdown markedly inhibits LPS-induced expression of IL-1β, TNF-α and iNOS in BV2 cells (Figure.4D-F). These data suggest that forced expression of SR-A in microglia contributes to the secretion of inflammatory cytokines.

VEGF165 inhibits neuroinflammatory response and ischemic brain injury by regulating SR-A Our data demonstrated that VEGF165 inhibits MCAO-induced expression of SR-A on microglia and SR-A positively regulates neuroinflammation. Thus we further investigated whether SR-A mediates the role of VEGF165 in inhibiting neuroinflammation and brain injury. BV2 cells were treated with LPS, VEGF165 and SR-A, and then the inflammatory cytokines levels were assayed. Figure.5A-C showed that VEGF165 significantly suppresses LPS-induced expression of IL-1β, TNF-α and iNOS, whereas SR-A overexpression partially destroys the role of VEGF165 in inhibiting neuroinflammation. Rats were subjected to MCAO for 24 h followed by treatment with VEGF165 and SR-A, and then brains were collected and infarct volumes were analyzed. Figure.6A showed that the cerebral infraction volume 24 h after MCAO injury is significantly decreased for MCAO-injury animals treated


Accepted Article

with VEGF165 compared with vehicle controls. More important, SR-A overexpression partially destroys the role of VEGF165 in inhibiting ischemic brain injury (Figure.6A). We also assayed the expression of SR-A at the lesion edge after treatment with VEGF165. As shown in Figure.6B, VEGF165 markedly inhibits the expression of SR-A at the lesion edge. In order to assess the effects of VEGF165 on functional recovery of rats, mNSS tests were performed to assay behavioral outcomes after MCAO. Figure.6C showed that the scores of rats in VEGF165-treated group are markedly lower than those in the vehicle group at day 4 after VEGF165 treatment. SR-A partially destroys the role of VEGF165 in functional recovery of rats (Figure.6C). These data demonstrate that VEGF165 helps to inhibit ischemia-induced neuroinflammation and subsequent brain injury by regulating SR-A.

Discussion In the study, the role of VEGF165 in the regulation of ischemic brain injury and its underlying mechanism were investigated in vitro and in vivo. The current data demonstrate that (i) VEGF165 treatment decreases the expression of SR-A in rats with MCAO, (ii) VEGF165 inhibits SR-A expression on microglia in a VEGFR1-dependent manner, (iii) Upregulated SR-A promotes LPS-induced secretion of IL-1β, TNF-α and iNOS in microglia, (iv) VEGF165 effectively inhibits ischemia-induced neuroinflammation and subsequent brain injury by inhibiting SR-A expression. These results reveal a function of VEGF165 in regulating ischemic brain injury and may provide a novel opportunity to treat the disease. It is increasingly clear that post-ischemic inflammation is an essential step in the progression of brain ischemia-reperfusion injury (Shichita et al. 2012). Microglia are the


Accepted Article

primary cellular source of increased proinflammatory cytokine levels in the brain (Shichita et al. 2012, Cheng et al. 2014) and are pivotal players in the various processes of brain inflammation (Lakhan et al. 2009). Microglia are typically in a quiescent or “resting” state in the normal adult central nervous system (CNS) but can become activated as non-phagocytic microglia in areas involved in CNS inflammation. Currently, the mechanism of microglia activation is still unclear. Emerging studies demonstrated the role of SR-A in microglia-mediated inflammatory response (Yang et al. 2015). Yang et al reported that SR-A inhibition increases microglia activation and cytokine production, and sensitizes mice to intracerebral hemorrhage-induced neuron injury (Yang et al. 2015). On the contrary, other studies showed that SR-A is a positive regulator of neuroinflammation (Godoy et al. 2012, Xu et al. 2012). SR-A-deficient mice display a reduced infarct size and improve the neurological function after MCAO compared with wild-type mice controls (Xu et al. 2012). Mechanistically, SR-A inhibition results in a decrease in inflammatory microglia and attenuates nuclear factor-kappaB (NF-κB) activation in ischemic brains (Xu et al. 2012). In the study, we demonstrated that forced expression of SR-A promotes LPS-induced expression of IL-1β, TNF-α and iNOS in BV2 cells, whereas SR-A knockdown markedly inhibits LPS-induced expression of inflammatory cytokines. Our data suggest that SR-A plays an important role in positively regulating neuroinflammation. The expression of SR-A is increased after MCAO, whereas VEGF165 treatment significantly decreases the MCAO-induced upregulation of SR-A. Increased expression of SR-A is mainly observed in Iba-1-positive cells after MCAO. The GFAP or NeuN-positive cells that also are positive for SR-A can be rarely found after MCAO. Here we


Accepted Article

further demonstrated that VEGF165 inhibits SR-A expression on microglia in a VEGFR1-dependent manner. VEGFR1 blockade almost completely abolishes the inhibitory effect of VEGF165 on the expression of the SR-A in microglia. Expectedly, VEGF165 suppresses

LPS-induced

expression

of

inflammatory

cytokines,

whereas

SR-A

overexpression destroys VEGF165-induced inhibition of neuroinflammation, indicating that SR-A, at least in part, mediates the role of VEGF165 in inhibiting neuroinflammatory response. Furthermore, SR-A partially destroys the role of VEGF165 in inhibiting ischemic brain injury. VEGF plays an important role in the vascular response to cerebral ischemia because ischemia increases VEGF expression in the brain (Zhang et al. 2002) and VEGF promotes the formation of new cerebral blood vessels (Sun et al. 2003, Krum et al. 2002). Sun et al demonstrated that VEGF improves neurological performance and reduces infarct size after focal cerebral ischemia (Sun et al. 2003). VEGF also enhances the delayed survival of newborn neurons in the dentategyrus and subventricular zone, and stimulates angiogenesis in the striatal ischemic penumbra (Sun et al. 2003). In the study we further demonstrate that VEGF helps to inhibit ischemia-induced neuroinflammation and subsequent brain injury by regulating SR-A. Although current data confirm that VEGF inhibits SR-A expression on microglia and SR-A partially mediates the effect of VEGF on the regulation of cerebral ischemia injury, underlying mechanism of SR-A dysregulation following VEGF treatment remains unclear.


Accepted Article

Involves human subjects: No If yes: Informed consent & ethics approval achieved: => if yes, please ensure that the info "Informed consent was achieved for all subjects, and the experiments were approved by the local ethics committee." is included in the Methods ARRIVE guidelines have been followed: Yes => if No or if it is a Review or Editorial, skip complete sentence => if Yes, insert "All experiments were conducted in compliance with the ARRIVE guidelines." unless it is a Review or Editorial Conflicts of interest: none => if 'none', insert "The authors have no conflict of interest to declare." => otherwise insert info unless it is already included

Acknowledgments This study was supported by Program Of Shanghai Subject Chief Scientist (grant number XBR2013075). All experiments were conducted in compliance with the ARRIVE guidelines.

Author's contribution LJ-H was responsible for conducting the study and contributed to the experimental design; Z-X, KW-H, JG-C, CH-W, Y-D, MK-Y, RL-B and CG-H did the experiments and analyzed the data; Z-X and LJ-H wrote the paper, and all authors read and approved the final manuscript.

References Akpinar, H., Naziroglu, M., Ovey, I. S., Cig, B. and Akpinar, O. (2016) The neuroprotective action of dexmedetomidine on apoptosis, calcium entry and oxidative stress in cerebral ischemia-induced rats: Contribution of TRPM2 and TRPV1 channels. Scientific reports,6, 37196.


Accepted Article

Bao, W. L., Lu, S. D., Wang, H. and Sun, F. Y. (1999) Intraventricular vascular endothelial growth factor antibody increases infarct volume following transient cerebral ischemia. Zhongguo yao li xue bao = Acta pharmacologica Sinica,20, 313-318. Castro-Rivera, E., Ran, S., Thorpe, P. and Minna, J. D. (2004) Semaphorin 3B (SEMA3B) induces apoptosis in lung and breast cancer, whereas VEGF165 antagonizes this effect. Proceedings of the National Academy of Sciences of the United States of America,101, 11432-11437. Chen, J., Li, Y., Wang, L., Zhang, Z., Lu, D., Lu, M. and Chopp, M. (2001) Therapeutic benefit of intravenous administration of bone marrow stromal cells after cerebral ischemia in rats. Stroke,32, 1005-1011. Cheng, R. D., Ren, J. J., Zhang, Y. Y. and Ye, X. M. (2014) P2X4 receptors expressed on microglial cells in post-ischemic inflammation of brain ischemic injury. Neurochemistry international,67, 9-13. del Zoppo, G., Ginis, I., Hallenbeck, J. M., Iadecola, C., Wang, X. and Feuerstein, G. Z. (2000) Inflammation and stroke: putative role for cytokines, adhesion molecules and iNOS in brain response to ischemia. Brain Pathol,10, 95-112. Doige, C. E. and Furneaux, R. W. (1975) Liver disease and intrahepatic portal hypertension in the dog. The Canadian veterinary journal = La revue veterinaire canadienne,16, 209-214. Domin, H., Przykaza, L., Jantas, D., Kozniewska, E., Boguszewski, P. M. and Smialowska, M. (2016) Neuroprotective potential of the group III mGlu receptor agonist ACPT-I in animal models of ischemic stroke: In vitro and in vivo studies. Neuropharmacology,102, 276-294. Eikelenboom, P., Bate, C., Van Gool, W. A., Hoozemans, J. J., Rozemuller, J. M., Veerhuis, R. and Williams, A. (2002) Neuroinflammation in Alzheimer's disease and prion disease. Glia,40, 232-239. Ferrara, N. and Davis-Smyth, T. (1997) The biology of vascular endothelial growth factor. Endocrine reviews,18, 4-25. Godoy, B., Murgas, P., Tichauer, J. and Von Bernhardi, R. (2012) Scavenger receptor class A ligands induce secretion of IL1beta and exert a modulatory effect on the inflammatory activation of astrocytes in culture. Journal of neuroimmunology,251, 6-13. Gram, A., Hoffmann, B., Boos, A. and Kowalewski, M. P. (2015) Expression and localization of vascular endothelial growth factor A (VEGFA) and its two receptors (VEGFR1/FLT1 and VEGFR2/FLK1/KDR) in the canine corpus luteum and utero-placental compartments during pregnancy and at normal and induced parturition. General and comparative endocrinology,223, 54-65. Greenberg, D. A. and Jin, K. (2013) Vascular endothelial growth factors (VEGFs) and stroke. Cellular and molecular life sciences : CMLS,70, 1753-1761. Guo, Q., Shao, B., Du, Z. and Zhang, J. (2016) Simultaneous Determination of 25 Ergot Alkaloids in Cereal Samples by Ultraperformance Liquid Chromatography-Tandem Mass Spectrometry. Journal of agricultural and food chemistry,64, 7033-7039. Hai, J., Li, S. T., Lin, Q., Pan, Q. G., Gao, F. and Ding, M. X. (2003) Vascular endothelial growth factor expression and angiogenesis induced by chronic cerebral hypoperfusion in rat brain. Neurosurgery,53, 963-970; discussion 970-962. Hayashi, T., Abe, K. and Itoyama, Y. (1998) Reduction of ischemic damage by application of vascular endothelial growth factor in rat brain after transient ischemia. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism,18, 887-895. Hicklin, D. J. and Ellis, L. M. (2005) Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology,23, 1011-1027. Iadecola, C. and Alexander, M. (2001) Cerebral ischemia and inflammation. Current opinion in neurology,14,


Accepted Article

89-94. Jin, R., Yang, G. and Li, G. (2010) Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. Journal of leukocyte biology,87, 779-789. Kelley, J. L., Ozment, T. R., Li, C., Schweitzer, J. B. and Williams, D. L. (2014) Scavenger receptor-A (CD204): a two-edged sword in health and disease. Critical reviews in immunology,34, 241-261. Kidwell, C. S., Liebeskind, D. S., Starkman, S. and Saver, J. L. (2001) Trends in acute ischemic stroke trials through the 20th century. Stroke,32, 1349-1359. Kim, H. J., Rowe, M., Ren, M., Hong, J. S., Chen, P. S. and Chuang, D. M. (2007) Histone deacetylase inhibitors exhibit anti-inflammatory and neuroprotective effects in a rat permanent ischemic model of stroke: multiple mechanisms of action. The Journal of pharmacology and experimental therapeutics,321, 892-901. Krum, J. M., Mani, N. and Rosenstein, J. M. (2002) Angiogenic and astroglial responses to vascular endothelial growth factor administration in adult rat brain. Neuroscience,110, 589-604. Kuang, X., Wang, L. F., Yu, L., Li, Y. J., Wang, Y. N., He, Q., Chen, C. and Du, J. R. (2014) Ligustilide ameliorates neuroinflammation and brain injury in focal cerebral ischemia/reperfusion rats: involvement of inhibition of TLR4/peroxiredoxin 6 signaling. Free radical biology & medicine,71, 165-175. Lakhan, S. E., Kirchgessner, A. and Hofer, M. (2009) Inflammatory mechanisms in ischemic stroke: therapeutic approaches. Journal of translational medicine,7, 97. Lee, T. H., Seng, S., Sekine, M., Hinton, C., Fu, Y., Avraham, H. K. and Avraham, S. (2007) Vascular endothelial growth factor mediates intracrine survival in human breast carcinoma cells through internally expressed VEGFR1/FLT1. PLoS medicine,4, e186. Li, X., Zheng, W., Bai, H., Wang, J., Wei, R., Wen, H. and Ning, H. (2016) Intravenous administration of adipose tissue-derived stem cells enhances nerve healing and promotes BDNF expression via the TrkB signaling in a rat stroke model. Neuropsychiatric disease and treatment,12, 1287-1293. Lu, C., Hua, F., Liu, L. et al. (2010) Scavenger receptor class-A has a central role in cerebral ischemia-reperfusion injury. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism,30, 1972-1981. Moro, M. A., Almeida, A., Bolanos, J. P. and Lizasoain, I. (2005) Mitochondrial respiratory chain and free radical generation in stroke. Free radical biology & medicine,39, 1291-1304. Plate, K. H., Beck, H., Danner, S., Allegrini, P. R. and Wiessner, C. (1999) Cell type specific upregulation of vascular endothelial growth factor in an MCA-occlusion model of cerebral infarct. Journal of neuropathology and experimental neurology,58, 654-666. Shi, G. D., OuYang, Y. P., Shi, J. G., Liu, Y., Yuan, W. and Jia, L. S. (2011) PTEN deletion prevents ischemic brain injury by activating the mTOR signaling pathway. Biochem Biophys Res Commun,404, 941-945. Shichita, T., Sakaguchi, R., Suzuki, M. and Yoshimura, A. (2012) Post-ischemic inflammation in the brain. Frontiers in immunology,3, 132. Sun, Y., Jin, K., Xie, L., Childs, J., Mao, X. O., Logvinova, A. and Greenberg, D. A. (2003) VEGF-induced neuroprotection, neurogenesis, and angiogenesis after focal cerebral ischemia. The Journal of clinical investigation,111, 1843-1851. Tansey, M. G. and Goldberg, M. S. (2010) Neuroinflammation in Parkinson's disease: its role in neuronal death and implications for therapeutic intervention. Neurobiology of disease,37, 510-518. Tichauer, J. E. and von Bernhardi, R. (2012) Transforming growth factor-beta stimulates beta amyloid uptake by microglia through Smad3-dependent mechanisms. Journal of neuroscience research,90, 1970-1980. Vairano, M., Dello Russo, C., Pozzoli, G., Tringali, G., Preziosi, P. and Navarra, P. (2001) A functional link between


Accepted Article

heme

oxygenase

and

cyclo-oxygenase

activities

in

cortical

rat

astrocytes.

Biochemical

pharmacology,61, 437-441. Villa, P., Bigini, P., Mennini, T. et al. (2003) Erythropoietin selectively attenuates cytokine production and inflammation in cerebral ischemia by targeting neuronal apoptosis. The Journal of experimental medicine,198, 971-975. Wang, Y., Lin, S. Z., Chiou, A. L., Williams, L. R. and Hoffer, B. J. (1997) Glial cell line-derived neurotrophic factor protects against ischemia-induced injury in the cerebral cortex. J Neurosci,17, 4341-4348. Weinstein, J. R., Koerner, I. P. and Moller, T. (2010) Microglia in ischemic brain injury. Future neurology,5, 227-246. Xu, Y., Qian, L., Zong, G. et al. (2012) Class A scavenger receptor promotes cerebral ischemic injury by pivoting microglia/macrophage polarization. Neuroscience,218, 35-48. Yamamoto, H., Rundqvist, H., Branco, C. and Johnson, R. S. (2016) Autocrine VEGF Isoforms Differentially Regulate Endothelial Cell Behavior. Frontiers in cell and developmental biology,4, 99. Yang, Z., Zhong, S., Liu, Y., Shen, H. and Yuan, B. (2015) Scavenger receptor SRA attenuates microglia activation and protects neuroinflammatory injury in intracerebral hemorrhage. Journal of neuroimmunology,278, 232-238. Zhang, H., Su, Y. J., Zhou, W. W., Wang, S. W., Xu, P. X., Yu, X. L. and Liu, R. T. (2014) Activated scavenger receptor A promotes glial internalization of abeta. PloS one,9, e94197. Zhang, Z. G., Zhang, L., Tsang, W. et al. (2002) Correlation of VEGF and angiopoietin expression with disruption of blood-brain barrier and angiogenesis after focal cerebral ischemia. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism,22, 379-392. Zhou, X., Zhou, J., Li, X., Guo, C., Fang, T. and Chen, Z. (2011) GSK-3beta inhibitors suppressed neuroinflammation in rat cortex by activating autophagy in ischemic brain injury. Biochemical and biophysical research communications,411, 271-275.

Figure legend Figure.1 VEGF165 inhibits MCAO-induced upregulation of SR-A (A) Rats were subjected to MCAO followed by treatment with VEGF165 and then the mRNA level of SR-A was assayed by qPCR (n=7. n, number of rats, similarly hereinafter). Total RNA was extracted from total brains and was subjected to qPCR to analyze the expression level of SR-A in each sample. β-actin was used as an internal control. The 2-ΔΔCt method was used to determine the relative quantization of gene expression levels. *p