human psychopharmacology Hum. Psychopharmacol Clin Exp 2011; 26: 95–101. Published online 9 February 2011 in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/hup.1177
REVIEW ARTICLE
Venlafaxine modulates depression-induced behaviour and the expression of Bax mRNA and Bcl-xl mRNA in both hippocampus and myocardium Yiming Wang1,2, Zhengjun Xiao1,3, Xingde Liu4 and Michael Berk2,5,6,7,8* 1
Department of Psychiatry, Hospital Affiliated to Guiyang Medical University, Guiyang, Guizhou Province, China Department of Clinical and Biomedical Sciences Psychiatry, University of Melbourne, Victoria, Australia 3 Department of Psychology, Wu Tai Shan Hospital Affiliated to Yang Zhou Medical College, Yang Zhou, Jiangsu Province, China 4 Cardiovascular Department, Hospital Affiliated to Guiyang Medical University, Guiyang, Guizhou Province, China 5 Department of Psychiatry, University of Melbourne, Melbourne, Australia 6 School of medicine, Deakin University, Geelong, Australia 7 Mental Health Research Institute, the University of Melbourne, Victoria, Australia 8 Orygen Research Centre, Centre for Youth Mental Health, the University of Melbourne, Victoria, Australia 2
Objectives Major depressive disorder is associated with progressive brain changes and is frequently comorbid with cardiovascular disease. There may be shared pathophysiological pathways between cerebral and myocardial dysfunction that impact on apoptosis related proteins. Our aim was to examine behaviour changes of rats with chronic mild stress (CMS), explore the expression of Bax and Bcl-xl in the hippocampus and myocardium, and additionally evaluate the effects of venlafaxine on these molecular mechanisms. Methods Rats were randomly divided into three groups. The behaviour was assessed using the open field and sucrose consumption tests. Gene expression was measured by RT-PCR. Results In CMS, there was a significant reduction of movements and sucrose consumption, an increased Bax level and a decreased Bcl-xl level in both the hippocampus and myocardium. The venlafaxine group showed an increase in movements and sucrose consumption, as well as upregulated expression of Bcl-xl and downregulated expression of Bax in both the hippocampus and myocardium. Conclusions These results demonstrate that in CMS, there is an increase in pro-apoptotic pathways that is reversed by venlafaxine. This suggests that there are shared active biochemical pathways that may play a role in the process of neuroprogression that is seen in depression and cardiovascular disorders. Copyright # 2011 John Wiley & Sons, Ltd. key words — venlafaxine; major depressive disorder; chronic mild stress; apoptotic genes; hippocampus; myocardium
INTRODUCTION Major depressive disorder (MDD) is a multifaceted psychological disorder, in which psychological and social factors interact with biological pathways (Aan het Rot et al., 2009). MDD involves various psychological, physiological, cognitive, neuroendocrine function (hypothalamic–pituitary–adrenal dysfunction), behaviour and social components (Williams * Correspondence to: M. Berk, Barwon Health and Geelong Clinic, Department of Psychiatry, and Clinical and Biomedical Sciences Psychiatry, University of Melbourne, Victoria, 3220, Australia, Tel.: þ613 418573700; Fax: þ61352465165. E-mail:
[email protected]
Copyright # 2011 John Wiley & Sons, Ltd.
et al., 2006). Adverse childhood adverse experience and the effects of chronic stress on neurobiological systems are part of the pathophysiology of this disorder (Heim and Nemeroff, 2001). Adult stressors may interact with early adversity to induce the manifestation of these disorders (Heim et al., 2002). In the chronic mild stress (CMS) model of depressive mood in rodents, a series of chronic mild and unpredictable separation stressors are used. This model is accepted as a valid animal model of depression (Moreau et al., 1992), in which the behaviour and mood of rats are modelled by the behaviour changes during the open field and sucrose consumption tests Received 29 August 2010 Accepted 12 January 2011
96
y. wang
(Willner et al., 1987). In this model, there are behavioural and physiological changes relevant to depressive mood, including decreases in sexual and locomotor behaviour (D’Aquila et al., 1994). Recent research suggests that CMS induced changes mimic symptoms in human depression, suggesting face validity of the model (Li et al., 2008). In MDD, there are reported changes in molecular pathology in the amygdala and hippocampus, which play an important role in motivation emotional behaviour and memory (Holm et al., 2010; Sibille et al., 2009); however, the amygdala is poorly differentiated from other adjacent structures, which may result in high variability of data (Tebartz et al., 2001). Since the hippocampus has a clearer structure, we can obtain more accurate results for that region. There are recent data regarding cardiovascular dysfunction in the CMS model, such as elevated heart rate (HR), reduced HR variability, elevated sympathetic cardiac tone and exaggerated reactivity to stressors. (Carney et al., 1995; Grippo et al., 2003; Strekalova et al., 2004). It has been demonstrated that there is a significant relationship between depression and cardiovascular risk factors. Individuals with a history of depression have a four times higher risk of myocardial infarction (MI) than nondepressed people, and have a higher risk of mortality if they have established cardiovascular disease (Mcconnell et al., 2005). There may be shared pathophysiological pathways between cerebral and myocardial dysfunction that impact on apoptosis related proteins. Venlafaxine is an antidepressant which blocks both serotonin and norepinephrine transporters, and reduces free radical-based oxidative stress in the brain (Eren et al., 2007). There are reports that chronic stress can promote neuronal apoptosis in animal models, and that antidepressants can reduce levels of apoptosis (McKernan et al., 2009). The purpose of this study was to understand the mechanisms underpinning the relationship between depression and both cerebral and cardiovascular disease, and to examine the effects of a validated treatment on these pathways. In particular, we aimed to examine the effects of treatment on behaviour and anhedonic-like state of rats using a CMS-induced depressive model. We also attempted to
ET AL.
evaluate the apoptosis-related proteins Bax, Bcl-xl and apoptosis in the hippocampus and myocardium, to clarify the molecular mechanism of antidepressant agent venlafaxine on these pathways. Understanding these pathways could shed light on the potential neuroprotective effects of antidepressants, as well as their effects on common pathways to medical comorbidity (Maes et al. 2010a, 2010b). MATERIALS AND METHODS Animals Male Sprague-Dawley rats (n ¼ 48, weighing 200 20 g) were used for the experimental procedures. Rats were allowed to adapt to the surroundings for 1 week prior to the commencement of the experiment. Rats were randomly divided into three groups: (i) control group (n ¼ 16), (ii) CMS (n ¼ 16), (iii) venlafaxine group, in which CMS animals (n ¼ 16) were treated with venlafaxine, which was administered by gastric perfusion (15 mg/kg) once a day for 21 days. Rats in the control group were given distilled water by gastric perfusion as well. This investigation was approved by the Committee on the Guidelines for Animal Experiment at Guiyang Medical University.
Animal model In this study, the CMS model was used as a valid animal model of depression (Moreau et al., 1992). Chronic mild unpredictable stress and separation were used in the CMS and venlafaxine groups. Rats were given the following stressors (Willner et al., 1992), consisting each week of repeated periods of confinement to small (38 cm 20 cm 16 cm) cage, restraint (1 h), water deprivation (24 h), food deprivation (24 h), isolation (24 h), flashing light (3 h), forced cold water swimming (10 min) and group-housed in a soiled cage overnight. Individual stressors and length of time used each day are listed in Table 1. Stressors were used daily in a random and unpredictable order for 21 days. Open field test and sucrose consumption test. The behaviour and anhedonic-like state of rats were detected by the open field and sucrose consumption tests (Grippo et al., 2006): the behavioural response to
Table 1. Schedule of CMS
Stressor used Duration
Monday
Tuesday
Wednesday
Thursday
Friday
Saturday
Restraint
Water deprivation
Food deprivation
Isolation
Flashing light
1h
24 h
24 h
24 h
3h
Forced cold water swimming 10 min
Copyright # 2011 John Wiley & Sons, Ltd.
Sunday Group-housed in soiled cage Overnight
Hum. Psychopharmacol Clin Exp 2011; 26: 95–101. DOI: 10.1002/hup
BEHAVIOUR CHANGES OF RATS WITH CMS
97
Table 2. Primer series of Bax, Bcl-xl and b-actin gene Gene
Upstream (50 –30 )
Downstream (50 –30 )
bp
Bax Bcl-xl b-actin
CCCACCAGCTCTGAACAGTTC TGTGGCTGGTGTAGTTCTGC CATCTCTTGCTCGAAGTCCA
CCAGCCACAAAGATGGTCACT CAGAAAAGCATTCCCGAGAG ATCATGTTTGAGACCTTCAACA
500 402 300
a new environment and activating behaviour of rats was detected by the open field test which includes horizontal movements (the total number of crossing squares) and vertical movements (grooming and rearing) during a 5 min period (Willner et al., 1987). The former can be used to measure emotional activity, the latter is a measure of exploratory activity to novel environments (Erdodan et al., 2004; Mechan et al., 2002). A special white square (80 cm 80 cm 40 cm), which has 25 same sectors with black stripes on the ground was used. Each animal was separately put in the same central sector, and their activity as recorded during a 5 min period by a installed video camera. Observers analysed the results of videotapes. Sucrose consumption is a test of an anhedonia-like state of rats (Henningsen et al., 2009). The sucrose consumption test was begun 23 h after water and food deprivation. Every cage was offered a bottle of water and a bottle of 1% sucrose water. Sucrose consumption (ml) was measured after 60 min. Tissue preparation Rats were sacrificed after their last activity was recorded according to the experimental protocol. Brains and hearts were removed and washed by diethypyrocarbonate H2O. Tissues were frozen over liquid nitrogen and stored at 808C for further use. The expression of Bax mRNA and Bcl-xl mRNA were detection by reverse transcription-polymerase chain reaction (RT-PCR) Hippocampal and myocardial tissue (100 mg) was separated from brain and heart samples. Total RNA was extracted by the TRIZOL reagent (Shanghai ShengGong Biological Engineering Services Co., LTD). Primers were synthesized (Shanghai ShengGong Biological Engineering Services Co., LTD). cDNA was synthesized by the use of Oligo-dT primer and reverse transcripase. cDNA was amplified with TaqDNA polymerase for each gene by PCR (958C, 5 min, 948C 45 min, annealing 45 s (Bcl-xl 558C, Bax 598C, b-actin 578C) extending 728C 1 min, for a total of 30 cycles, extending again 728C 10 min). PCR products Copyright # 2011 John Wiley & Sons, Ltd.
were separated by electrophoresis using 1.5% agarose gel and stained by ethidium bromide. The density of each band was quantified (Scion image system). Table 2 shows Primer series of Bax, Bcl-xl and bactin gene. Statistical analysis The results were evaluated by one-way ANOVA and SNK-q of SPSS 11.5 analysis software system for multiple comparisons. Probability values
